ID: 1048966024

View in Genome Browser
Species Human (GRCh38)
Location 8:139615164-139615186
Sequence AAATAGCAACAGAAGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048966022_1048966024 6 Left 1048966022 8:139615135-139615157 CCAGCAACAAGAGATCTTCAGAA 0: 1
1: 0
2: 1
3: 10
4: 236
Right 1048966024 8:139615164-139615186 AAATAGCAACAGAAGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048966024 Original CRISPR AAATAGCAACAGAAGTAGCC AGG Intronic
No off target data available for this crispr