ID: 1048966948

View in Genome Browser
Species Human (GRCh38)
Location 8:139622119-139622141
Sequence CACACCATAGTGTTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048966946_1048966948 17 Left 1048966946 8:139622079-139622101 CCTGCCGTCTTACTACAGCATGA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1048966948 8:139622119-139622141 CACACCATAGTGTTTCTCACTGG No data
1048966947_1048966948 13 Left 1048966947 8:139622083-139622105 CCGTCTTACTACAGCATGAAAGA 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1048966948 8:139622119-139622141 CACACCATAGTGTTTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048966948 Original CRISPR CACACCATAGTGTTTCTCAC TGG Intronic
No off target data available for this crispr