ID: 1048967106

View in Genome Browser
Species Human (GRCh38)
Location 8:139623381-139623403
Sequence CTGTGCCAAGAGCAGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048967106_1048967111 4 Left 1048967106 8:139623381-139623403 CCTGGGACCTGCTCTTGGCACAG 0: 1
1: 0
2: 3
3: 22
4: 225
Right 1048967111 8:139623408-139623430 TTCCACAAACACTTCTTTCCTGG No data
1048967106_1048967114 18 Left 1048967106 8:139623381-139623403 CCTGGGACCTGCTCTTGGCACAG 0: 1
1: 0
2: 3
3: 22
4: 225
Right 1048967114 8:139623422-139623444 CTTTCCTGGAAATCTCCCAAGGG No data
1048967106_1048967113 17 Left 1048967106 8:139623381-139623403 CCTGGGACCTGCTCTTGGCACAG 0: 1
1: 0
2: 3
3: 22
4: 225
Right 1048967113 8:139623421-139623443 TCTTTCCTGGAAATCTCCCAAGG No data
1048967106_1048967115 19 Left 1048967106 8:139623381-139623403 CCTGGGACCTGCTCTTGGCACAG 0: 1
1: 0
2: 3
3: 22
4: 225
Right 1048967115 8:139623423-139623445 TTTCCTGGAAATCTCCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048967106 Original CRISPR CTGTGCCAAGAGCAGGTCCC AGG (reversed) Intronic
900148617 1:1168770-1168792 CTTTGCCAAGAGCAGGGCCTGGG + Intergenic
900312027 1:2038199-2038221 CTATGCCAAGCACAGGGCCCTGG - Intergenic
902519476 1:17007890-17007912 CTGTGCCCACAGCAGCTGCCTGG - Intronic
903690449 1:25169515-25169537 CTTTTCCAACAGCTGGTCCCTGG - Intergenic
907307335 1:53520633-53520655 CTGGGCCAGGAGCTGCTCCCAGG - Exonic
907456838 1:54581612-54581634 CTGTGCCAAGTGCTGGCCCCAGG - Intronic
907496953 1:54851610-54851632 CTGTGCCAAAGCCAGGTCCGAGG - Exonic
910552043 1:88486320-88486342 CTGTGTCAAGACCTGGTACCAGG - Intergenic
912721611 1:112025060-112025082 CAGTTCCTAGAGCAGGTCCCAGG - Intergenic
912924656 1:113903419-113903441 ATGTCCCAAGAGCATGTCCCTGG - Intronic
914751618 1:150538531-150538553 CTCTGTCAAGAGCAGGGCACAGG - Intergenic
915320334 1:155052657-155052679 CAGTGCCACCTGCAGGTCCCAGG - Exonic
918084218 1:181231513-181231535 CTATGCCAAGGTCAGGGCCCTGG + Intergenic
920529462 1:206691224-206691246 CCAGACCAAGAGCAGGTCCCAGG - Intronic
920667505 1:207974091-207974113 CTGTCCAAAGAGCAGGTTGCTGG + Intergenic
921505707 1:215967090-215967112 CTGTGTCAAGAGAGGTTCCCAGG - Intronic
922792409 1:228317613-228317635 CTGTGCCACGAGCTGGTGCCTGG + Exonic
1063118237 10:3086047-3086069 CTGTACTAAGAGCAGCTCTCAGG - Intronic
1063355183 10:5392498-5392520 CTGAGCCAAAAGCATGTACCCGG + Intergenic
1063869653 10:10403778-10403800 CTGTGGCAAGTGCATTTCCCAGG - Intergenic
1064281803 10:13957997-13958019 CTGTGCCGAGAGCAGGATCTAGG - Intronic
1065603475 10:27392983-27393005 CTGTGACAGGAGGAGGTCCAGGG + Intergenic
1069631220 10:69898091-69898113 CAGTGCCAAGCCCAGTTCCCCGG - Intronic
1069893161 10:71664490-71664512 CTGTGCCAGCAGCGGGTCCGTGG - Intronic
1070289069 10:75103230-75103252 CATTGCCAACAGCAGGACCCAGG + Intronic
1070546931 10:77459723-77459745 CTATGCCAAGAGCGGGCCCCTGG - Intronic
1070743724 10:78919958-78919980 CTGGGCCATGAGCACGTTCCAGG + Intergenic
1071260539 10:83915226-83915248 CTGTGGCAAGTGCAGGAGCCAGG + Intergenic
1071421854 10:85508450-85508472 TAGTGCCCAGAGCAGTTCCCTGG + Intergenic
1072670659 10:97426642-97426664 CTGTGCCAGGGGGAGGACCCAGG + Intronic
1072728434 10:97828967-97828989 CTGTGCCCAGGGCAGGTTCTAGG - Intergenic
1074711100 10:116178254-116178276 CTGTGCCAAGAGCCCTTCCCTGG + Intronic
1075199991 10:120394672-120394694 TTATGCCAAGAGTAGGTACCAGG + Intergenic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1076833516 10:133008587-133008609 CTGTGTCCAGACCAGGACCCGGG - Intergenic
1076888178 10:133272021-133272043 CTGTGCCAAGTCCTGGGCCCTGG - Intronic
1077160752 11:1111771-1111793 CTTGGCCCAGAGCAGGTGCCTGG + Intergenic
1080760645 11:35245775-35245797 CTCTTCCAAGAGCAGATCTCAGG - Intergenic
1082015040 11:47479180-47479202 CTGAGCCAAGCTCAAGTCCCTGG + Intronic
1083405390 11:62453543-62453565 CAGTGCCAAGTTCAGGTCCTGGG - Intronic
1083628155 11:64082478-64082500 TGGGGCCAAGAGCTGGTCCCAGG + Intronic
1084298045 11:68225923-68225945 TTGTGGCCAGAGAAGGTCCCCGG - Intergenic
1084319328 11:68364761-68364783 CTGTTCCCAGAGCAGGACACAGG + Intronic
1084761166 11:71272097-71272119 CTGGGCCAACAGCAGCCCCCAGG - Intergenic
1085442663 11:76578351-76578373 CTGGGAGAAGGGCAGGTCCCAGG - Intergenic
1088013753 11:105035072-105035094 CTGTTCCAAGAACAGGTCCCTGG - Intronic
1088014762 11:105045256-105045278 CTGTTCCAAGAACAGGTCCCTGG - Intronic
1088016870 11:105071464-105071486 CTGTCCCAAAAACAGGTCCCTGG - Intronic
1088019421 11:105101373-105101395 CTGTCCCAAAAACAGGCCCCTGG - Intronic
1089692587 11:120196109-120196131 CTGTGCAAAGAGCTGGTCGGGGG - Intergenic
1089735308 11:120546675-120546697 CTGAGCCAGAAGCATGTCCCAGG - Intronic
1090184164 11:124725427-124725449 CAGTGCCCAGAGCAAGACCCAGG + Intergenic
1090259504 11:125308502-125308524 CTCTCCCAAGAGCAGCTCCCCGG + Intronic
1091700229 12:2654151-2654173 CTCTACCAAGAGCAGAACCCAGG - Intronic
1092162238 12:6322070-6322092 CTGTGCCCAGTGCTGGCCCCAGG - Intronic
1093749535 12:22782274-22782296 GTGTGCCATGAGCAGGTTCATGG - Intergenic
1096814404 12:54192700-54192722 CTGTGCCAAGGACATGTCCTTGG - Intergenic
1098356431 12:69616904-69616926 AGGTGCCAAGAGCAGGTCTAAGG + Intergenic
1102165230 12:110800821-110800843 ATATGCTAAGAGCAGGTCCCAGG - Intergenic
1104053492 12:125211866-125211888 CTGTGGGCAGAGCAGGTCTCAGG + Intronic
1104579777 12:130002706-130002728 CTCTGCCTATTGCAGGTCCCAGG + Intergenic
1106115348 13:26812848-26812870 ATGGGCCATTAGCAGGTCCCAGG - Intergenic
1106348024 13:28898429-28898451 CTGTGGAAAGAGCAGGGCTCTGG - Intronic
1106788297 13:33129358-33129380 CTGGGCAGAGAGCAGGTCCCTGG - Exonic
1110684177 13:78352202-78352224 CTGGGCCAAGAACAGGACACTGG - Intergenic
1112387553 13:98954347-98954369 AAGTGCCAGGATCAGGTCCCAGG + Intronic
1113766832 13:112887317-112887339 GTGTGCCAGGTGCAGGGCCCTGG + Intergenic
1113786303 13:113003676-113003698 CAGAGCCTGGAGCAGGTCCCGGG - Intronic
1115311940 14:31987651-31987673 CTGTGGCAAGAATATGTCCCAGG + Intergenic
1116924519 14:50620437-50620459 CTGTGAGAAGAGCAGGTTTCAGG + Intronic
1118765235 14:68905023-68905045 GTGTGCCAAGGGCAGGGCACTGG + Intronic
1118836302 14:69480387-69480409 TTGTGCCAAGTGAAGGACCCAGG - Intergenic
1119472696 14:74909547-74909569 CTGGTCCAGGAGCAGGTTCCCGG + Exonic
1122409587 14:101519048-101519070 CTTTGCATACAGCAGGTCCCGGG + Intergenic
1123032277 14:105457539-105457561 CTGTGCCCCCAGAAGGTCCCTGG + Intronic
1125157876 15:36609743-36609765 CAGTGCTAAGAGCATGGCCCTGG + Intronic
1127382877 15:58444850-58444872 CAGTGCCAAGCCCAGGACCCGGG - Intronic
1131094899 15:89648840-89648862 CCGCGCCAGGAGCCGGTCCCAGG - Intronic
1132467735 16:85264-85286 AGGTGCACAGAGCAGGTCCCTGG + Intronic
1133627479 16:7584589-7584611 CTGTATCAAGAGCAGGATCCAGG - Intronic
1134040855 16:11067334-11067356 CTGTTCTAAGAGCAGGTGACGGG + Intronic
1136293638 16:29290079-29290101 TGGTGCCAGGAGCAGGTCCTGGG - Intergenic
1137505635 16:49051735-49051757 GTGTGCCAGGAGCAGCTGCCAGG + Intergenic
1137553692 16:49456897-49456919 CTGGGTCAGGAGTAGGTCCCAGG - Intergenic
1137865655 16:51893449-51893471 CTGTGCAAAGAGCAGATTACAGG + Intergenic
1139071220 16:63385884-63385906 CTGTGCCAAGAGCCAGCCACAGG + Intergenic
1142099520 16:88264085-88264107 TGGTGCCAGGAGCAGGTCCTGGG - Intergenic
1142982210 17:3678840-3678862 CTGTGCGGTGAGCAGGTGCCTGG - Intronic
1146655179 17:34630804-34630826 CTGGGGCCAAAGCAGGTCCCTGG - Intronic
1147053283 17:37814323-37814345 ATCTACCAAGAGGAGGTCCCCGG + Intergenic
1150175450 17:63049989-63050011 CTGTGAGAGGAGCAGGTTCCTGG + Intronic
1152315763 17:79579481-79579503 CCCTGCCCCGAGCAGGTCCCAGG - Intergenic
1152889041 17:82869721-82869743 CTCTGCCCAGAGCAGGTCTGGGG - Intronic
1153773475 18:8433528-8433550 CTGTGCCTCCAGCAGGTCACCGG + Intergenic
1153781602 18:8499976-8499998 CTGTTCTCAGAGCAGGTCCCTGG - Intergenic
1154076107 18:11203382-11203404 CCATGTCCAGAGCAGGTCCCTGG + Intergenic
1155053528 18:22167243-22167265 CTGCGGGAAAAGCAGGTCCCCGG + Intergenic
1155803207 18:30135259-30135281 GTGTGCCAAGACCATGTCACTGG - Intergenic
1156454509 18:37285411-37285433 CTCTGCCCAGAACAGGCCCCAGG - Intronic
1160959504 19:1713051-1713073 CTGGGCACAGAGCAGGGCCCTGG + Intergenic
1161977669 19:7615419-7615441 CTGGCCCAAGAGGAGGCCCCGGG + Exonic
1164608645 19:29617638-29617660 CTGTCCAAGGAGCAGGACCCTGG + Intergenic
1164682325 19:30144217-30144239 CTTTGACAAGAGCAGATCCTGGG - Intergenic
1165069359 19:33246934-33246956 CTCTGCCCAGAGCAGCTCCTGGG - Intergenic
1165121140 19:33559584-33559606 CTGTGCCTAGACCAGATACCTGG + Intergenic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
925238340 2:2298684-2298706 CTGTGCCACCAGCAGCTTCCTGG + Intronic
925277995 2:2663864-2663886 GTGTGCCTGGAGAAGGTCCCGGG + Intergenic
925901928 2:8514983-8515005 CTGTGCCAAGACCAGCCCCAGGG - Intergenic
925940271 2:8810311-8810333 CTGTGCTAAGTGCAGGTACAGGG + Intronic
926063547 2:9820010-9820032 CTGTGTGAAGAGCAGGCTCCAGG - Intergenic
926227777 2:10980705-10980727 CCGGGCCCAGAGCAGGCCCCTGG - Intergenic
926289515 2:11517314-11517336 CAGTCCAAAGAGCAGGTGCCTGG - Intergenic
926450755 2:13000934-13000956 CTGTGCCTAAAGCAGCTTCCCGG - Intergenic
930160949 2:48155778-48155800 TTGTCCCAGGAGCAGCTCCCTGG - Intergenic
932591515 2:73070783-73070805 GTGTGCCCAGAGCCAGTCCCCGG + Intronic
936741574 2:115517920-115517942 CTGTGCGAAAAGCATGGCCCTGG + Intronic
936839558 2:116753663-116753685 CTGTGCCAAGAGAAGACACCAGG + Intergenic
936938222 2:117858728-117858750 CCGTGCCACCAGCAGGTCCGAGG + Intergenic
936946113 2:117932539-117932561 CTGTGGAAAGAGCAGGGCACAGG - Intronic
937750391 2:125470149-125470171 CAGTGACAAGAGCAGGGCCTGGG + Intergenic
938219002 2:129549519-129549541 CTGTGCCTGGTGCAGGTCTCAGG + Intergenic
940376821 2:152967097-152967119 CGATGCCAAGAGCAGGAGCCTGG + Intergenic
942221239 2:173770859-173770881 CTGTGCCAAGAACAGGTAGGTGG + Intergenic
944868309 2:203883936-203883958 CAGAGCCAAGAGCAGAACCCAGG - Intergenic
946061565 2:216946240-216946262 CTGAGCCTAGGGCAGGACCCAGG - Intergenic
947689346 2:232120504-232120526 CAGTGCCAAGTGCAGGTGACGGG + Intronic
947926124 2:233924135-233924157 CAGTGTCAGGAGAAGGTCCCTGG - Intronic
948476212 2:238221439-238221461 CTGGGGCAGGAGCAGCTCCCCGG - Intergenic
948835168 2:240622875-240622897 CCGTGCCCACAGCAGGACCCTGG + Intronic
1169947910 20:11009267-11009289 TTATGCCAAGAACAAGTCCCAGG + Intergenic
1170769436 20:19319206-19319228 CTGTCCCATGAGCAGGACACTGG + Intronic
1171041844 20:21771355-21771377 CTTTGCCAAGACCAGGCCACCGG - Intergenic
1172355504 20:34276985-34277007 CTGTCCCAACAGCAGCTTCCTGG + Intergenic
1172695435 20:36819479-36819501 CTATGTCAAGAACTGGTCCCAGG - Intronic
1173607330 20:44340939-44340961 CTCTGCTCTGAGCAGGTCCCAGG - Intronic
1173818303 20:46004358-46004380 CCGTGCTAAGATCAGGTCACTGG - Intergenic
1173899643 20:46577956-46577978 CTTTGCCCAGAGCAAGTCCCTGG + Intronic
1176642538 21:9319714-9319736 CTGTGCCAAGACCAATTTCCTGG + Intergenic
1177623447 21:23627053-23627075 CCATGCCAAGATCAGGTACCTGG - Intergenic
1178300460 21:31448838-31448860 CTCTGCCAAGTGGAGATCCCTGG + Intronic
1179507655 21:41852491-41852513 CTTTGCCAAAACCAGGTGCCTGG - Intronic
1179627239 21:42655593-42655615 CTGTACCACGAGCAAGCCCCTGG + Intronic
1180183210 21:46127141-46127163 CTGGGCCCACAGGAGGTCCCCGG + Intronic
1180351552 22:11809068-11809090 CTGTTCCAAGAGCAATTTCCTGG + Intergenic
1180386652 22:12183007-12183029 CTGTTCCAAGAGCAATTTCCTGG - Intergenic
1181237392 22:21455883-21455905 CTGGGCCACCAGCAGGGCCCAGG + Intergenic
1182583089 22:31327019-31327041 GTGAGCCAAGGGCAGGGCCCAGG + Exonic
1183373440 22:37448722-37448744 CTGTGCCAGGCGCAGGCCCTGGG - Intergenic
1184224795 22:43123351-43123373 CTGTGCTGACAGCAGGTGCCTGG + Intronic
1184406586 22:44304080-44304102 CAGGGCCCAGAGCAGGTGCCAGG - Intronic
1184986838 22:48141603-48141625 GTGTGCCCAGAGCATGTCCACGG + Intergenic
1185030968 22:48442726-48442748 CAGAGCCCAGAGCAGGTCCTGGG - Intergenic
1185144043 22:49119816-49119838 CTGTCCCATGAGCAGATTCCTGG + Intergenic
949928785 3:9061814-9061836 CTTAGCCAGGAGCAGCTCCCTGG - Intronic
953221206 3:40973416-40973438 CTATGCCAAGGGGTGGTCCCTGG - Intergenic
953672450 3:44974926-44974948 CTATGCCCAGAGAAGTTCCCTGG - Intronic
953854554 3:46491140-46491162 TCGTGGCAAGAGCAGGCCCCAGG + Intergenic
954939300 3:54356390-54356412 CAGTGCCAAGAGGAGGCCTCAGG + Intronic
955228086 3:57077608-57077630 AGGTGACAAGATCAGGTCCCTGG + Intronic
956368009 3:68526181-68526203 CAATGCCAAGAGCATCTCCCTGG + Intronic
960737562 3:120797368-120797390 TTGTGAAAAGGGCAGGTCCCAGG - Intergenic
963431476 3:145211077-145211099 CTGTGCCAAGAACATTCCCCAGG + Intergenic
963906763 3:150779401-150779423 CTGTGTGAAGAGCATGTCCTCGG + Intergenic
963998605 3:151740123-151740145 ATGTGCCTACAGCAGGGCCCTGG - Intronic
964625426 3:158753885-158753907 GGGGGCCAAGAGCAGGCCCCAGG + Intronic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
1202744347 3_GL000221v1_random:85304-85326 CTGTGCCAAGACCAATTTCCTGG - Intergenic
968515316 4:1013178-1013200 CGGTGCCATGAGCACGTACCAGG - Intronic
968628319 4:1637854-1637876 GGGTGCCCAAAGCAGGTCCCAGG + Intronic
968679605 4:1908045-1908067 CTGTGCTAAGAGCAGGTGTAGGG + Intronic
968705645 4:2076171-2076193 CACTGCCAGGGGCAGGTCCCTGG + Intronic
969584076 4:8081893-8081915 CTATGACAGGTGCAGGTCCCTGG - Intronic
969835290 4:9835365-9835387 CTGTGCCCAGACCAGGACCTAGG + Intronic
971371892 4:26026640-26026662 CTGTGCCATCAGCAAGACCCGGG + Intergenic
979819427 4:125151966-125151988 GTGTGGCAAGACCAGGGCCCAGG - Intergenic
982090461 4:151875957-151875979 CTGTGCCAGGAACAGTTTCCCGG - Intergenic
985729911 5:1541291-1541313 CTGTGCACACAGCAGGGCCCAGG - Intergenic
985843887 5:2329965-2329987 CTCTGACATGCGCAGGTCCCAGG + Intergenic
986720563 5:10558194-10558216 GTTTGCCAAGAGCAGGAACCAGG - Intergenic
988540298 5:32102366-32102388 CTGGCAAAAGAGCAGGTCCCAGG - Intronic
989520587 5:42396237-42396259 CTGAGACCAGAGCAGGTGCCAGG - Intergenic
989606840 5:43252533-43252555 CAGTGCCAGGAGCAGCTCCCAGG + Intronic
992777239 5:80099048-80099070 CTGTTTCAAGAGCATGTTCCTGG - Intergenic
993598042 5:89884237-89884259 CTGTGGTAAGAGCATGTACCTGG + Intergenic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
995017712 5:107330628-107330650 CTGTCCCAAGGGCAGGTTTCAGG - Intergenic
996992655 5:129654412-129654434 CTGTGCAAATGGCAGGTGCCAGG + Exonic
997213557 5:132092614-132092636 CTATGCCAAGGGCAGAGCCCTGG - Intergenic
997225490 5:132206411-132206433 CTGTTCCAAGATGAGGTCCAGGG + Intronic
997692167 5:135834291-135834313 CCGTGCCTAGAGCAGGCACCTGG - Intergenic
997759655 5:136432987-136433009 GAGTGCCAAGAGCATCTCCCAGG + Intergenic
998132079 5:139656277-139656299 CTGTGGCAAGAGCAGGGGCCAGG - Intronic
1001964788 5:175902598-175902620 CTGTGCCAAGGCCAGGGCCCTGG + Intergenic
1002252162 5:177936590-177936612 CTGTGCCAAGGCCAGGGCCCTGG - Intergenic
1004278206 6:14256729-14256751 CTGTGACATGAGCAGGCCTCTGG + Intergenic
1004328968 6:14704008-14704030 CCCTGCCAAGACCAGATCCCTGG - Intergenic
1007545535 6:42690842-42690864 CTTTGCCAAGAGCAGGTAAAAGG - Intronic
1007648617 6:43401967-43401989 CAGTGCCAAGCTCAGGTCCCTGG + Intergenic
1009941030 6:70288145-70288167 CTGTGGGAAGAGCAGGTGTCAGG - Intronic
1014388150 6:120826473-120826495 CTCTGCCAACAGCAGGTCTCAGG - Intergenic
1015122964 6:129721384-129721406 CTCATCCAAGAGCAGGTACCAGG + Intergenic
1015434651 6:133172275-133172297 CTGAGATCAGAGCAGGTCCCGGG - Intergenic
1019934597 7:4246073-4246095 CTGGGCCTAAAGCAGATCCCAGG - Intronic
1020430651 7:8113391-8113413 CTGTCCCCACAGCAGGTGCCTGG - Exonic
1022496738 7:30857780-30857802 CTGTGCCAAGAGGATGCTCCTGG - Intronic
1022647532 7:32245116-32245138 CTATGCCAAGGGCACTTCCCAGG + Intronic
1027248070 7:76380358-76380380 GTGTCCCAAGACCTGGTCCCTGG + Intergenic
1028724059 7:94067464-94067486 CTCTGCCCACTGCAGGTCCCGGG - Intergenic
1030076722 7:105743267-105743289 CTGTGCCAAGAACTGGGGCCAGG + Intronic
1030902540 7:115142055-115142077 CTGTGCCAAGACCTGTTCCAAGG + Intergenic
1034034375 7:147803410-147803432 CGGTGCCACCAGCAGGTCCACGG - Intronic
1035302141 7:157904496-157904518 CAGTGCCCTGAGCAGGTGCCGGG + Intronic
1035362303 7:158321595-158321617 CTGGACGAAGAGCAGGACCCTGG - Intronic
1037727501 8:21495291-21495313 CAGTCTCCAGAGCAGGTCCCTGG - Intergenic
1038006831 8:23437634-23437656 CTGTGACAAGATCCGGTCCTGGG + Intronic
1038338600 8:26664992-26665014 CTGTGCCCTGAACACGTCCCAGG + Intergenic
1038779762 8:30559997-30560019 CTGTGGAAAGAACAGGCCCCTGG + Intronic
1038852881 8:31297260-31297282 CTGTGACAACAGCAGCACCCAGG + Intergenic
1042778402 8:72461604-72461626 CTGTGTAAAGATCATGTCCCAGG - Intergenic
1045532064 8:102994465-102994487 CTGTGCTAAGGTCAGGGCCCAGG - Intergenic
1045752227 8:105498597-105498619 CTGTGCTAAGAGCAGATGCTTGG - Intronic
1046648287 8:116809500-116809522 TGGTGCTCAGAGCAGGTCCCTGG + Intronic
1048967106 8:139623381-139623403 CTGTGCCAAGAGCAGGTCCCAGG - Intronic
1049168091 8:141139429-141139451 GTGTGCCAAGAGCAGAACCAAGG + Intronic
1049322615 8:142004885-142004907 CTGGGCCTGGAGCAGGTGCCCGG - Intergenic
1049670727 8:143868643-143868665 CTGCGCCCTGAACAGGTCCCTGG + Exonic
1049807481 8:144547526-144547548 CTGCTCCACAAGCAGGTCCCCGG + Exonic
1050546565 9:6714813-6714835 CTGTGCCAAGAATACTTCCCTGG + Intergenic
1056690805 9:88807271-88807293 CTGTCCAAAGAGCAGACCCCAGG - Intergenic
1058903254 9:109460120-109460142 CTGTGGGAAGAACAGGTCTCAGG - Intronic
1060216892 9:121743833-121743855 CTGTCACAGGAGCTGGTCCCAGG + Intronic
1060343919 9:122800518-122800540 CTATGCCACGAGGATGTCCCGGG + Exonic
1060394227 9:123304314-123304336 CTGAGCCAGGAGCAGGCCACAGG - Intergenic
1060645083 9:125271604-125271626 GTGAGCCAAGATCAGGTCACTGG - Intronic
1060852724 9:126890477-126890499 TTGTGCCCAGGGCAAGTCCCAGG - Intergenic
1061014368 9:127973408-127973430 CTCTGGCCAGAGCAGCTCCCAGG + Intronic
1061516766 9:131094666-131094688 GAGTGCCAAGAGCAGGCACCAGG - Intergenic
1061852437 9:133424017-133424039 CTGTGCCCAGAGCAGGGTCCAGG + Intronic
1061922548 9:133789957-133789979 CTGTGCCTCGAGCACCTCCCAGG - Intronic
1062041116 9:134404779-134404801 CTGCGCCAGGAGCAGGCCCCTGG - Intronic
1062614254 9:137388887-137388909 CTGTGCTGATAGCAGGTGCCTGG - Intronic
1203689042 Un_GL000214v1:24991-25013 CTGTGCCAAGACCAATTTCCTGG + Intergenic
1203712979 Un_KI270742v1:115253-115275 CTGTGCCAAGACCAATTTCCTGG - Intergenic
1203647233 Un_KI270751v1:79062-79084 CTGTGCCAAGACCAATTTCCTGG - Intergenic
1185445546 X:256063-256085 CTGAGCCGAGAGCCGCTCCCAGG + Intergenic
1186473190 X:9837060-9837082 CGGTGCCAAGTGCTGGTCCTTGG + Intronic
1187883354 X:23866047-23866069 CAGTGCCGAGAGCTTGTCCCTGG - Intronic
1195702231 X:107714324-107714346 CCCTGACAAGAGCAGGTCTCTGG - Exonic
1198420711 X:136468837-136468859 ATGTGCCAAGTGCAGGTACTGGG - Intergenic
1200116563 X:153772145-153772167 CTGAGCCCTGAGCAGCTCCCAGG + Intronic