ID: 1048967253

View in Genome Browser
Species Human (GRCh38)
Location 8:139624051-139624073
Sequence CTGGCTTAGGGCCCTGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048967253_1048967262 15 Left 1048967253 8:139624051-139624073 CCAACAGCAGGGCCCTAAGCCAG 0: 1
1: 0
2: 1
3: 26
4: 210
Right 1048967262 8:139624089-139624111 GGAATGCAAAGACCACACACAGG No data
1048967253_1048967256 -6 Left 1048967253 8:139624051-139624073 CCAACAGCAGGGCCCTAAGCCAG 0: 1
1: 0
2: 1
3: 26
4: 210
Right 1048967256 8:139624068-139624090 AGCCAGAGCCCCACCAACTGAGG No data
1048967253_1048967263 16 Left 1048967253 8:139624051-139624073 CCAACAGCAGGGCCCTAAGCCAG 0: 1
1: 0
2: 1
3: 26
4: 210
Right 1048967263 8:139624090-139624112 GAATGCAAAGACCACACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048967253 Original CRISPR CTGGCTTAGGGCCCTGCTGT TGG (reversed) Intronic
900320268 1:2080048-2080070 CTGACTTGGGGCCCTTCTTTGGG + Intronic
900420655 1:2554638-2554660 CAGGCTTGGGGCCTTGGTGTGGG + Intergenic
900503529 1:3018079-3018101 CTGGCTCAGGGCCCTGCCGCTGG - Intergenic
901066064 1:6495222-6495244 CTGGCATTGGGCTCTGGTGTTGG - Intronic
901344366 1:8526152-8526174 CTTGCTCAGTTCCCTGCTGTTGG - Intronic
901492150 1:9602096-9602118 CTGCCTGTGGGCCCTGCTGCTGG + Exonic
901632943 1:10656753-10656775 TGGGGTCAGGGCCCTGCTGTGGG + Intronic
902314131 1:15604783-15604805 GTGGCTGTGGGCTCTGCTGTGGG + Intergenic
902555314 1:17243239-17243261 CTGGCTTGGGGCCCTAATCTGGG - Intronic
902615109 1:17619403-17619425 CTGGCATGGGGCCCAGCTCTGGG - Exonic
903010578 1:20327425-20327447 ATGGCTTCTGGCCCTCCTGTGGG - Intronic
903067828 1:20710695-20710717 TGGGCTCAGGCCCCTGCTGTGGG + Intronic
904498751 1:30902260-30902282 ATGGCTGAGGGCCCAGCAGTGGG - Intronic
905786769 1:40764634-40764656 CTGGCTCAGGCACCTTCTGTAGG + Intronic
905794474 1:40807831-40807853 CTGCCTTTGGGCCCTGGTCTAGG + Intronic
906034116 1:42740294-42740316 CTGGCTTAGGCGGCTGCTGTGGG - Intergenic
911208364 1:95115702-95115724 CTGGCTTTGGTTACTGCTGTTGG + Intergenic
915634720 1:157178167-157178189 CTGCCATGGGGCCCTGCTCTGGG + Intergenic
916588684 1:166169203-166169225 CTAGCTTGGGGCAGTGCTGTGGG + Intergenic
918793247 1:188858069-188858091 CTGCCTATGGCCCCTGCTGTGGG + Intergenic
922332406 1:224588852-224588874 CAGGCTTTGGAACCTGCTGTGGG + Intronic
924218403 1:241848489-241848511 CAGGCTAAGGGCTCCGCTGTTGG - Intronic
924432737 1:244010364-244010386 TTGGCTGAGGCCCCTGCTGCAGG + Intergenic
1068856013 10:61798188-61798210 ATGGCTGTGGGCCCTGCTGTGGG + Intergenic
1070148290 10:73790174-73790196 GATGCTGAGGGCCCTGCTGTGGG - Exonic
1072919708 10:99566007-99566029 CTTGCAAAGGGCCCTGCTCTGGG - Intergenic
1073132071 10:101196062-101196084 CTGGCTCAGAGTCCTGCTTTGGG + Intergenic
1073191809 10:101656668-101656690 CTGGATTATGGCTTTGCTGTGGG + Intronic
1073330973 10:102669633-102669655 CTGGCTGAGGGGCCTGCAGCTGG + Intergenic
1074117094 10:110464523-110464545 CTGGCTTTGTGCCCTGGGGTGGG - Intergenic
1074988739 10:118682715-118682737 CTGGCTGCGTGCCATGCTGTCGG - Exonic
1076230566 10:128817070-128817092 CAGGCTTAGGGGGCTGCTGAGGG - Intergenic
1076883717 10:133251922-133251944 CTGGGCAGGGGCCCTGCTGTGGG + Intergenic
1076903956 10:133353096-133353118 CTGTCTCAGGCTCCTGCTGTAGG - Intergenic
1077614694 11:3666436-3666458 CTGGGCTAGGGCCCTCCTGCTGG - Exonic
1079305324 11:19316690-19316712 TTGGCTTAAGGCCGTGCTGCTGG + Intergenic
1080459648 11:32442262-32442284 CTGTTTTAGGGTCCTGGTGTAGG - Intergenic
1081724751 11:45320543-45320565 CTGGCAAGGGGCCCTGCAGTGGG + Intergenic
1081751100 11:45511864-45511886 CTCACTTAAGGCCCTGCTGCTGG - Intergenic
1083294192 11:61706482-61706504 CTGGCCGAGGGCCCTGCTCGTGG + Intronic
1083590387 11:63890239-63890261 CTGGCTCACATCCCTGCTGTGGG + Intronic
1083886849 11:65577206-65577228 CTGGATTAGGGCACAGCTGTGGG + Intronic
1083888048 11:65582239-65582261 CTGGAGCAGGGCCCTTCTGTTGG + Exonic
1084909093 11:72373122-72373144 TTGGCATAGGGCCCTTCTGGGGG - Intronic
1085452974 11:76648029-76648051 CTGGCTGAGGGTCCTTCTGTAGG + Intergenic
1088332569 11:108668979-108669001 CTGGCTTGGGGAGCTGATGTGGG + Intronic
1089341992 11:117764208-117764230 CTTTCTTAGGTCCCTGCTCTGGG + Intronic
1091294475 11:134463946-134463968 CTTGCTGAGGGCCGTGCTGCTGG + Intergenic
1091536412 12:1414179-1414201 CTGGTTCAGGGCCCTGGGGTTGG + Intronic
1091802437 12:3333187-3333209 CTCTCTTAGAGCCCTGCTTTAGG - Intergenic
1096495819 12:52038572-52038594 CTGGCTTGGGGCCCTAGTGGTGG + Intronic
1096531990 12:52248287-52248309 CTGGCCCAGGGCCCTGCTGGAGG + Intronic
1097640680 12:62177725-62177747 CTGGCTTAGGTGACTGCTGGGGG - Intronic
1098455432 12:70667543-70667565 CTGACTTAGGGCCATCATGTTGG - Intronic
1099968359 12:89474988-89475010 CTGGCACTGGGCACTGCTGTGGG + Intronic
1100420274 12:94425451-94425473 CTGACTCAGGCCCCTGCTTTAGG + Intronic
1101268726 12:103119883-103119905 TTGGCCTTTGGCCCTGCTGTTGG + Intergenic
1101416626 12:104514150-104514172 CTGGAGTAGGGAACTGCTGTAGG - Intronic
1104013172 12:124946564-124946586 CTGGCTCATGGCCCTGCCTTGGG + Intergenic
1104915353 12:132261645-132261667 CTGGGCTAGGGCACTGCTGCAGG + Intronic
1104991191 12:132624693-132624715 CTGGCTAATGGCCCAGCTGTGGG + Exonic
1105886894 13:24649926-24649948 CTGCCTTATCGCCCTGCTGCTGG + Intergenic
1106579355 13:31004125-31004147 CTCATTTAGGGCCCAGCTGTAGG - Intergenic
1107617173 13:42181707-42181729 GTGGCTGTGGGCCCTGCTGTGGG - Intronic
1110148343 13:72221280-72221302 CTGCTGTAGGTCCCTGCTGTGGG - Intergenic
1113372293 13:109734350-109734372 CTGGGGCAGGGCTCTGCTGTGGG + Intergenic
1113537069 13:111076409-111076431 CTGCATTATGGCCCTGCTGCTGG + Intergenic
1118065897 14:62189866-62189888 CTGGCTTTGGGCCCTGGCCTTGG + Intergenic
1118323226 14:64765369-64765391 CAGGCTTAGGGAGCTGCTCTGGG - Intronic
1119193446 14:72700309-72700331 TTGGTTTAATGCCCTGCTGTTGG + Intronic
1120968789 14:90190716-90190738 CTGGATCCGGGCCCTGCTTTTGG + Intergenic
1122778058 14:104131526-104131548 CTGACTTAGGGCTGGGCTGTGGG + Intergenic
1123017837 14:105384052-105384074 CTGGCTCAGGGCTCTGACGTCGG - Intronic
1123696297 15:22881434-22881456 CTGCCTGAGGGCCCTGCAGCTGG + Intronic
1124385742 15:29207069-29207091 CTGGCTGAGGGCACTGCTGCAGG - Intronic
1124645801 15:31436890-31436912 CAGGCTTAGATCCCTGCTGCAGG + Intergenic
1124691701 15:31828849-31828871 CTGGCTTAGGGACCTGCCTGGGG - Intronic
1126098754 15:45107183-45107205 CTAGTTGAGGTCCCTGCTGTGGG + Intronic
1126389011 15:48125941-48125963 CTGGCTAAAGATCCTGCTGTTGG - Intronic
1127473963 15:59314829-59314851 CTGGCTTAGGTGACTGCTGGAGG + Intronic
1128108906 15:65063880-65063902 CTGGATCAGGGGCCTGCTGCAGG + Intronic
1130693203 15:86104316-86104338 CTGTGTCATGGCCCTGCTGTTGG + Intergenic
1132574762 16:659297-659319 ATGGCTTGGGGACCTGCTGCCGG - Exonic
1134214498 16:12306654-12306676 CTGAGTTAGGCCCCTGCTGATGG + Intronic
1134230385 16:12424451-12424473 CTGTCTTAGGGCCCTTCCTTGGG + Intronic
1135220780 16:20612533-20612555 CTGGCTTAGTGGCTTGCTGAGGG + Intronic
1137715967 16:50598546-50598568 CTGGCTCAGGGCCACCCTGTCGG + Intronic
1138681244 16:58684862-58684884 CTGGCTCAGGGCAGTGCTGTCGG - Intronic
1143451296 17:7038388-7038410 CTGGCTGAGGACCCTGCTGTGGG + Exonic
1146909192 17:36637397-36637419 CTGCCTCAGGGCCCTGTTCTTGG + Intergenic
1147259167 17:39198307-39198329 CTGGGTGAGGTCCCTGCTCTTGG + Intergenic
1148441744 17:47715067-47715089 CCTGCCCAGGGCCCTGCTGTGGG - Intergenic
1148496705 17:48057187-48057209 ATGGCTGAGGGGCCAGCTGTTGG + Intronic
1150223320 17:63509271-63509293 CTGGGTAAAGGCCCTGCTGGTGG + Intronic
1151977705 17:77491868-77491890 CCGTCTGAGGCCCCTGCTGTGGG + Intronic
1152537174 17:80957550-80957572 CAGGCTTTGGGGCCTGCTCTGGG - Intronic
1155623870 18:27812547-27812569 TTGGATTAGGGCCCAGCTGATGG - Intergenic
1156048117 18:32900155-32900177 CTGGATTTGGGCTCTGCTTTAGG - Intergenic
1156525371 18:37762621-37762643 ATGGCTTAGGGAGTTGCTGTAGG - Intergenic
1158403427 18:57140952-57140974 CTGGCCAATGGCCCTGCAGTTGG + Intergenic
1160400067 18:78603716-78603738 GTGGCTTCGGGCCCCTCTGTAGG - Intergenic
1160740175 19:681935-681957 CTGATTTAGGGCCCTTCTCTAGG + Exonic
1161052024 19:2169138-2169160 CTGGCCTGGAGCCCGGCTGTGGG + Intronic
1161566261 19:5004499-5004521 CTGGCTGAGGGCATTGCTCTAGG - Intronic
1161592424 19:5134810-5134832 CTGTCTTGGGGCTCTGCTGCTGG + Intronic
1161699660 19:5787777-5787799 CTGGCTCAGGGCCCCCCAGTGGG - Intronic
1161793375 19:6373623-6373645 ATGGGTTGGGGCCATGCTGTGGG + Intronic
1163470762 19:17495716-17495738 CCCCCTTAGGGACCTGCTGTTGG + Intronic
1164896722 19:31883331-31883353 CTGGGTCCGGGACCTGCTGTAGG - Intergenic
1165198628 19:34127167-34127189 GTGGCTGTGGGCTCTGCTGTGGG + Intergenic
1165336416 19:35173201-35173223 CTGACTTCTGGCCTTGCTGTTGG - Intergenic
925103239 2:1267292-1267314 CATGCTGAGGGCCCTGGTGTGGG - Intronic
925413921 2:3656320-3656342 CTGGCTCAGGCCACTGCTCTGGG + Intergenic
926119635 2:10235056-10235078 CTGGCCTAGAGCCCAGCTGATGG - Intergenic
926127438 2:10280219-10280241 CTGAATTAGGGCCCAGCTGTGGG - Intergenic
927709422 2:25315435-25315457 CTGCCTCAGGGCTCAGCTGTGGG - Intronic
928819275 2:35341816-35341838 CTGGCTTAGGGCCCCACTGCCGG + Intergenic
928949803 2:36804486-36804508 CTGGCTTAGGGGCTTAGTGTGGG + Intronic
929195311 2:39178744-39178766 CAGACTTAGGTGCCTGCTGTGGG + Exonic
929560888 2:42955684-42955706 CTGGCTGAGGGGCCTTCTTTGGG + Intergenic
929830606 2:45343789-45343811 CTGGCTCAGGGCTCTGCTGGGGG + Intergenic
931221483 2:60292143-60292165 CTGGATTAATGCCCTGCTGGTGG - Intergenic
932006277 2:67930311-67930333 CTTGCTTAGGGAACTGCTCTTGG - Intergenic
933710268 2:85320132-85320154 CTGGCCAAGGCCCCTCCTGTGGG - Intronic
934048076 2:88188171-88188193 CTGGCACTGGGCGCTGCTGTGGG + Intergenic
937060864 2:118979544-118979566 CTGGCTGAGGCCCCTTCTCTGGG - Intronic
937104010 2:119293746-119293768 CTGGCTGATGGCCTGGCTGTGGG + Intergenic
937445986 2:121958302-121958324 CTGTAAGAGGGCCCTGCTGTAGG - Intergenic
937861576 2:126715376-126715398 CTGACTCAGGGCCCTTCAGTGGG + Intergenic
937940810 2:127284442-127284464 CAGGGTGTGGGCCCTGCTGTGGG - Intronic
938079066 2:128359627-128359649 CTGGCTTAGTGCCCTCCTTGTGG + Intergenic
938107120 2:128540050-128540072 CTGGCCTAAGGCTCTTCTGTTGG + Intergenic
938604099 2:132874426-132874448 ATGACGTAGGGCCCAGCTGTAGG + Intronic
939681134 2:145134584-145134606 CTGTCAGAGGGCCCTGCTGTAGG + Intergenic
939951620 2:148481777-148481799 CTGGGTTAGGGCCCAGGTATTGG + Intronic
945683283 2:212938704-212938726 TTGGCTTAGGGCCCATTTGTAGG - Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947151852 2:227123619-227123641 TTGGCTGAGGGCCCTGGTGATGG + Intronic
948453696 2:238094126-238094148 CTGGCCTAGGGTCCTGCTTTCGG - Intronic
948596250 2:239081616-239081638 CTGGATGAAAGCCCTGCTGTTGG + Intronic
948629258 2:239291574-239291596 CTGGCTTCGGGCCCTACCGTGGG - Intronic
1172902263 20:38343939-38343961 CTGGCTAAGGTCCCTGCTGATGG - Intergenic
1172980548 20:38938272-38938294 CTGGATTAGAGACCTGCTGGAGG - Intronic
1176216572 20:63950930-63950952 CTGCCCTAGGGGACTGCTGTGGG - Intronic
1178316229 21:31568896-31568918 CTATCTAAGGACCCTGCTGTTGG - Intergenic
1178330124 21:31682552-31682574 CTTGCTTTGGGGCCTGCTGTAGG - Intronic
1179480040 21:41671213-41671235 CTGACTTAGGGCACAGCTGTGGG - Intergenic
1180068323 21:45423897-45423919 CTCGCCCAGGGCCCTCCTGTTGG + Intronic
1180103157 21:45599350-45599372 CTGCCTAACTGCCCTGCTGTGGG - Intergenic
1180181125 21:46119137-46119159 CTGCCTCAGGGCCCCGCTCTGGG + Intronic
1182476365 22:30578747-30578769 GTGGCTTGGGGCCCTCCTCTAGG - Intronic
1183354371 22:37350549-37350571 TGGGCCTAGGGCCCTGCGGTGGG - Intergenic
1183742680 22:39677543-39677565 ACAGCTGAGGGCCCTGCTGTAGG - Intronic
1184116609 22:42426220-42426242 CAGGGTTAGGGGCCTGCTGAGGG + Intronic
949412223 3:3778401-3778423 CTGACTAAGAGCCCTGCTGGTGG + Intronic
954211236 3:49098646-49098668 CTGGCTTGGGGCCAGCCTGTGGG - Exonic
954326309 3:49866136-49866158 CTGGCTTGGGGCCCTGGACTTGG + Intronic
954493512 3:50930652-50930674 CTGGCTTGGGGCCCTGCCCAGGG + Intronic
954980387 3:54740425-54740447 CTGGCTGAAGACCCTACTGTAGG - Intronic
961112987 3:124301050-124301072 CTGCCTTAGGGCCAGGCTGTTGG - Intronic
961643313 3:128378808-128378830 CTGGCTTCGGGCCTCCCTGTGGG - Intronic
963252210 3:143114037-143114059 TTGCTTTAGGGCTCTGCTGTTGG + Intergenic
967677284 3:192315767-192315789 GTAGCTTATGGCCTTGCTGTAGG - Intronic
969752569 4:9122818-9122840 CCAGCTTGGGGCCCTTCTGTAGG + Intergenic
969966391 4:11001104-11001126 CTGGCCCTGGGCCCTGCTGTAGG - Intergenic
970220677 4:13807099-13807121 CTGGCTTCGGGCCTTTCTGGTGG + Intergenic
972390880 4:38611953-38611975 CTAGCTTATGGGGCTGCTGTGGG - Intergenic
975640469 4:76495109-76495131 CTGGGTTAGGAGCCTGCTGGAGG + Intronic
976683624 4:87786156-87786178 GTGGCTGTGGGCTCTGCTGTGGG - Intergenic
984030065 4:174593015-174593037 CTGGCTTAGCCCCATGCTGGGGG - Intergenic
985162741 4:187061465-187061487 ATGGATTAGGGCCTTGCTGGGGG - Intergenic
985495184 5:200162-200184 CAGGCTGAGGGTCTTGCTGTCGG - Exonic
991201293 5:63996716-63996738 CTGTCTTTGGTCCTTGCTGTTGG - Intergenic
991703169 5:69334103-69334125 GTGGCTGTGGGCTCTGCTGTGGG + Intergenic
991971767 5:72148349-72148371 CTGGGTATGGGCCCTTCTGTGGG - Intronic
992067442 5:73120655-73120677 CTGGCTGACCGCGCTGCTGTGGG - Exonic
992610213 5:78501410-78501432 CTGGCTGAGGGCCCTTCTGCGGG + Intronic
993609120 5:90032512-90032534 CTGGCTTTGGTCTTTGCTGTTGG - Intergenic
995913241 5:117212940-117212962 CTGACTAAAGGCCCTGTTGTAGG - Intergenic
996094639 5:119385285-119385307 TTGGCTTCACGCCCTGCTGTTGG + Intronic
998012563 5:138707235-138707257 CTGGCTGAGGGCTCTGCAGGAGG + Intronic
1002695572 5:181086181-181086203 GTGGCTCAGCGCCCTGCTGGAGG - Intergenic
1002846985 6:955655-955677 CTGGCTTAAGACCCAGGTGTAGG - Intergenic
1004896538 6:20153399-20153421 TTGTCTTAGGGTCCTGCTGGGGG - Intronic
1005937522 6:30535039-30535061 CTGTCTTGGGGCCTTGCTGGCGG + Intergenic
1006592854 6:35170937-35170959 CTGGCTCAGAGCCCTGCAGCAGG - Intergenic
1007513308 6:42391387-42391409 CTAGCTTAGGGACCTGTTGAAGG - Intronic
1013170048 6:107628771-107628793 CTGAACTAGGGCCCTGCTGGTGG + Intronic
1017840899 6:158222231-158222253 CTGAATGAGAGCCCTGCTGTTGG - Intergenic
1017899422 6:158706260-158706282 CTGGCTAAGGACCCTGATCTAGG + Intronic
1019224584 6:170499766-170499788 GAGGCTTGGGGCCCTTCTGTGGG + Intergenic
1023350956 7:39319744-39319766 CTGGTTTATGTCCCTGCAGTAGG - Intronic
1024623839 7:51187778-51187800 TTGGCTTGGGGCCCTCCTGAAGG - Intronic
1025097044 7:56104308-56104330 GTGGCTGTGGGCTCTGCTGTGGG - Exonic
1025112936 7:56234793-56234815 CTTGCTCAGGGCCCTACTTTGGG + Intergenic
1026959144 7:74397560-74397582 CTTGCTCAGGGTCCTGCAGTGGG + Intronic
1028425115 7:90677860-90677882 ATGCCTTAGTGCCCTGCTCTAGG + Intronic
1029356839 7:100058343-100058365 GTGGCTGTAGGCCCTGCTGTGGG + Intronic
1029453485 7:100655651-100655673 CGGTCTGAGGACCCTGCTGTGGG - Intronic
1029596176 7:101538657-101538679 CTGGGCTCAGGCCCTGCTGTGGG - Intronic
1032803609 7:135335690-135335712 CTGGCTTGGGGCCCAGTTATGGG - Intergenic
1034102459 7:148461639-148461661 CTTGCATAGGGACCTGTTGTGGG - Intergenic
1034267673 7:149789123-149789145 CAGGCTCAGGACGCTGCTGTAGG - Intergenic
1034307292 7:150054552-150054574 CTGGCTTAGCCCCAGGCTGTGGG - Intergenic
1034355529 7:150448246-150448268 CTGTCTTAGGGCCCCGATGCCGG + Intergenic
1034799555 7:154046131-154046153 CTGGCTTAGCCCCAGGCTGTGGG + Intronic
1036397179 8:8379231-8379253 CAGGCTGAGGTCACTGCTGTAGG - Intronic
1039960041 8:42239292-42239314 CGGGATGAGGGCCATGCTGTTGG - Intergenic
1042096048 8:65217153-65217175 CTTGGTGAGGGCCCTCCTGTAGG - Intergenic
1042784886 8:72536673-72536695 CAGGGTCAGGGTCCTGCTGTGGG + Intergenic
1043512680 8:80965170-80965192 CTGGCTTGGAGCCCTGGCGTTGG + Intergenic
1046627781 8:116593558-116593580 CTGGATTAGGGCCCACCTGATGG - Intergenic
1047214657 8:122866437-122866459 CTTGCTTAGTGCCCTGCCTTTGG + Intronic
1047222272 8:122928111-122928133 CTGGCTTAGGGCTGTCCTCTTGG - Intronic
1048967253 8:139624051-139624073 CTGGCTTAGGGCCCTGCTGTTGG - Intronic
1049400714 8:142425746-142425768 CTGGCAAAGGGCCCTGGGGTTGG - Intergenic
1050327098 9:4508383-4508405 CTGGCTTAGAGCCCAGCAGGTGG - Intronic
1053106818 9:35416546-35416568 CAGGCTTGGTGCCCGGCTGTTGG - Intergenic
1055741216 9:79391499-79391521 GTGGCTGTGGGCTCTGCTGTGGG + Intergenic
1055744989 9:79433758-79433780 CTGGCTTAGGGACCTTCTTGGGG + Intergenic
1057551883 9:96057174-96057196 CTGCCTTCCGGCCCTTCTGTTGG - Intergenic
1057867274 9:98691526-98691548 CTGGCTTCTAGCCTTGCTGTCGG - Intronic
1059498531 9:114730853-114730875 CTGGCTGAGGCCCAGGCTGTTGG + Intergenic
1060756838 9:126219807-126219829 CTGGCCTGGGGCCCTGCCTTGGG + Intergenic
1062085433 9:134645710-134645732 CTGGCTTAGGGCCCCACAGCAGG - Intronic
1062392844 9:136340815-136340837 GTGGCTGGGGGCCCTGCTGTGGG - Intronic
1186981226 X:14959786-14959808 CTGGCTTCTGGCACTGTTGTGGG - Intergenic
1187157833 X:16737563-16737585 CTGGCTTGGGGACTTGCTGTAGG + Intronic
1187475785 X:19609652-19609674 CTGGCCTAAGGCCTTGCTGTAGG + Intronic
1189239367 X:39513943-39513965 CTGGCTCAGGGCCCTGCCTCAGG - Intergenic
1189652693 X:43207504-43207526 CTGGCATTGTGCCCTGCTCTAGG + Intergenic
1189827860 X:44938383-44938405 TTGGCTTAAGGCAATGCTGTGGG - Intronic
1190537864 X:51447231-51447253 TTTACTTAGGACCCTGCTGTAGG + Intergenic
1190595793 X:52051924-52051946 CTGGCGTAGGGCATGGCTGTGGG + Exonic
1190613031 X:52202149-52202171 CTGGCGTAGGGCATGGCTGTGGG - Exonic
1190630072 X:52377745-52377767 CTGTCTTAGGGTACAGCTGTGGG - Intergenic
1198653410 X:138888457-138888479 CTGGCTTAGTGCTCTACTGTTGG + Intronic
1200237078 X:154472855-154472877 CTTGCTTTGGGCCCTGCAGGGGG + Exonic