ID: 1048967559

View in Genome Browser
Species Human (GRCh38)
Location 8:139625434-139625456
Sequence GGGATCTGCACAGCTGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048967559_1048967564 0 Left 1048967559 8:139625434-139625456 CCTGACTCAGCTGTGCAGATCCC 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1048967564 8:139625457-139625479 AGAGCCCAGCATGGAGGAGAAGG No data
1048967559_1048967561 -6 Left 1048967559 8:139625434-139625456 CCTGACTCAGCTGTGCAGATCCC 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1048967561 8:139625451-139625473 GATCCCAGAGCCCAGCATGGAGG No data
1048967559_1048967560 -9 Left 1048967559 8:139625434-139625456 CCTGACTCAGCTGTGCAGATCCC 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1048967560 8:139625448-139625470 GCAGATCCCAGAGCCCAGCATGG No data
1048967559_1048967567 10 Left 1048967559 8:139625434-139625456 CCTGACTCAGCTGTGCAGATCCC 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1048967567 8:139625467-139625489 ATGGAGGAGAAGGCAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048967559 Original CRISPR GGGATCTGCACAGCTGAGTC AGG (reversed) Intronic
900134839 1:1112013-1112035 GGGCTCAGCACACCGGAGTCGGG + Intronic
900736301 1:4301491-4301513 CTGAGCTGCACAGCTGAGTTAGG + Intergenic
901781134 1:11595414-11595436 GGCATCTGCATATCTGAGCCTGG - Intergenic
902414424 1:16230516-16230538 GGCATCAGGACAGGTGAGTCTGG + Intergenic
903664526 1:24998130-24998152 GGTTTCTGCACAGCTGTGGCGGG + Intergenic
903959886 1:27050247-27050269 GGGCTCTGCACAGCTGCCTTTGG + Intergenic
905397093 1:37673893-37673915 CGGAGTGGCACAGCTGAGTCAGG + Intergenic
909901008 1:81135621-81135643 GGAGTCTGCACAGTGGAGTCAGG - Intergenic
911087234 1:93989291-93989313 GGGATGTGCACATCTGAGCCTGG + Intergenic
917968411 1:180192733-180192755 GAGGTGTGCACAGTTGAGTCTGG + Intronic
918399186 1:184146636-184146658 GGGCTCTGCTCAGATGTGTCTGG - Intergenic
920502832 1:206496316-206496338 GGAAGCAGCACAGCTGAGACTGG + Exonic
920665241 1:207958866-207958888 GGGCTCGGCACAGGTGATTCTGG + Intergenic
921595016 1:217045429-217045451 AGGATCTGCAGAGTTGACTCGGG + Intronic
922623435 1:227010858-227010880 AGGGTATGAACAGCTGAGTCAGG - Intronic
922870552 1:228898849-228898871 GGGCCCTGCACAGCTGACCCTGG + Intergenic
1063562010 10:7137320-7137342 GGGATCTGTACAGATGAATAGGG - Intergenic
1064738964 10:18412814-18412836 GGGCTCTACAGAGCTCAGTCTGG - Intronic
1067227153 10:44383746-44383768 AGGACCAGCGCAGCTGAGTCGGG - Intronic
1069920977 10:71815416-71815438 GGGATCTGAGCAGCTGATGCGGG - Exonic
1071470013 10:85977386-85977408 GGGGTCTGCACCCTTGAGTCAGG - Intronic
1072247149 10:93553912-93553934 GGAAGCTGCTCAGCTAAGTCTGG + Intergenic
1072895040 10:99359485-99359507 GTGATCTGGACACCTGGGTCTGG + Intronic
1073385633 10:103126009-103126031 GTGACCTACACAGATGAGTCAGG - Intronic
1074406161 10:113181842-113181864 GTGATCTGCAAATTTGAGTCTGG - Intergenic
1074439337 10:113461313-113461335 GGCATCTGCAGGGCTGGGTCAGG - Intergenic
1076378932 10:130011885-130011907 GGGATGTGTCCATCTGAGTCTGG - Intergenic
1076683906 10:132188080-132188102 GGGTTCTGCCCGGCTGGGTCTGG + Intronic
1077845833 11:6023850-6023872 GGGAACTTCACAGCAGAGTTGGG + Intergenic
1078662428 11:13298115-13298137 GGGTTCTGCACAGCTCATTGTGG + Intronic
1082800830 11:57413788-57413810 GGAATCTGGGCAGATGAGTCGGG - Intronic
1084756178 11:71240271-71240293 GGGTTCTGCACTGCTGGCTCTGG - Intronic
1085127247 11:74010310-74010332 GGGCTGGGCACAGCTGAATCGGG + Intergenic
1088018834 11:105094161-105094183 GGGATTTGCACAGCAGAATGTGG + Intronic
1088850557 11:113700083-113700105 GGGATCTTCAGAGCAGAGCCTGG - Exonic
1090047994 11:123352876-123352898 GGCACCTGCACAGCTGAGATTGG - Intergenic
1092088862 12:5787462-5787484 AGGATCTGAACTCCTGAGTCTGG - Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1098365064 12:69693625-69693647 GGGCTCTTCTCAGCTGAGACAGG - Intronic
1101059023 12:100951764-100951786 CTGATTTTCACAGCTGAGTCTGG + Intronic
1101515312 12:105429652-105429674 GGGATCAGCACAGCTGGGATTGG - Intergenic
1101917617 12:108908078-108908100 GGGCACTGAGCAGCTGAGTCAGG + Intergenic
1101983342 12:109426604-109426626 AGGAGCAACACAGCTGAGTCAGG + Intronic
1103596971 12:122030066-122030088 GGGAACTGCACCCCTGATTCAGG - Intronic
1103606310 12:122088269-122088291 TGTTTCTGCTCAGCTGAGTCTGG + Intronic
1104294630 12:127500701-127500723 GGCATCTGCCCAGCTGCCTCGGG + Intergenic
1105408295 13:20149788-20149810 GGCTTCTGCACAGCAGAGCCAGG + Intronic
1106001519 13:25727969-25727991 GGCATTTGCACAGGTGAGTAGGG - Intronic
1106994977 13:35470969-35470991 GGCCTCTGCCCAGCCGAGTCGGG - Intronic
1119300706 14:73569375-73569397 GGGGTCTCCACAGCTGAGGCAGG + Exonic
1119466542 14:74863057-74863079 AGCTTCTGCCCAGCTGAGTCAGG + Intronic
1122178908 14:99940583-99940605 CTGATTTGCACAGCTGAATCAGG + Exonic
1122201751 14:100126952-100126974 GGAGTCTGCTCAGCTGGGTCTGG + Intronic
1122660821 14:103293761-103293783 GGTGTCAGCACAGCTGAGGCTGG - Intergenic
1122720247 14:103717749-103717771 GGGATCTGAGCAGCTGAGGGAGG + Intronic
1122739288 14:103861935-103861957 GGGGTCTGCTCAGCTGAGCGAGG + Intergenic
1124846984 15:33300928-33300950 GGGTTCTGTAGAGCTGAGTCAGG + Intergenic
1127865197 15:63026883-63026905 GGGAGCTCCACAGCTGAGAGGGG - Intergenic
1129121392 15:73399011-73399033 GGGATCTGCACAGAGGAAGCTGG + Intergenic
1129358946 15:75012510-75012532 GGGATCATCACAGCTGACCCGGG + Intronic
1134634714 16:15783578-15783600 GGAATCACCACAGCTGAGACTGG + Intronic
1136064297 16:27748337-27748359 GGGATTCGCCCAGCTGAGGCAGG + Intronic
1137842617 16:51653966-51653988 GAGATATGCCCAGCTGAGGCAGG - Intergenic
1138008294 16:53356997-53357019 GGAAACTGCCCTGCTGAGTCTGG - Intergenic
1139443952 16:66985229-66985251 AGGAGCTGCATAGCTGAGTGGGG + Intergenic
1139466986 16:67159440-67159462 GGGAGCTGCGTAGCTGAGTAGGG - Intronic
1140457424 16:75113360-75113382 GGTATCTGAACAGCTGGGTGGGG + Intronic
1141168451 16:81676179-81676201 GGGCTCAACACAGCTGAGCCAGG - Intronic
1141377801 16:83548029-83548051 GATATATGCAGAGCTGAGTCTGG + Intronic
1142919079 17:3168701-3168723 GGGCTCTGCCCGGCTGTGTCAGG - Intergenic
1144659155 17:17057213-17057235 GGGCTCTTCACAGAGGAGTCTGG + Intronic
1148455179 17:47807647-47807669 GGGATCCGCTGAGCTGAGACGGG + Exonic
1151429578 17:74053296-74053318 GGAGTCTGCACGGCTGAGCCTGG - Intergenic
1151814893 17:76466952-76466974 AGGATCTGCACTGCTGGGTGGGG + Intronic
1152529002 17:80905985-80906007 GGGCTCCCCACAGCTGAGTGAGG - Intronic
1154396521 18:13995670-13995692 GGGATTTCCTCAGCTGAATCTGG + Intergenic
1155236289 18:23822848-23822870 GGGAGCTGCAAACCTGACTCAGG + Intronic
1158876533 18:61739441-61739463 GGGGTCTGAAAATCTGAGTCTGG + Intergenic
1159495913 18:69204580-69204602 GGGAAATTCACAGCTGACTCTGG - Intergenic
1161488018 19:4546206-4546228 GGGGACTGCACAGGTGAGTTGGG - Exonic
1161951276 19:7469428-7469450 GGGATCAGCACAGCCGGGACAGG + Intronic
1162480473 19:10924256-10924278 GGTCTCAGCACAGCTCAGTCAGG - Intronic
1163372455 19:16908979-16909001 AGGATCTGCACAGCTGGGGCCGG - Intronic
1165256470 19:34579570-34579592 GGGAGCTGCAAGGCTGAGCCAGG + Intergenic
1165266103 19:34664767-34664789 GGGAGCTGCAAGGCTGAGCCAGG - Intronic
1165783272 19:38446222-38446244 TGGGTCTGCAGAGCTGAGGCTGG - Intronic
1166314977 19:41984747-41984769 GGGATCTGGACCCCTGGGTCCGG - Intronic
1166873001 19:45882288-45882310 TGGGTCTGCAGAGCTGGGTCAGG + Intergenic
1168296448 19:55379318-55379340 GGCAGCTGCACATCTCAGTCTGG + Exonic
924993973 2:340457-340479 GGGAGGGGCACAGCTGGGTCAGG - Intergenic
925254026 2:2466886-2466908 GGGAGCTGCACAGGTGCGTGGGG - Intergenic
926196676 2:10768317-10768339 GAGATCGGCACAGCCGAGCCAGG + Intronic
926798022 2:16634769-16634791 GGGATCTGTACAGTTGGATCTGG - Intronic
928358729 2:30645634-30645656 GGGTTCTCCATAGCTGTGTCTGG + Intergenic
929881430 2:45840542-45840564 GGGAGCTGCTCACCTGAGTTTGG - Intronic
931999469 2:67871297-67871319 GGGTCCTGTACAGCAGAGTCAGG - Intergenic
932793149 2:74673313-74673335 GTGATGTGCTCAGCAGAGTCTGG + Intronic
934524571 2:95043692-95043714 GGGAAAGGCACAGCCGAGTCAGG - Intronic
935577451 2:104725577-104725599 GTGATCTGAAAAGCTGACTCAGG - Intergenic
939750211 2:146034853-146034875 GGGAACTGCATAGCTGCTTCTGG + Intergenic
939839585 2:147170833-147170855 GGTATCTGCAGAGCTGAGGTTGG - Intergenic
942728048 2:179032164-179032186 AGGATGTGCACAGCAGAGTGAGG - Intronic
943126803 2:183804103-183804125 TGGATCTTCAGAGCTGAGTCTGG + Intergenic
943275403 2:185861032-185861054 GGCATTTGGACAGCTGAGTTTGG - Intergenic
945979055 2:216294284-216294306 GGGTTTTGCACAGCTGAGGCTGG - Intronic
948311371 2:236989470-236989492 AGAGCCTGCACAGCTGAGTCGGG + Intergenic
1170878944 20:20277717-20277739 GAGAACTTCCCAGCTGAGTCTGG - Intronic
1171961370 20:31497206-31497228 GGGATGCGCACAGCTGACTCAGG + Intergenic
1175166301 20:57047107-57047129 GGGATCTGCATTCCTGAGGCTGG - Intergenic
1175909868 20:62400110-62400132 GGCAGGTGCACAGCTGTGTCTGG - Intronic
1180237767 21:46474508-46474530 GGCATCTGTGCAGCTGAGGCAGG + Intronic
1181812986 22:25415596-25415618 GGGCTGTGCAAAGTTGAGTCTGG - Intergenic
1183934235 22:41253041-41253063 GGGATGGGCACAGCTGTGTCGGG - Intronic
952331885 3:32371126-32371148 GTGATCTGCCCACCTCAGTCAGG - Intergenic
953563281 3:44011476-44011498 GGGAACTGCAGAGCTGGATCTGG - Intergenic
954215523 3:49122286-49122308 TGGATCTGCTCAGCTGAAGCTGG + Exonic
954659367 3:52218805-52218827 GGGCTCGGCTCAGGTGAGTCTGG - Intergenic
957716388 3:83934462-83934484 AGGATCTCCACTGCTGAGGCAGG + Intergenic
958680102 3:97318635-97318657 ATGATGTGCACAGCAGAGTCTGG + Intronic
960925878 3:122794878-122794900 GGGACCAGCGCGGCTGAGTCGGG - Exonic
960942935 3:122946365-122946387 GGGTTATTCACAGCTCAGTCAGG + Intronic
961221996 3:125208349-125208371 TGACTCAGCACAGCTGAGTCAGG - Intronic
962356427 3:134698273-134698295 GGTACCTGGACAGCTGACTCTGG + Intronic
962835709 3:139186537-139186559 GGGATGCGCAAAGCTGAGGCTGG + Intronic
966869144 3:184278591-184278613 GGGATCAGCCCAGCTCAGCCAGG - Intronic
968759149 4:2433118-2433140 GGAAGCTGCAGAGCTGAGTGAGG - Intronic
978923285 4:114212671-114212693 GAGACCTGCAAAGCTGAGTGCGG + Intergenic
984823522 4:183905305-183905327 CGGCTCTGCACAGCTGTTTCTGG - Intronic
985923328 5:2996531-2996553 GGGCTATGCAGAGCTGAGGCTGG - Intergenic
986331062 5:6716354-6716376 GGGACCTGCACAACTGAGCAGGG - Intronic
987326211 5:16813684-16813706 GGGCTCTGCACAGGTGATTATGG + Intronic
987338017 5:16914245-16914267 GGGATCGGCAGAGCTGGCTCTGG - Intronic
992499310 5:77326137-77326159 GGGATCTACCCATCTGTGTCAGG - Intronic
992882221 5:81121735-81121757 GGAATCTGGATATCTGAGTCTGG - Intronic
995709064 5:115016291-115016313 AGGTTCTGCACAGCTGACTGTGG + Intergenic
998856675 5:146400816-146400838 GGCATCTGCACAGTAGAATCAGG - Intergenic
1001177573 5:169486391-169486413 GGCATCAGCTCAGCTGAGTTTGG - Intergenic
1001654403 5:173338534-173338556 TGGATCAGCACAGCTCAGCCTGG + Intergenic
1001698288 5:173688853-173688875 GGGCCCTGAACTGCTGAGTCAGG + Intergenic
1003505071 6:6734026-6734048 GAGGTCTGCACAGCAGTGTCAGG - Intergenic
1004128083 6:12893252-12893274 TGGAGCTGCACAGCTGTGTTTGG - Intronic
1004658127 6:17684666-17684688 GGCATGTGGACAGCTGAGACAGG - Intronic
1004690623 6:17989188-17989210 GGGTTCTGCAGAGCTGACTGTGG + Intergenic
1005424134 6:25683397-25683419 GAGACGTGCACAACTGAGTCAGG - Intronic
1005685702 6:28251639-28251661 GGAATCTGCAGAGCTGGGTGCGG - Exonic
1005696907 6:28359885-28359907 GGAATCTGCAGAGCTGGGTGCGG + Exonic
1011626646 6:89288519-89288541 GAGAACTGCACAGCTGAGCCCGG + Intronic
1018043231 6:159943486-159943508 GAGATCCACACAGCTGACTCAGG - Intergenic
1019192486 6:170260905-170260927 GCTATCTGCACAGCTGCCTCTGG - Intergenic
1020005746 7:4783099-4783121 GGGAGCTGCATCGCTGAGGCTGG - Intronic
1027136908 7:75631063-75631085 GGGATCCTCCCAGCTGAGGCAGG - Intronic
1028579973 7:92398545-92398567 GGGTCCTGGCCAGCTGAGTCAGG - Exonic
1035063504 7:156088345-156088367 GGGAGGTGCACAGTTGACTCTGG + Intergenic
1035552156 8:537081-537103 GGGAGCTGCAGAATTGAGTCAGG - Intronic
1037758884 8:21728947-21728969 GGGGTCTGGACAGCAGAATCGGG + Intronic
1040888785 8:52293947-52293969 GTGATTTTCACAGCTGACTCAGG + Intronic
1041173291 8:55167394-55167416 GAGGTCTTCACAGCTGAGCCTGG - Intronic
1041279799 8:56198328-56198350 GGGGTCACCACAGCTGAGGCAGG + Intronic
1041324114 8:56647163-56647185 GAGAGCTGCCCAGCTGATTCTGG + Intergenic
1045058539 8:98391549-98391571 GGGAGGTGCACAGCAGAGTAGGG - Intergenic
1045803298 8:106127033-106127055 GGGACCAGCACACCTGAGTTAGG + Intergenic
1048967559 8:139625434-139625456 GGGATCTGCACAGCTGAGTCAGG - Intronic
1048979044 8:139693326-139693348 GGGATCTGTCCTGCTGAGTGGGG - Intronic
1049006196 8:139857170-139857192 GGGATCAGCACAGCAGAGGAGGG + Intronic
1049163401 8:141111898-141111920 AGCACCTGCACAGGTGAGTCAGG + Intergenic
1052444696 9:28545456-28545478 GGGATCTGCAAAAATAAGTCTGG + Intronic
1053073586 9:35115165-35115187 TGGATCTGTCCAGCTGAGACTGG - Intronic
1053358261 9:37465202-37465224 GGGGTCTCCTCACCTGAGTCGGG + Exonic
1056253907 9:84778746-84778768 GGGAACTGCACAGTTCAGGCAGG - Intronic
1056271511 9:84952368-84952390 GAGAACTGGACAGCTAAGTCAGG + Intronic
1056578302 9:87872303-87872325 GGGATCTGAGCTGCTGAGCCAGG - Intergenic
1056623618 9:88236029-88236051 GGAATTTCCACAGCTGAGTATGG + Intergenic
1057441953 9:95089756-95089778 GGGAGCTGCTGAGCTGAGGCTGG - Intergenic
1057784090 9:98073685-98073707 GGGAACTGCTGATCTGAGTCAGG - Intronic
1058219218 9:102275812-102275834 GGGGTATGCACAGCTGGGTCTGG + Intergenic
1059238030 9:112778900-112778922 GGGATTTGCACAGCCCAGACTGG + Intronic
1059526908 9:115000454-115000476 GCCATCTGCACTGCTGAGTAAGG - Intergenic
1060150449 9:121284978-121285000 GGGCTCTGGACAGCTCAGGCTGG - Intronic
1061622072 9:131817239-131817261 AGGCTCTGCACAGCAAAGTCGGG - Intergenic
1061765616 9:132879125-132879147 GGGGCCTGCACAGCTGTCTCGGG + Intronic
1062245714 9:135565143-135565165 GGGGTCTGCACAGCTTAGGATGG - Intronic
1062448712 9:136606654-136606676 GGGAGCTGGACACCTGTGTCAGG + Intergenic
1062473760 9:136717839-136717861 GGAATCTGCAAAGCTGCCTCAGG + Intronic
1187319757 X:18228751-18228773 GGGTTCTGGACAGCTGAGCAGGG - Intergenic
1195033518 X:100949164-100949186 GGTATCTGCAAGGCTGAGTGGGG + Intergenic
1199645611 X:149907784-149907806 GGGAAATGCACAGCTGTGTGAGG - Intergenic