ID: 1048967776

View in Genome Browser
Species Human (GRCh38)
Location 8:139626650-139626672
Sequence GGGCTGGGGGAGACAGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 378}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048967776_1048967789 9 Left 1048967776 8:139626650-139626672 CCCATGGCTGTCTCCCCCAGCCC 0: 1
1: 0
2: 5
3: 37
4: 378
Right 1048967789 8:139626682-139626704 TGGGACAGGCTGCCCAGCACCGG No data
1048967776_1048967784 -5 Left 1048967776 8:139626650-139626672 CCCATGGCTGTCTCCCCCAGCCC 0: 1
1: 0
2: 5
3: 37
4: 378
Right 1048967784 8:139626668-139626690 AGCCCACAGTTCCCTGGGACAGG No data
1048967776_1048967790 13 Left 1048967776 8:139626650-139626672 CCCATGGCTGTCTCCCCCAGCCC 0: 1
1: 0
2: 5
3: 37
4: 378
Right 1048967790 8:139626686-139626708 ACAGGCTGCCCAGCACCGGAAGG No data
1048967776_1048967791 19 Left 1048967776 8:139626650-139626672 CCCATGGCTGTCTCCCCCAGCCC 0: 1
1: 0
2: 5
3: 37
4: 378
Right 1048967791 8:139626692-139626714 TGCCCAGCACCGGAAGGAGATGG No data
1048967776_1048967780 -10 Left 1048967776 8:139626650-139626672 CCCATGGCTGTCTCCCCCAGCCC 0: 1
1: 0
2: 5
3: 37
4: 378
Right 1048967780 8:139626663-139626685 CCCCCAGCCCACAGTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048967776 Original CRISPR GGGCTGGGGGAGACAGCCAT GGG (reversed) Intronic
900213414 1:1468345-1468367 GAGCTGAGGGAGGCCGCCATGGG - Intronic
900220975 1:1509166-1509188 GAGCTGAGGGAGGCCGCCATGGG - Intergenic
900537185 1:3184704-3184726 GGGGTGGGGGTGACAGCGAGAGG - Intronic
900571047 1:3358370-3358392 GGGCAGTGGGTGGCAGCCATGGG + Intronic
900951727 1:5861842-5861864 GGGCTGCTGGAGACATCCATTGG - Intergenic
901500492 1:9649880-9649902 AGGCTCGGGGAGACAGCCCAGGG - Intergenic
902480901 1:16711012-16711034 GGGCTGGGAGTGCCAGCCAGCGG - Intergenic
902752849 1:18529336-18529358 GTGCTGGGGGAGAAACCCAGTGG + Intergenic
902914622 1:19629276-19629298 GGGTTTGGGGAGACAGCGATGGG + Exonic
903272898 1:22202797-22202819 AGGCTGGGGGTGGCAGCCACAGG - Intergenic
903334855 1:22618148-22618170 GGACTCGGGGAGACAGCCACCGG - Intergenic
904005737 1:27362248-27362270 TGCCTGGGGGAGAGAGGCATGGG + Exonic
904006236 1:27364738-27364760 GGGCTGGTGGAGGCAGGCACAGG - Intronic
905732910 1:40308376-40308398 GGGCCGGAGGAGAGAGCCTTGGG + Intronic
906201563 1:43963821-43963843 GGGGTGGGGGAGTCAGTCCTTGG - Intronic
906625192 1:47319323-47319345 GGGTTGGGGGAGAAAGGCAGAGG + Intergenic
906662607 1:47593519-47593541 GGGCGGGGGGAGACAGAGAGAGG - Intergenic
907241309 1:53082531-53082553 GGGCTGGGGAAGCTTGCCATGGG + Intronic
907414894 1:54307370-54307392 GGGCTAGGGGAGACAGGGAGAGG - Intronic
907583209 1:55590692-55590714 GGGGTGGGGGAGACAGGAATGGG - Intergenic
907930599 1:58995769-58995791 GGGCTGGAGGAACCAGCAATGGG + Intergenic
910392061 1:86755781-86755803 GGACTGGGGAAGACAGGCAAAGG - Intergenic
910480838 1:87656426-87656448 GGGGTGGGGGTTACAGCCAGAGG + Intergenic
910929511 1:92428981-92429003 GGGCTGGGGGAGAGAATAATGGG + Intergenic
910976902 1:92916102-92916124 AGGCTGGGGGAGGGAGCAATGGG + Intronic
912332873 1:108835176-108835198 GAGCTGGGGGAGACAGGGGTGGG - Intronic
915302089 1:154957482-154957504 GGGGTGGGGAAGGCAGGCATGGG - Exonic
915302218 1:154958277-154958299 GGGCTCTGGGAGACAGCTTTAGG - Exonic
915461307 1:156072273-156072295 GGGTGGGTGGAGACAGCCCTGGG - Exonic
915461490 1:156073157-156073179 GGCCTGGGGGAAGCAGGCATGGG + Exonic
915557966 1:156670520-156670542 GGGCTGGGGGAGACCAGCACTGG + Exonic
916173246 1:162017536-162017558 GGGCTGGGGCACACAGACACAGG + Intronic
917434254 1:175002790-175002812 GGGCTTGGGAATTCAGCCATTGG + Intronic
917891588 1:179443555-179443577 GGGTTGGGGGAGGCAGAAATAGG - Intronic
918096236 1:181336722-181336744 GGGCTGGGGGAGGGAGGAATGGG - Intergenic
919685526 1:200479917-200479939 GGGCTGGGAGGGATGGCCATGGG - Intergenic
920082210 1:203383092-203383114 GGGGTTGTGGAGATAGCCATGGG - Intergenic
920562909 1:206951869-206951891 GGGCTGGGGGAGAAGAGCATTGG + Intergenic
920577233 1:207070425-207070447 GGGCTGGGAGACACATCCAGTGG + Intronic
922674909 1:227544073-227544095 GAGCTGGGGGAGTCAGGCAGGGG - Intergenic
1062957148 10:1547824-1547846 GGGGAGGGGGAGATAGGCATTGG + Intronic
1064018143 10:11788369-11788391 GGGCTGCGGGAAGGAGCCATGGG + Intergenic
1064169933 10:13022080-13022102 GGGCTGGGGGAGGAAGGAATGGG - Intronic
1066125822 10:32341855-32341877 GGGCTGGGGCAGAAAGCCCAGGG - Intronic
1067563687 10:47321785-47321807 GAGCTGGGGGAGGAAGCCCTGGG - Intergenic
1069219478 10:65865345-65865367 GGGGTGTGGGACAGAGCCATGGG + Intergenic
1069572629 10:69503691-69503713 GGGCTGGGGGGGACGGTCATGGG + Intronic
1069763281 10:70831385-70831407 GGGTTGGGGGAGACAGGTATGGG - Intronic
1070025230 10:72625927-72625949 GGGGTTGGCGAGACAGCCTTAGG - Intronic
1070979325 10:80631793-80631815 GGGCTGGGAGAGGCAGGCACTGG + Intronic
1071308575 10:84322256-84322278 GGGCTGGGGGAGAGGGGAATGGG + Intergenic
1071858063 10:89645379-89645401 GGTCTGGGAGAGACAGCGAAAGG + Exonic
1072216425 10:93291153-93291175 GGGCTGCTGGGGACAGTCATGGG - Intergenic
1072436248 10:95417000-95417022 GGGCTGGGTGAGATGGGCATGGG - Intronic
1073075962 10:100826191-100826213 GGGGTGGGGGATGCAGCCACTGG - Intronic
1074703573 10:116112509-116112531 GGGCTTGGGGAGAGTGCCACAGG - Intronic
1074718847 10:116247521-116247543 GGGCTGGGAGAGCCAGCCAGGGG - Intronic
1074756398 10:116627405-116627427 GGGCGGGGGGAGCCAGAGATAGG + Intronic
1075551351 10:123395104-123395126 GGGCTGGAGAAAGCAGCCATGGG - Intergenic
1075572326 10:123555385-123555407 GAGCTGGGGGAGGCAGCCTCAGG + Intergenic
1076352467 10:129826530-129826552 GTGATGGGGGTGACAGCCAAGGG - Intergenic
1077144508 11:1038703-1038725 GGGTTGGGGGTGAGAGCCAGTGG + Intergenic
1078877281 11:15411341-15411363 GGGCTGTGGGTGACAGTCATTGG + Intergenic
1079929739 11:26543109-26543131 GGGCAGGGGGAGAAAGCATTCGG + Intronic
1080663450 11:34315584-34315606 GGGATGGAGGAGACAGGCACTGG - Intronic
1081596155 11:44460925-44460947 TGGCTGGGGGAGTCAGTCTTGGG + Intergenic
1081598085 11:44473143-44473165 GGGCTTGGGGCCAAAGCCATGGG - Intergenic
1083547311 11:63558554-63558576 TGGCTGGGGGAGACAACTACAGG - Exonic
1083663913 11:64264632-64264654 AGGCTGGGGGACACAGGCAGGGG + Intronic
1083673547 11:64313401-64313423 CGGCTGGGGAAGATTGCCATGGG + Intronic
1083743245 11:64722152-64722174 GGGGTGGGGGAGCAAGCCAAGGG + Intronic
1084102372 11:66958166-66958188 CGGCTGGAGGAGACAGCGACGGG - Intronic
1084189342 11:67491918-67491940 GGGCTGGGGGGGCCAGCGCTGGG + Exonic
1084430836 11:69110273-69110295 CGACTGGGGGACACAGCCAGTGG + Intergenic
1084792022 11:71481048-71481070 GGGCTGGGGGTCACACCCAGGGG - Intronic
1085174618 11:74475029-74475051 GGGCTAGGGGAGTCAGTCATTGG + Intergenic
1088004834 11:104927396-104927418 GGGCTGTGGGAGACACCTATTGG - Intergenic
1088739431 11:112754938-112754960 GGTCTGGTGGAGAAAGCCAGTGG + Intergenic
1088806786 11:113359765-113359787 GAGTTAGGGGAGACAGACATGGG + Intronic
1089495694 11:118907791-118907813 GGGGGAGGGGAGACAGGCATGGG - Intronic
1089531743 11:119134402-119134424 GGGCTGGGGGAGGCTCCCCTGGG - Exonic
1089638765 11:119833286-119833308 GGCCTGGGGTAGAGAGCCAGCGG - Intergenic
1089795741 11:120979653-120979675 GTGCTGAGGGAGAGAGCCAGTGG + Intronic
1091645265 12:2268248-2268270 GGGGTGGGGTCGACAGCCAGAGG + Intronic
1091669188 12:2440277-2440299 GGGCTGGGGGAAGGAGCAATGGG - Intronic
1091989892 12:4946805-4946827 GGGCTGGGGAACACAGCAGTTGG + Intergenic
1092764037 12:11836529-11836551 GGGCTGTGGGAGACATTAATGGG + Intronic
1093597132 12:20975723-20975745 GGGCTGGGGGGGATAGCATTAGG - Intergenic
1094523884 12:31219261-31219283 GGGCTGGGTGAGACATTCAAAGG - Intergenic
1096466170 12:51848618-51848640 GGGCCGGGGGCGACAGGCCTGGG + Intergenic
1097340571 12:58433044-58433066 GGGCTGGGGGAAAGAGCAAGTGG - Intergenic
1097340621 12:58433722-58433744 GGGCTGGGGGAAAGAGCAAGTGG + Intergenic
1098236111 12:68420050-68420072 GGGCTGGGGGAGACAGAGAGGGG - Intergenic
1099640700 12:85280192-85280214 GCGCTGGGGGAGGGAGCCAGTGG - Exonic
1099840684 12:87961860-87961882 GGGAGAGGGGAGACAGCCAGAGG - Intergenic
1101409976 12:104459241-104459263 GGGCAGGGCCAGACAGCCAGGGG + Intronic
1101771074 12:107751543-107751565 GTGATGGAGGAGACAGCCACAGG + Exonic
1101899309 12:108779451-108779473 GGGGTGGGAGAGACAGCTCTGGG + Intergenic
1102516113 12:113447997-113448019 GGGCTGAGGGAGGCAGGCAGGGG - Intergenic
1102914755 12:116744559-116744581 GTGCTGGGGGACACAGGGATGGG - Intronic
1103013282 12:117474547-117474569 GGGCTGGGGGAGATAACACTGGG - Intronic
1103568020 12:121826822-121826844 GGGCGGGGGGTGACAGCCCAGGG + Intronic
1103700663 12:122847309-122847331 GGGAGGGGTGAGACTGCCATAGG + Intronic
1103794951 12:123496945-123496967 GGGCTGGGGGAGGGAGGAATGGG - Intronic
1104022001 12:124998598-124998620 GGGCTGGGGGAGGGAGCAATGGG + Intronic
1104691903 12:130832865-130832887 GGGCTGGGGGAGGGTGCCCTGGG - Intronic
1105413960 13:20193205-20193227 GGGCTGGGGGAGGCGGCGCTCGG - Intergenic
1105657409 13:22456177-22456199 GGCCTGGGGGAGGGAGACATTGG - Intergenic
1106311626 13:28559784-28559806 GGGCTGGGGGAGGCAAGAATGGG - Intergenic
1106945677 13:34824953-34824975 GGGCTGGGGGAGAGGGGAATGGG - Intergenic
1108162308 13:47653800-47653822 GGGCTGGAGGAAGCAGACATAGG - Intergenic
1108203488 13:48064697-48064719 GGGATGGGGGAGGGAGCAATGGG - Intronic
1109334623 13:60978558-60978580 GGGCAGGGGAAGAGAGGCATAGG + Intergenic
1110537238 13:76665649-76665671 TGGCTGGTGGCAACAGCCATGGG - Intergenic
1112508794 13:99991028-99991050 GGGCTGGGGGAGGTAGGAATGGG - Intergenic
1112825986 13:103393089-103393111 GGGCTGGAGATGACAGCGATGGG + Intergenic
1113969351 13:114176856-114176878 CAGCTGTGGGTGACAGCCATGGG + Intergenic
1113969435 13:114177241-114177263 CAGCTGTGGGTGACAGCCATGGG + Intergenic
1114309529 14:21454343-21454365 GGCCTGGGCGACACAGCCAGAGG - Intronic
1114558745 14:23576935-23576957 GGGCTGGGGGTCACATCGATGGG + Intronic
1115323388 14:32110295-32110317 GGGCTGGGAAAGACAGCAGTAGG + Intronic
1116954639 14:50911461-50911483 GTGCTGGGGGAGGCAGCCCTGGG - Intronic
1117312690 14:54543964-54543986 GGGCTGGGGGAGGGAGAAATGGG - Intergenic
1118044601 14:61953580-61953602 AGGATGGTGGAGACAGCAATTGG - Intergenic
1118589744 14:67392574-67392596 GGCCTGGGGGCCACAGTCATGGG - Intronic
1118699931 14:68423118-68423140 GGGCAGTGGGATACAACCATGGG - Intronic
1121051831 14:90824268-90824290 GGGCAGGGGGAGATAGGCTTTGG - Intergenic
1122399514 14:101458573-101458595 GGGCTGGGGGTGCCAGGCTTTGG + Intergenic
1122784254 14:104156605-104156627 GGGCAGGGTGAGCCGGCCATGGG + Intronic
1125356300 15:38820328-38820350 GGGCTGGGGCCCAAAGCCATAGG - Intergenic
1128367404 15:67014055-67014077 AGGAAGGTGGAGACAGCCATCGG - Intergenic
1128924050 15:71637643-71637665 GGGCTGGGGGAGGTGGCAATGGG + Intronic
1129236890 15:74229068-74229090 GGGGTGGGGGTGACAGCCTTGGG - Intergenic
1130164229 15:81436488-81436510 GGGCTGGGGGAAAGGGCCACAGG + Intergenic
1130538416 15:84803154-84803176 GGGTTGGGGCACACAGACATTGG + Exonic
1131034038 15:89209613-89209635 GGACTGGAGGAGACAGCTTTTGG + Intergenic
1131111157 15:89766161-89766183 GGGCTGGGAGCCACAGGCATGGG - Intronic
1131120672 15:89821588-89821610 GGGCTGGGGGAGGGAGACAGGGG + Intergenic
1132500412 16:282405-282427 GGGGTGGGGGCAACAGCCAGAGG + Intronic
1132676069 16:1121748-1121770 GGGCTGAGGGCCACAGCCCTGGG + Intergenic
1132678563 16:1130639-1130661 GGGCTGGGGGACACATCCACAGG - Intergenic
1133311285 16:4848055-4848077 GGGCTCGGGGACCCGGCCATGGG + Intronic
1133712962 16:8419361-8419383 GGGTTGGGGGAGATAGGCCTTGG - Intergenic
1134228668 16:12412123-12412145 GGGGTGGGAGAGCCGGCCATCGG + Intronic
1135548050 16:23378787-23378809 GGGCTGGGGAAGACAGGGAAGGG + Intronic
1135998103 16:27268607-27268629 GGGGTGGGCGAGACAGGCAGTGG - Intronic
1136068983 16:27776848-27776870 GGGCTGGGGGTGCCAGGCGTGGG - Intronic
1136093596 16:27937945-27937967 GAGGTGGGGCAGACAACCATGGG - Intronic
1136115510 16:28091868-28091890 GTGCTGGGGAAGGCAGGCATGGG + Intergenic
1137270141 16:46897850-46897872 AGGCTAAGGGAGACAGCCAGAGG - Intronic
1138287395 16:55820801-55820823 GGGCTAGGGGAGGCAGGCAGAGG - Intronic
1138606579 16:58093897-58093919 GGGCTGGAGGAGACACCAATGGG - Intergenic
1139558650 16:67728296-67728318 GGGCTGGGGTAGGCAGGCTTTGG - Intronic
1141163261 16:81643366-81643388 GGGCTGGGGGAGAGTACAATAGG + Intronic
1141480360 16:84302197-84302219 GGGCTGGGGGAGGGAGGAATAGG + Intronic
1141832981 16:86520002-86520024 GGGCAAGGGGAGGCAGCCAGGGG + Intergenic
1142008786 16:87703320-87703342 GGGCTGGGGGAGACATGCCCTGG - Intronic
1142008797 16:87703362-87703384 GGGCTGGGGGAGACATGCCCTGG - Intronic
1142361690 16:89630607-89630629 GGGCTGGGGGAGCCAGGGCTGGG + Intronic
1143186527 17:5013610-5013632 GGTCAGGGGGAGCCAGCCAGGGG - Intronic
1143336181 17:6173265-6173287 GGGCTAGGGCAGACAGCACTGGG - Intergenic
1143512976 17:7405934-7405956 CGGCTGGGGGAGTCAGGCCTGGG + Intronic
1144556387 17:16286324-16286346 GGTCTGGGGGAGAAAGACCTGGG + Intronic
1144629897 17:16865761-16865783 GGGCTTGGGGACTCAGCCGTGGG - Intergenic
1144651533 17:17010356-17010378 GGGCTTGGGGACTCAGCCGTGGG + Intergenic
1144666941 17:17108341-17108363 AGCCTGGGACAGACAGCCATCGG + Intronic
1146581343 17:34040663-34040685 GTGCTGCAGGTGACAGCCATGGG + Intronic
1146641499 17:34545187-34545209 GGGCTGGGGGAGGGAGGAATGGG + Intergenic
1146926917 17:36751660-36751682 GGGTTGGGGGAGGCAGCCTGAGG + Intergenic
1146944455 17:36864424-36864446 GGGGTGGGGCAGACAGCCCCAGG - Intergenic
1147886472 17:43687739-43687761 GGGCTGCGGGAAAAAGCCCTGGG + Intergenic
1147953775 17:44121416-44121438 GGGAAGGGGGAGACAGCAAGGGG - Intronic
1148135802 17:45290833-45290855 GGGTTGGGGGAGAAAGGCAGGGG + Intronic
1148440258 17:47708526-47708548 GGGCAGGGGGAGGCAGCCGCGGG + Intronic
1148444717 17:47730711-47730733 GGGCTGGGAGGAGCAGCCATGGG + Intergenic
1148497397 17:48061131-48061153 TGCCTGGGGGAGGCAGACATGGG + Exonic
1149436635 17:56639032-56639054 GGGCAGGGGGAGACTGCACTAGG + Intergenic
1149599208 17:57882305-57882327 GGGGTTGGGGAGACTGCCAAGGG + Intronic
1149658691 17:58323590-58323612 GGGCTGGGGCAGGCTGCCCTGGG - Intronic
1150327613 17:64269386-64269408 GGGCTGGGGCTGTCATCCATTGG - Intergenic
1150590258 17:66556055-66556077 TGGATGGGCGAGCCAGCCATGGG + Intronic
1150610289 17:66727946-66727968 GGGTTGAGGGAGACAGCCAGTGG - Intronic
1150614099 17:66755603-66755625 AGGCTGGGTGAGACAGCCCTGGG - Intronic
1151323504 17:73365393-73365415 GGGCTGCGGGAGACAGCAAAGGG + Exonic
1151359769 17:73581832-73581854 GGGAGGGGGCAGACAGCCATTGG + Intronic
1151478139 17:74355199-74355221 GGGTTGGGGGGAACAGCCAGGGG - Exonic
1151646924 17:75439013-75439035 GGGCTGGGGGAGGCAGTGACGGG + Intergenic
1151785775 17:76274205-76274227 CGGCTGGGAGAGACGGCCCTCGG + Exonic
1151818845 17:76485971-76485993 GGGCAGGGGGTGACAGCTAAAGG + Intronic
1151977183 17:77489548-77489570 TGGCTGGTGGAGGCAGCCGTGGG + Intronic
1152272062 17:79330595-79330617 GGCCTGGGGGAGACAGGAGTGGG - Intronic
1152778509 17:82216296-82216318 GGCCTGGGGGAGCCAGCACTGGG - Intergenic
1153299652 18:3581519-3581541 GGGTTGGGGCACACAGACATTGG + Intronic
1153342967 18:3994187-3994209 AGGGTGGGGGAGACAGCTCTGGG + Intronic
1153478202 18:5519568-5519590 GGGCTGGGGTACACAGCCAATGG - Intronic
1153530271 18:6039037-6039059 GGGCTGGGGGAGAGAGGGTTGGG - Intronic
1153559013 18:6351353-6351375 GGTCTGGGGGAGAAGGCAATGGG + Intronic
1157388518 18:47280965-47280987 GGGCTTGGGGAGAGAGAAATGGG - Intergenic
1158105953 18:53885247-53885269 GGGGTGGGGGAGAAAGAGATGGG + Intergenic
1158105960 18:53885267-53885289 GGGGTGGGGGAGAAAGAGATGGG + Intergenic
1158819091 18:61137594-61137616 GGGCTGGGGGAGAGGGAAATGGG - Intergenic
1159617733 18:70600756-70600778 GGGCTGGGGGAGAAGGGAATGGG - Intergenic
1160665324 19:325445-325467 GGGCAGGGGCAGGCAGCAATAGG + Intronic
1160822532 19:1065192-1065214 GGGCTGGGGGAGGCAGGCTGGGG + Intronic
1160980624 19:1815081-1815103 GCCCTGGGGGAGCCAGCCCTGGG + Intergenic
1161273799 19:3404522-3404544 GGGCTGGGGGAGGCGGCCCAGGG + Intronic
1161301291 19:3544294-3544316 AGCCTGGAGGAGACAGCCACGGG - Exonic
1161977047 19:7612747-7612769 GGGCTGGGGGATGCAGCTTTGGG - Exonic
1162320202 19:9967137-9967159 GGACTTGGGGGGACACCCATGGG - Intronic
1162582130 19:11537913-11537935 GGGCTGGAGGAGACAGAACTGGG + Intergenic
1163228581 19:15981397-15981419 GGACTGGGGGATGCAGCCACAGG + Intergenic
1163821257 19:19497820-19497842 GGGCTGGTGGAGACAGTCAAGGG + Intronic
1165746234 19:38231253-38231275 GAGCAGGGGGAGACAGCCTGGGG + Intergenic
1166108784 19:40610485-40610507 GGACTGGGGCAGACAGCCCCGGG - Intronic
1167263573 19:48472403-48472425 GGGCTGAACAAGACAGCCATCGG + Exonic
1167587429 19:50382902-50382924 GGGCTAGGGGGGAGAGCCATGGG - Exonic
1167773364 19:51537800-51537822 GGGCTGGACAAGACAGCCTTTGG + Intergenic
1202714938 1_KI270714v1_random:36917-36939 GGGCTGGGAGTGCCAGCCAGCGG - Intergenic
925280695 2:2682651-2682673 AGGATGGAGGACACAGCCATTGG + Intergenic
925361585 2:3284031-3284053 CGTCTTGGGGAGACAGCCCTGGG - Intronic
926207744 2:10846014-10846036 GCCCTGGGGGAGGCAGCCTTGGG + Intergenic
926418866 2:12677845-12677867 GCACTGGGAAAGACAGCCATTGG - Intergenic
927181005 2:20446878-20446900 GGGCTGGGAGAGGCAGCGACCGG - Intergenic
927948756 2:27153319-27153341 GGGCTGGGTCACACAGCCAGAGG + Exonic
928429563 2:31206222-31206244 GGGATGGGAGAGACATCCTTGGG - Intronic
928534094 2:32222870-32222892 GGGATGGGGAAGACATGCATGGG - Intronic
929410341 2:41692185-41692207 TGGCTGTGAGAGACACCCATGGG - Intergenic
930224702 2:48780378-48780400 GGGCTGGGGGAGGGAGAAATGGG + Intergenic
931224834 2:60320741-60320763 GTGCTGGGGGAGCCAGCAAGGGG - Intergenic
932612097 2:73207420-73207442 GGGATGAGGGAGTGAGCCATTGG - Intronic
934071488 2:88388205-88388227 GGGCTGGGGGAGGAAGAAATGGG + Intergenic
934686740 2:96326887-96326909 GTGCTGGGGAAGAAAGACATGGG + Exonic
936286721 2:111186932-111186954 GGGTTGGGGGTGCCAGGCATAGG + Intergenic
936484364 2:112913902-112913924 GGGATGGGGGATGGAGCCATTGG + Intronic
936507381 2:113118178-113118200 GGGCACGGGGAGGCATCCATGGG + Intronic
937246786 2:120498955-120498977 GGGCTGGGGGAGCCTGGCAGGGG - Intergenic
937450092 2:121994682-121994704 GTGCTGTGGGACACAGCAATGGG + Intergenic
938139168 2:128782494-128782516 GAGATGGAGGAGGCAGCCATGGG + Intergenic
940219698 2:151338893-151338915 GGGGTGGGTGAGACAGTCAGGGG + Intergenic
940897920 2:159098644-159098666 GGGGTGGGGGAAACAGACTTTGG + Intronic
941876143 2:170435306-170435328 GGGCTGGTGGAAACAGCAAGGGG + Intronic
944823126 2:203451728-203451750 GGGGAGGAGGAGATAGCCATAGG - Intronic
947396897 2:229695486-229695508 GCTCTGGTGGAGACAGCCCTGGG + Intronic
947769712 2:232661308-232661330 GGGCTGGGAGAGAGGGGCATGGG - Intronic
948607035 2:239142451-239142473 GGGCTGGGGCAGAGAGGCAGAGG - Intronic
948934760 2:241156117-241156139 AGGCTGGAGGAGCCAGCCCTTGG + Intronic
1168856313 20:1011671-1011693 GGGCTGGGGGAGATAGGGATTGG + Intergenic
1169200355 20:3706266-3706288 GGGCTGGGGCTGAGAGCCAAGGG + Intronic
1171194921 20:23189497-23189519 TGGCTGGGAGAGAGAGCTATGGG + Intergenic
1171329212 20:24322830-24322852 GGGGTGGAGGAGAGAGACATGGG + Intergenic
1171363965 20:24611136-24611158 GGGCTAGGGGAGGGAGCCGTGGG - Intronic
1172837193 20:37880782-37880804 GGGCTGGGGGAGGTAGCCATGGG - Intergenic
1173500693 20:43550637-43550659 GGGCTGGGCGAGGCTGCCAGGGG - Intronic
1174281865 20:49445489-49445511 GGTCTGGGGCAGCCAGCCACCGG - Intronic
1174625731 20:51912898-51912920 TGGCTGGAGGAGCCAGCCAGGGG - Intergenic
1175293391 20:57893125-57893147 GGGCTGGGGGTGTCAGGCAGGGG - Intergenic
1175487271 20:59355324-59355346 GTGGTGGGGGAGACAGGCAGAGG - Intergenic
1175817767 20:61892525-61892547 GGGCTGGGAGAGAATTCCATGGG + Intronic
1178687606 21:34723609-34723631 AGTTTGGGGGACACAGCCATGGG - Intergenic
1179375811 21:40848952-40848974 GGGCTGTGGGAGAGAGACAGTGG - Intergenic
1179711768 21:43267637-43267659 GGGCTGGGGGTGGCAGCACTGGG + Intergenic
1180840664 22:18957460-18957482 GGGCTGGGGGAAGCAGCCATGGG + Intergenic
1181060824 22:20281314-20281336 GGGCTGGGGGAAGCAGCCATGGG - Intronic
1181482371 22:23208373-23208395 GGACTGTGGGAGATAGTCATTGG + Intronic
1181523372 22:23462300-23462322 GGGCTGGGGGCTTCATCCATGGG - Intergenic
1181523403 22:23462398-23462420 GGGCTGGGGGATTCATCCACGGG - Intergenic
1181542728 22:23582396-23582418 GGGCTGGGGGAGGGAGGAATGGG - Intergenic
1181584124 22:23843690-23843712 GGGAAGGGGGAGAGAGCCAGGGG + Intergenic
1182129548 22:27840843-27840865 GGGCTGTGGCAGAGAGCCCTGGG - Intergenic
1182766915 22:32764363-32764385 GGGTTGGGGGTGACATCCATGGG - Intronic
1185286296 22:50001300-50001322 GGGAAGGGGGAGAGAGCCCTGGG + Intronic
1185332406 22:50257663-50257685 GGGCCGGTGGAGACAGACACAGG + Intronic
949508281 3:4746473-4746495 GGGCTTGGGGAGCCTGCCAAAGG - Intronic
950760473 3:15219600-15219622 AGGGTGGGTGAGATAGCCATGGG + Intronic
951202845 3:19893735-19893757 GGGCTGGGGAAGATACCCAAAGG - Intronic
951838463 3:27007094-27007116 GGGCTGGGGGAGATAGCATTAGG + Intergenic
952050072 3:29374053-29374075 GGGCTGAGTGGGACAGCAATGGG + Intronic
952312841 3:32205884-32205906 GGGCTGGGGGAGATAGGAAGTGG - Intergenic
952920007 3:38277595-38277617 CGGCAGGAGGTGACAGCCATGGG - Exonic
953110822 3:39936405-39936427 GGGCTGGAGGAAACAGGAATGGG + Intronic
953569330 3:44058728-44058750 GGGCTGTGGGAACCAGCCGTGGG + Intergenic
953661349 3:44893969-44893991 GGGGGGTGGGAGAGAGCCATGGG - Intronic
953661423 3:44894174-44894196 GGGGGGTGGGAGAGAGCCATGGG - Intronic
953661431 3:44894194-44894216 GGGGGGTGGGAGAGAGCCATGGG - Intronic
953661439 3:44894214-44894236 GGGGGGTGGGAGAGAGCCATGGG - Intronic
953661461 3:44894274-44894296 TGGGTGGGGGAGAGAGCCGTTGG - Intronic
953661479 3:44894322-44894344 GGGGTATGGGAGATAGCCATGGG - Intronic
953884463 3:46707578-46707600 GGGCTGGAGGAGACCTCCAGGGG - Intronic
954448079 3:50557334-50557356 GGGCTGGGGGACAGGGCCTTAGG - Intergenic
954632991 3:52056879-52056901 GGGGTGGGGGTGCCAGGCATAGG - Intergenic
954703193 3:52463111-52463133 GGGCTGGGGGACAGAGGGATGGG - Intronic
956658776 3:71580242-71580264 GGGGTGGGGGATGCAGCCAGTGG + Intronic
958823918 3:99007493-99007515 GTGCTGGGGGAGAATCCCATGGG + Intergenic
961224524 3:125229384-125229406 TGGCTGAGGGTGCCAGCCATCGG - Exonic
962312720 3:134337519-134337541 GGTCTGGGAGAGACAGACAGGGG - Intergenic
962391376 3:134975518-134975540 GGGCTAGGGGAGACAGTCCTGGG - Intronic
963056800 3:141192901-141192923 GGGCAGGGGGAGATAGACAAAGG + Intergenic
965071469 3:163920520-163920542 GGTCTGGTGGAGTCAGCCAGTGG + Intergenic
965077893 3:164002550-164002572 GTGCTGGGGGAGAGAGCCAATGG + Intergenic
967709450 3:192688098-192688120 GGGCTGGGGCAGAAAGTGATGGG - Intronic
968468731 4:766743-766765 GGGCTGGGTGTGTCAGCCACAGG - Exonic
969077345 4:4590501-4590523 GGGGTGGTGGAGAGAGCCCTGGG - Intergenic
969209147 4:5672982-5673004 GGGCTGGGGGAGAAGGAAATGGG + Intronic
969564304 4:7968668-7968690 GGACTGGGGGAGAGAGGAATGGG + Intronic
969586304 4:8096081-8096103 GGGTTGGGGGAGAGACCCAAGGG - Intronic
971077317 4:23164915-23164937 GTGCTGGAGAGGACAGCCATAGG - Intergenic
973392273 4:49566632-49566654 GGGTTGGGGGTGAAAGGCATGGG + Intergenic
975176918 4:71299826-71299848 GGGCTGGAGCAGCCAGCCAGAGG + Intronic
975847603 4:78541502-78541524 GGGCTGGGGGAGGGAACCAAAGG - Intronic
975969119 4:80012643-80012665 GGGGTGGGGGAGACAGACGTGGG + Intronic
976104355 4:81600994-81601016 GGGCTAGAGGGGACAGCCATGGG + Intronic
976269479 4:83216932-83216954 GGGCTGGGGGAGAGGGGAATAGG + Intergenic
976486961 4:85618142-85618164 GGGCTGGGTGAGACAGGAAATGG - Intronic
977051206 4:92129866-92129888 GGGCTGGTGGTGATAGCCACAGG - Intergenic
977627514 4:99203342-99203364 GGGCTGGGGCAGAAAGTCAAAGG + Exonic
978522869 4:109634933-109634955 GGGCTAGGGGAGAGAGCATTAGG - Intronic
978757271 4:112316194-112316216 GGGCTGGGGAAGAGAGAAATGGG - Intronic
981623812 4:146734555-146734577 GGGGTGTGGGAGACAGTCTTGGG + Intronic
985723093 5:1501013-1501035 GGTCTGGGGGAGGCCACCATGGG + Intronic
986814277 5:11391027-11391049 GGACTGGGGGAGGAAGACATTGG + Intronic
987097112 5:14559885-14559907 TGACTGGAGGAGGCAGCCATAGG + Intergenic
988914181 5:35875782-35875804 GGGCTGGAGGGCACAGCCAGTGG + Intronic
992023393 5:72647553-72647575 AGGCATGGGAAGACAGCCATAGG + Intergenic
992089911 5:73307494-73307516 GGGCTGGGGGTGACAGGAAGGGG + Intergenic
992949128 5:81839342-81839364 GGGGTTGGGGAGAAAGCCAAAGG + Intergenic
995526404 5:113053773-113053795 AGCCTCGGGGAGACAGCCAGAGG - Exonic
995533054 5:113109933-113109955 AGGCTGAGGGAGAAAGCCAGTGG - Intronic
995551714 5:113288202-113288224 AGGCTTGGGGAGAAAGCCAAAGG - Intronic
995799511 5:115978814-115978836 GGGCTGGGGGTGACAGGGAGAGG + Intronic
997292445 5:132747580-132747602 GGTCTGGAGGAAACAGCCCTGGG + Exonic
997385380 5:133468171-133468193 AGGCTGGGGGAGGCAGGCAGGGG + Intronic
997596928 5:135113323-135113345 GGGTTGGAGGAGACATCTATAGG + Intronic
999322758 5:150625255-150625277 GGGCTTGGGGAGACAGACTCTGG - Intronic
999456427 5:151720153-151720175 GGGCTGGGGGAAACATCCATTGG - Intergenic
1001079122 5:168654065-168654087 GGGCTGGGGGAGACGGAACTGGG - Intergenic
1002066839 5:176656144-176656166 GGGCTGGGGCAGGCAGGCAGGGG + Intronic
1002083081 5:176748953-176748975 GGGCTGGGGGAGACGGCAGGTGG + Intergenic
1002643426 5:180641275-180641297 GGGCCTGGGGACAGAGCCATGGG - Intronic
1002684456 5:180997282-180997304 GGGCTGGGGGAACCAGCCTGAGG - Exonic
1004262316 6:14118608-14118630 GGGCTAGGGGAGGAAGCCAAGGG - Intronic
1006383816 6:33717578-33717600 GGGCTGGGGGAGAAAGGCTAAGG + Intergenic
1007097275 6:39221307-39221329 GGGCTGGGAGTGACAGGCTTGGG - Intronic
1007260039 6:40557037-40557059 GGGATGGGGGAGCCAGACTTGGG - Intronic
1007357638 6:41332885-41332907 GAGCTGGGGCAGAGAGCCATTGG + Intergenic
1007938703 6:45756678-45756700 GGAATGGGGGAGAGAGCCAATGG - Intergenic
1011570838 6:88732781-88732803 GGGCTGGAGGAGGAAGCAATGGG + Intronic
1011648666 6:89485082-89485104 GGGCTGGGTGAGACAGTCTGGGG - Intronic
1013123019 6:107157516-107157538 GGGGTGGGGGAGACAGCCCCAGG - Intronic
1013316246 6:108945962-108945984 GGGGCTGGGAAGACAGCCATAGG - Intronic
1013591783 6:111624895-111624917 GGGCTGGGAGAGAGAGAAATGGG + Intergenic
1015308366 6:131735810-131735832 GGGCTGGGGGAGGGAGAAATGGG + Intronic
1016933229 6:149429174-149429196 AGGCTGGGTGTGAGAGCCATGGG - Intergenic
1019706038 7:2497819-2497841 GGGCTGAGGGAGTCACCCACAGG + Intergenic
1020083646 7:5299174-5299196 GGGGTGGGGGAGGCAGGCAGGGG + Intronic
1022035960 7:26534840-26534862 GGGCTGGGAGGGAGAGCCCTGGG - Exonic
1022508860 7:30922733-30922755 AGGCTCTGGGAGACAGCCAGAGG + Intronic
1022666648 7:32416993-32417015 CGGCTGGGAGAGCCAGGCATGGG - Intergenic
1022958134 7:35400184-35400206 GGGCTGGTGGAGAGACCCAGTGG + Intergenic
1024541581 7:50479508-50479530 GGGCAGGTGGGCACAGCCATGGG - Intronic
1025210629 7:57018010-57018032 GGGGTGGGGGAGGCAGGCAGGGG - Intergenic
1025258162 7:57399320-57399342 GGGCTGGGGGAGGCAGCTGAGGG + Intergenic
1025610465 7:63072370-63072392 GGGCTGGGGGAGGCAGCTGAGGG - Intergenic
1025661327 7:63558837-63558859 GGGGTGGGGGAGGCAGGCAGGGG + Intergenic
1026878555 7:73893846-73893868 GGGCTGGGGGAGCCTCCCCTGGG - Intergenic
1029456931 7:100676192-100676214 GGGCTGGGGGAGGCAGCTCCTGG - Exonic
1029702690 7:102258032-102258054 GGGGTGGGGGAGGCACCCGTCGG + Exonic
1034547071 7:151796143-151796165 GAGCTGGTGGGGACAGACATGGG + Intronic
1035275419 7:157745383-157745405 GGTCTGCGGGAGGCAGGCATGGG + Intronic
1035690867 8:1558388-1558410 GGCCTGGGGGACACACCTATGGG + Intronic
1037842532 8:22255606-22255628 AGGCTGGAGGAGTGAGCCATAGG + Intergenic
1038006100 8:23431693-23431715 GGGGTGGGGGAAACACCAATTGG + Exonic
1039953630 8:42191082-42191104 GGGCTGGGGGGGGCGGCCACTGG - Intronic
1040309146 8:46227649-46227671 GGGGTGGGAGAGACATCCCTAGG - Intergenic
1040330289 8:46382404-46382426 GGGATGGGAGAGTCATCCATTGG - Intergenic
1041497961 8:58507785-58507807 GTGGTGGGGGAGAAAGCCAAAGG + Intergenic
1042847753 8:73185401-73185423 GGGCTGTGGGAGACAGGCCTTGG + Intergenic
1046770537 8:118112334-118112356 GGGCTGGGAGAGGCAGCTTTCGG - Intergenic
1047594693 8:126366478-126366500 GCGGTGGGGGAGGCAGGCATGGG - Intergenic
1048325775 8:133437725-133437747 GGGCTGGGGGACAGGGCCCTCGG + Intergenic
1048475143 8:134736139-134736161 GGGAGAGGGGAGCCAGCCATGGG + Intergenic
1048956688 8:139543368-139543390 TGGCAGGGAGAGACATCCATGGG + Intergenic
1048967776 8:139626650-139626672 GGGCTGGGGGAGACAGCCATGGG - Intronic
1049058027 8:140254362-140254384 GGGCTGGGGGAGGCGGGCTTTGG - Intronic
1049640336 8:143712379-143712401 GAGCTGGTGGTGACAGCCAAGGG + Intronic
1049978033 9:878296-878318 GGACTGTGGGAGACAGACTTTGG + Intronic
1050691190 9:8228383-8228405 GGGAGGAGGTAGACAGCCATTGG + Intergenic
1053281661 9:36824209-36824231 GGGCTGAGGGACACAGCCTCAGG + Intergenic
1053430338 9:38038143-38038165 GGGCTGGGGCACACATGCATGGG - Intronic
1056761434 9:89418270-89418292 GTGCTGGGGAAGACAGCACTGGG + Intronic
1057443751 9:95099577-95099599 GAGCTGGGGGAGCCACCCCTCGG - Exonic
1059236693 9:112766614-112766636 GGGCTGGGGAAGACAGAGAATGG - Intronic
1060214233 9:121728815-121728837 GGGGAGGGGGGGACAGCCAGGGG + Intronic
1060361072 9:122958232-122958254 TGCCTGGGGGAGGCAGACATGGG - Intronic
1060720045 9:125970591-125970613 GGACTTGGGAAGACACCCATGGG - Intergenic
1060817176 9:126641129-126641151 GAGCTGTGGGAAACAGCCTTGGG + Intronic
1061250488 9:129423441-129423463 GGGCCGGGGGACACGGCCACAGG + Intergenic
1061293418 9:129665236-129665258 CTGCTGGGAGAGACAGCCTTGGG + Intergenic
1061496903 9:130980279-130980301 GGGAAGAGGGAGACAGCAATAGG - Intergenic
1061890578 9:133617048-133617070 GGGCTGGGGGTGAGAGCAGTGGG + Intergenic
1062056630 9:134472423-134472445 GGGCTGGGGCAGCCACCCACAGG - Intergenic
1062308816 9:135924851-135924873 GGGCTGGGGGAGGGAGGAATGGG - Intergenic
1062470295 9:136700334-136700356 GGGCTGGGGGAGGGAGCAGTGGG - Intergenic
1185880550 X:3736214-3736236 GGGCTGGGGCAGAGAGCCCTGGG - Intergenic
1187376053 X:18755704-18755726 GGGCTGGGGGAGGGAGCAACTGG - Intronic
1188770253 X:34145629-34145651 GGGCTGGGGGAGAAGGCAACGGG + Intergenic
1189173747 X:38933769-38933791 GGGCTTGGGGAGCCAGGCAGAGG + Intergenic
1190115077 X:47620963-47620985 GTGCAGGGGGAGACAGCCATGGG - Intergenic
1190287714 X:48971840-48971862 GGGCGGGGAGAGAGAGCCAGAGG - Intergenic
1190289524 X:48983095-48983117 GGGATGGGGCAGACTGTCATGGG + Intronic
1191043595 X:56112341-56112363 GGGCTGGGGGAGATAGCATTAGG + Intergenic
1192142739 X:68659531-68659553 GGGCTGGAGGAGAGAGACACGGG - Intronic
1192178728 X:68902359-68902381 GGACTGGGGGAGGCAGGCCTGGG + Intergenic
1192318558 X:70069757-70069779 CAGCTGGGGCAGACAGCCCTGGG - Intergenic
1192557460 X:72101759-72101781 GGGCTGGAGGAGGCAGCAGTAGG - Intergenic
1195602590 X:106765850-106765872 GGGCTGGGGGGGATAGCATTAGG - Intronic
1195671157 X:107471193-107471215 GGCCTGTGGGAGGCAGCCAAGGG - Intergenic
1197769787 X:130082690-130082712 GGGCTGTGGGAGGCAGGCCTGGG - Intronic
1198766755 X:140088033-140088055 GAGCTGTGGGAGGCAGCCATGGG + Intergenic
1199854845 X:151751832-151751854 GAGCTGGGGTAGGCAGGCATGGG + Intergenic
1200315155 X:155124643-155124665 GGGCAGGGGGAGAGATCCAGTGG + Intronic
1200784603 Y:7249138-7249160 GGGCTGGGGCAGAGAGCCCTGGG + Intergenic