ID: 1048967777

View in Genome Browser
Species Human (GRCh38)
Location 8:139626651-139626673
Sequence TGGGCTGGGGGAGACAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 490}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048967777_1048967791 18 Left 1048967777 8:139626651-139626673 CCATGGCTGTCTCCCCCAGCCCA 0: 1
1: 0
2: 4
3: 64
4: 490
Right 1048967791 8:139626692-139626714 TGCCCAGCACCGGAAGGAGATGG No data
1048967777_1048967789 8 Left 1048967777 8:139626651-139626673 CCATGGCTGTCTCCCCCAGCCCA 0: 1
1: 0
2: 4
3: 64
4: 490
Right 1048967789 8:139626682-139626704 TGGGACAGGCTGCCCAGCACCGG No data
1048967777_1048967790 12 Left 1048967777 8:139626651-139626673 CCATGGCTGTCTCCCCCAGCCCA 0: 1
1: 0
2: 4
3: 64
4: 490
Right 1048967790 8:139626686-139626708 ACAGGCTGCCCAGCACCGGAAGG No data
1048967777_1048967784 -6 Left 1048967777 8:139626651-139626673 CCATGGCTGTCTCCCCCAGCCCA 0: 1
1: 0
2: 4
3: 64
4: 490
Right 1048967784 8:139626668-139626690 AGCCCACAGTTCCCTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048967777 Original CRISPR TGGGCTGGGGGAGACAGCCA TGG (reversed) Intronic
900089535 1:913870-913892 TGGGCTGGGGGCAGCAGCCGCGG - Intergenic
900139686 1:1134498-1134520 GGAGCTGGTGGAGACACCCAGGG - Intergenic
900163693 1:1236389-1236411 TGAGCTGGGACAGTCAGCCAGGG - Intergenic
900497247 1:2981437-2981459 GGGGCAGGGGGAGACATCCGGGG - Intergenic
900543925 1:3218051-3218073 TGGGATGGGGGCGGCAGCGAGGG - Intronic
900571046 1:3358369-3358391 TGGGCAGTGGGTGGCAGCCATGG + Intronic
900645619 1:3707404-3707426 TGGGATGGGGGAGAGACCCGGGG + Intronic
901041818 1:6368595-6368617 TGGGCTCTGGGAGACTCCCAGGG + Intronic
901203717 1:7482169-7482191 TGGGCTTGGGGGGATAGACAAGG - Intronic
901500493 1:9649881-9649903 GAGGCTCGGGGAGACAGCCCAGG - Intergenic
902914621 1:19629275-19629297 TGGGTTTGGGGAGACAGCGATGG + Exonic
903474608 1:23610951-23610973 TCGGGTGAGGGACACAGCCAAGG + Intronic
904237819 1:29125380-29125402 TGGGCTGGGAGAGGCAGGCATGG - Intergenic
904859888 1:33528139-33528161 GGGCCTGGGCCAGACAGCCAAGG + Intronic
905360802 1:37418948-37418970 GGGGCTGGGGCAGACAGCTGAGG - Intergenic
905503242 1:38455879-38455901 TGGTCTGGTGGAGACAATCAAGG - Intergenic
906239858 1:44236164-44236186 AGGGCAGGGGGAGGCAGCTAGGG - Intronic
906406163 1:45544030-45544052 TGGGCTAGGGCAGGCAGGCAAGG - Intergenic
906696541 1:47827207-47827229 TGTAATGGAGGAGACAGCCAGGG + Intronic
906763072 1:48396754-48396776 GGGGTTGGGGGAGACAGGAATGG + Intronic
907188915 1:52632981-52633003 GGGGCTGGGGCAGACAGACAAGG - Intergenic
907583210 1:55590693-55590715 GGGGGTGGGGGAGACAGGAATGG - Intergenic
907771358 1:57468023-57468045 GGGGCCAGGGGAGACAGCCAGGG - Intronic
907927481 1:58968071-58968093 TGGGCTGGGAGAGGCAACTATGG + Intergenic
909869602 1:80722848-80722870 TGGCCTGGGGTGGTCAGCCAAGG + Intergenic
910687087 1:89928476-89928498 TGGGCTGGAGAAAACAGCAAGGG + Intronic
910891263 1:92022798-92022820 TGGGGTGGGGGAGGCAGCTTGGG + Intergenic
911580525 1:99628400-99628422 TGAGATGGGGGAGACAGATAAGG + Intergenic
911610522 1:99954993-99955015 TGGCCTGGGCGACAGAGCCATGG - Intergenic
912529608 1:110310765-110310787 TGGGCTGGGAGAGAGGACCATGG - Intergenic
913565751 1:120070298-120070320 TGGGCTGGGGGATTCAGGGAAGG + Intergenic
913632378 1:120723256-120723278 TGGGCTGGGGGATTCAGGGAAGG - Intergenic
914286343 1:146229672-146229694 TGGGCTGGGGGATTCAGGGAAGG + Intergenic
914547375 1:148680414-148680436 TGGGCTGGGGGATTCAGGGAAGG + Intergenic
914619140 1:149389946-149389968 TGGGCTGGGGGATTCAGGGAAGG - Intergenic
915301789 1:154955940-154955962 TGGGCTGGGGGAGGAAGGCCAGG - Intronic
915302090 1:154957483-154957505 TGGGGTGGGGAAGGCAGGCATGG - Exonic
916727958 1:167540225-167540247 TGGGGAGGGGGAGTCAGCCTTGG - Intronic
917920054 1:179743576-179743598 TGGGCAGAGGGAGGCAGCCGGGG - Intronic
918427916 1:184429004-184429026 TGGGTTGGGGGATGGAGCCAGGG - Intronic
919023369 1:192136895-192136917 ATGGCTGGGGGAAACAGCTAAGG - Intergenic
919685527 1:200479918-200479940 TGGGCTGGGAGGGATGGCCATGG - Intergenic
919739737 1:200974417-200974439 TGCACGGGGGAAGACAGCCAGGG + Intronic
920147239 1:203872547-203872569 TGGGCTGGGAGGGGCTGCCATGG + Intergenic
922674910 1:227544074-227544096 TGAGCTGGGGGAGTCAGGCAGGG - Intergenic
922741704 1:228017749-228017771 TGGGCTGGCGGAGACAGCGGTGG + Intronic
922774211 1:228207489-228207511 CGGGCTGGGGACCACAGCCAGGG - Intronic
923111583 1:230894861-230894883 TGGGCTGGGCGAGGCACCTAAGG - Intergenic
1062795043 10:338800-338822 TGGGCTGTGGGAGCCAGGCAGGG - Intronic
1062795053 10:338848-338870 TGGGCTGTGGGAGCCAGGCAGGG - Intronic
1062795067 10:338889-338911 TGGGCTGTGGGAGCCAGGCAGGG - Intronic
1062795085 10:338953-338975 TGGGCTGTGGGAGCCAGGCAGGG - Intronic
1064018142 10:11788368-11788390 TGGGCTGCGGGAAGGAGCCATGG + Intergenic
1064119306 10:12605476-12605498 TGGGCAGGGGTGGGCAGCCAGGG - Intronic
1064169934 10:13022081-13022103 TGGGCTGGGGGAGGAAGGAATGG - Intronic
1064676001 10:17761126-17761148 TGGGATGAGAGAAACAGCCATGG - Intronic
1066125823 10:32341856-32341878 TGGGCTGGGGCAGAAAGCCCAGG - Intronic
1067469030 10:46523106-46523128 TGGGCTGGTGGAGACATGTAGGG - Intergenic
1067523986 10:47027476-47027498 TGGGGAGAGGGAGAGAGCCAGGG + Intergenic
1067664950 10:48269820-48269842 TGGGAAATGGGAGACAGCCAAGG + Intronic
1067683134 10:48452475-48452497 TGGGGTGGGAGACCCAGCCAGGG + Intronic
1069219477 10:65865344-65865366 TGGGGTGTGGGACAGAGCCATGG + Intergenic
1069572628 10:69503690-69503712 GGGGCTGGGGGGGACGGTCATGG + Intronic
1069709229 10:70478538-70478560 TGGGGCGGGGGAGACTGCCCGGG - Intergenic
1069763282 10:70831386-70831408 GGGGTTGGGGGAGACAGGTATGG - Intronic
1069769435 10:70888215-70888237 TGGGCCGGGGAAGACAGTCGTGG - Intronic
1069877774 10:71573753-71573775 TGGGCTGGGGGAGCCAGAAAAGG + Intronic
1071515835 10:86296099-86296121 TGGGCTGTGGCTGCCAGCCATGG - Intronic
1072257657 10:93635745-93635767 TGGGCTGAGAGAGAGAGACAGGG + Intronic
1072436249 10:95417001-95417023 TGGGCTGGGTGAGATGGGCATGG - Intronic
1073107433 10:101040267-101040289 GGTGGTGGGGGAGACAGCGAGGG - Exonic
1073327488 10:102651074-102651096 TGGCCAGGGGGTGCCAGCCAGGG - Intronic
1073445373 10:103577090-103577112 TGGGCTGGGGGAAACAGCTGAGG + Intronic
1074134551 10:110615417-110615439 TGGGCTAGAGGAGACAACTATGG - Intergenic
1074355292 10:112777424-112777446 TGGGAGGATGGAGACAGCCACGG + Intronic
1074718848 10:116247522-116247544 AGGGCTGGGAGAGCCAGCCAGGG - Intronic
1074875119 10:117607627-117607649 TGGGCTGGGAGAGGAAGCCCAGG + Intergenic
1074886566 10:117698716-117698738 AAGTCTGGGGGACACAGCCACGG + Intergenic
1076352468 10:129826531-129826553 GGTGATGGGGGTGACAGCCAAGG - Intergenic
1076478617 10:130769434-130769456 TGTGCTGAGGGAAGCAGCCAGGG - Intergenic
1076723022 10:132400982-132401004 GGGGCTTGGGCAGGCAGCCAGGG + Intronic
1077465715 11:2732849-2732871 TGGGGCAGGGGAGACCGCCAGGG - Intronic
1077477426 11:2797084-2797106 TGGGGTGCTGGAGACAGCCCAGG - Intronic
1077836866 11:5933787-5933809 TTGGCTGGGGGAGTCAGGGAGGG - Intronic
1078478176 11:11652321-11652343 TGGGCTGGGGGTGGAAGCCTGGG - Intergenic
1080720375 11:34842406-34842428 GGGGATGGGGGAGACAGGCCTGG - Intergenic
1081525311 11:43924256-43924278 TGGTCTGGGAGAGACAGCCCTGG + Intergenic
1081584550 11:44375483-44375505 TAGGATGGAGGAGGCAGCCACGG - Intergenic
1081598086 11:44473144-44473166 TGGGCTTGGGGCCAAAGCCATGG - Intergenic
1082175243 11:49050252-49050274 CGGGCTGGGGGAGGGAGCTAGGG - Intergenic
1082841801 11:57696105-57696127 TGAGCTGTGGAAGACAGGCAAGG + Intronic
1083138833 11:60704792-60704814 TGGGCAGGGGGACACTGCAAAGG - Intronic
1083663912 11:64264631-64264653 AAGGCTGGGGGACACAGGCAGGG + Intronic
1083743244 11:64722151-64722173 AGGGGTGGGGGAGCAAGCCAAGG + Intronic
1083763903 11:64833150-64833172 TGGGATGGGAGAAACAGCCTGGG + Intronic
1083994167 11:66264022-66264044 TGGGATGGGAGAGGGAGCCAGGG - Intronic
1084102373 11:66958167-66958189 ACGGCTGGAGGAGACAGCGACGG - Intronic
1084335891 11:68457705-68457727 TGGGCAGGAGGGGGCAGCCAGGG - Intergenic
1084400837 11:68942052-68942074 GAGGCTGGGGGGCACAGCCAGGG - Intergenic
1084484480 11:69439792-69439814 TGGGCCGGGGTCAACAGCCAAGG - Intergenic
1084497602 11:69513950-69513972 GGGGCTGGAGGAAAAAGCCAAGG - Intergenic
1084612618 11:70213045-70213067 AGGTCTGGGGGTGACAGCCCAGG + Intergenic
1084792023 11:71481049-71481071 AGGGCTGGGGGTCACACCCAGGG - Intronic
1084956137 11:72692667-72692689 GGAGCATGGGGAGACAGCCAGGG - Intronic
1085120473 11:73964383-73964405 TGGGCTGGGCTGGACAGCGAAGG + Intronic
1085127538 11:74011864-74011886 TGGGCTGGGGCAGTCAGGGAAGG - Intergenic
1085332278 11:75663563-75663585 CGTGGTGGGGGAGACAGACATGG + Intronic
1085732552 11:79011945-79011967 TAGGCTGGGGGCTACATCCAGGG - Intronic
1085764421 11:79270583-79270605 TGGGATGGGGGTGAGAGCCATGG - Intronic
1087117102 11:94537255-94537277 TGGGCTGGGGGAGGGAGGGAGGG - Intergenic
1089176563 11:116552804-116552826 TGGGTTGGGGGAGACAGTTCTGG - Intergenic
1089504664 11:118955543-118955565 AGGGCTGGAGGAGGCAGTCAGGG + Intronic
1089755299 11:120681777-120681799 TGGGCTGGAGGGGACAGAGATGG + Intronic
1090275691 11:125417791-125417813 TGGGGTGGGGGAGACATCAAAGG - Intronic
1091356272 11:134940176-134940198 TGGGCTGGGAGAGACACGAAAGG + Intergenic
1091554635 12:1563371-1563393 GGGGCAGGTGGAGGCAGCCACGG - Intronic
1091840309 12:3615776-3615798 TCTGCCGAGGGAGACAGCCAGGG - Intronic
1092764036 12:11836528-11836550 TGGGCTGTGGGAGACATTAATGG + Intronic
1094084687 12:26576668-26576690 TGGGTTGGGGGTTACAGTCAAGG + Intronic
1097467332 12:59943683-59943705 TGTCCTGGGGTAGTCAGCCAGGG - Intergenic
1097707409 12:62882360-62882382 AGAGCTGGGGCAGGCAGCCAAGG + Intronic
1097753484 12:63383862-63383884 AGTTCTGGGGGAGACAGACATGG - Intergenic
1098106147 12:67069933-67069955 GGGGGAGGGGGCGACAGCCAGGG - Intergenic
1098236112 12:68420051-68420073 GGGGCTGGGGGAGACAGAGAGGG - Intergenic
1101409975 12:104459240-104459262 TGGGCAGGGCCAGACAGCCAGGG + Intronic
1101508905 12:105375154-105375176 TGGGATGGGAGAGGCAGGCAAGG + Intronic
1101899308 12:108779450-108779472 TGGGGTGGGAGAGACAGCTCTGG + Intergenic
1102516114 12:113447998-113448020 AGGGCTGAGGGAGGCAGGCAGGG - Intergenic
1103568019 12:121826821-121826843 TGGGCGGGGGGTGACAGCCCAGG + Intronic
1104022000 12:124998597-124998619 GGGGCTGGGGGAGGGAGCAATGG + Intronic
1104677102 12:130718722-130718744 GGGGCTGGTGCAGACAGCAATGG - Intergenic
1104899697 12:132182192-132182214 TGTGCTGGTGGAGGCAGCCGTGG + Intergenic
1105840467 13:24249559-24249581 GGGGCTCTGGGAGACGGCCAAGG + Exonic
1105931653 13:25058134-25058156 TGGGCTGGGGATCCCAGCCAGGG + Intergenic
1112297860 13:98204113-98204135 TGGGCTAGGGGTGATTGCCAGGG - Intronic
1113109180 13:106803315-106803337 TGGGGTGGGGGTCAAAGCCAGGG + Intergenic
1114506377 14:23217586-23217608 TGGGGTGGGGGAGAAAGTAAGGG + Intronic
1115907064 14:38211559-38211581 TTGGGTGAGGGAGAAAGCCAAGG - Exonic
1116954640 14:50911462-50911484 TGTGCTGGGGGAGGCAGCCCTGG - Intronic
1118452848 14:65919559-65919581 TGGGCTGGTGGAGACAGAGATGG - Intergenic
1118699932 14:68423119-68423141 TGGGCAGTGGGATACAACCATGG - Intronic
1118814439 14:69300003-69300025 TGGGCTGGGGAAGAGAGGCCTGG - Intronic
1118906867 14:70029679-70029701 TTGCCTGGGGGAAACTGCCAAGG - Intronic
1118983169 14:70732375-70732397 TGGGATCAGGGAGGCAGCCAGGG - Intronic
1119863888 14:77957061-77957083 TGGGAGGAGGGAGACAGTCAGGG - Intergenic
1121339093 14:93094388-93094410 TGGTCTGGGGGAGACATCCTAGG - Intronic
1121355684 14:93212385-93212407 GGGACTGGGGGAGGCAGTCAGGG - Intronic
1121609813 14:95270063-95270085 TGGCCAGGGTCAGACAGCCAGGG + Intronic
1121694753 14:95903814-95903836 TGGGCTGGCCGGCACAGCCAGGG + Intergenic
1121713125 14:96053760-96053782 TGGGCTGCTGGAGACTGACAGGG - Intronic
1122090272 14:99333979-99334001 AGGTCTGGGGGAGACTGCCCTGG + Intergenic
1122542223 14:102504975-102504997 TGGGCTGGGGGGGTCATGCAGGG - Exonic
1122784253 14:104156604-104156626 TGGGCAGGGTGAGCCGGCCATGG + Intronic
1122918011 14:104867688-104867710 GGGGCTGGTGTAGACAGGCAGGG - Intronic
1123041967 14:105493969-105493991 TGGGCTGGGGGGCACAGCAGGGG + Intronic
1124092794 15:26622195-26622217 TGGGAGGTGGGAGACAGACAGGG + Intronic
1124648630 15:31458294-31458316 TGAGTTGGGGGAGACCCCCAGGG - Intergenic
1124986618 15:34623068-34623090 TGGACTGGTGGAGATAGCCATGG + Intergenic
1127267714 15:57375080-57375102 TAGGTTGGGGAAGACAGCCAAGG - Intergenic
1127933002 15:63609770-63609792 TGAGCTGTGCGAGGCAGCCATGG - Intronic
1129205727 15:74036001-74036023 TGGGCTGGAGGAGGCAGCTCAGG - Intronic
1129236891 15:74229069-74229091 GGGGGTGGGGGTGACAGCCTTGG - Intergenic
1129361828 15:75029245-75029267 TGGGCTGGGGCAGACAGGGAAGG - Intronic
1129595317 15:76959396-76959418 TGGGCTTGGTGAGACACCCTGGG + Intergenic
1129680681 15:77656870-77656892 TGGGGTGGGGCTGGCAGCCAGGG - Intronic
1129854121 15:78811790-78811812 TGGCCTGGGGAACACAGCGAAGG - Intronic
1129858650 15:78843197-78843219 AGGTATGGGGGAGTCAGCCAGGG + Intronic
1130178878 15:81605526-81605548 TTGGCCTGGGGAGACAGCCCTGG - Intergenic
1131120671 15:89821587-89821609 TGGGCTGGGGGAGGGAGACAGGG + Intergenic
1131291429 15:91110466-91110488 TGGGCTCTGGGAGCCAGGCAGGG - Intronic
1131344578 15:91634115-91634137 TGGGGTGTGGGAGACATGCAGGG + Intergenic
1131435695 15:92419662-92419684 TGGGATGGGGGAACCAGCAAAGG + Intronic
1132372324 15:101307530-101307552 TGGGAGGGCAGAGACAGCCATGG + Intronic
1132423570 15:101694883-101694905 GAGGCTGGGGGAGGCAGGCATGG + Intronic
1132725304 16:1335848-1335870 TGGGCTGGGGACGGCAGTCAAGG - Intronic
1132764782 16:1528865-1528887 GGGGCTCGGGAGGACAGCCAGGG + Intronic
1132879022 16:2153095-2153117 TGGCCTGGCGGGGACAGCCTAGG - Intronic
1132981942 16:2742725-2742747 TGGGCTGGTGGAAGGAGCCAGGG + Intergenic
1133311284 16:4848054-4848076 TGGGCTCGGGGACCCGGCCATGG + Intronic
1134057915 16:11181734-11181756 TGGGTTGTGGGAGGCTGCCAAGG - Exonic
1135159462 16:20080854-20080876 TGGGTTGGGGGACAGAGCAAGGG - Intergenic
1135425083 16:22328421-22328443 TGGGCTGGGGCAGACAGGGAGGG + Intronic
1135548049 16:23378786-23378808 GGGGCTGGGGAAGACAGGGAAGG + Intronic
1135651154 16:24207953-24207975 GGGGGTGGGGGACACAGGCAGGG + Intronic
1135673375 16:24393575-24393597 GGGGCTGGGGGAGAAGCCCATGG - Intergenic
1136042035 16:27587048-27587070 GAGGCTGGGGCAGACAGCCTGGG + Intronic
1136068984 16:27776849-27776871 TGGGCTGGGGGTGCCAGGCGTGG - Intronic
1136172024 16:28495395-28495417 TGGGGCTGGGGAGACAGCCAAGG + Exonic
1137375992 16:47952329-47952351 TGGGCTGGGGAAGTCAGTGAGGG - Intergenic
1137580630 16:49631575-49631597 TGTGTTGGGGGAGGCAGCCCTGG - Intronic
1138185879 16:54977264-54977286 TGCTCTGGGGGACACAGACATGG - Intergenic
1138375779 16:56563115-56563137 TGGGCTGGGGGTGCAAGCCCGGG + Intergenic
1138606580 16:58093898-58093920 GGGGCTGGAGGAGACACCAATGG - Intergenic
1141680046 16:85538584-85538606 TGCCCTGGGGGAGCCAGCCTTGG + Intergenic
1141832980 16:86520001-86520023 AGGGCAAGGGGAGGCAGCCAGGG + Intergenic
1142203384 16:88771616-88771638 TGGGCTGAGGGGGACCCCCATGG - Intronic
1142709984 17:1717746-1717768 GGGGTTGGGGGAGACAGTCTTGG - Intronic
1142993602 17:3748001-3748023 TGCGCTGGGGGTGAAGGCCATGG + Exonic
1143026445 17:3944480-3944502 TGGTCTGTGGGGGACTGCCATGG - Intronic
1143186528 17:5013611-5013633 TGGTCAGGGGGAGCCAGCCAGGG - Intronic
1143455612 17:7065661-7065683 TGGGCAGTGGGGGACAGCAAAGG + Intergenic
1144504928 17:15821762-15821784 TGGGCTGGGGAAGTCAGGGATGG + Intergenic
1144539260 17:16123247-16123269 TGGGAAGAGGGAGACAGCAAAGG - Intronic
1144744365 17:17603885-17603907 TGGGTTGGGGGTGAGGGCCAAGG - Intergenic
1145169101 17:20639645-20639667 TGGGCTGGGGAAGTCAGGGATGG + Intergenic
1145203668 17:20969078-20969100 TGGGCTGGGGCAGTCAGGGATGG + Intergenic
1146627235 17:34443986-34444008 GGGGCTGGGGCAGAGAGGCAGGG - Intergenic
1147144539 17:38477542-38477564 GGGGTTGGGGGAGACAGGAATGG - Intronic
1147251312 17:39154144-39154166 TGGGCTGGGGAAGACAGGTCGGG - Intronic
1147335159 17:39723300-39723322 AGGGCTGGGGGCGGAAGCCAGGG - Exonic
1147953776 17:44121417-44121439 GGGGAAGGGGGAGACAGCAAGGG - Intronic
1148135801 17:45290832-45290854 TGGGTTGGGGGAGAAAGGCAGGG + Intronic
1148440257 17:47708525-47708547 AGGGCAGGGGGAGGCAGCCGCGG + Intronic
1148462340 17:47845973-47845995 TGGGGTGGGGGAGAGAGGAAAGG - Exonic
1148561659 17:48610079-48610101 GGGGCAGGGGGACACACCCAGGG + Intronic
1148646811 17:49224033-49224055 TGGAGTGGGGGAGGCAGCCGAGG + Exonic
1148914134 17:50960338-50960360 TAGGCTGGGAGAGAGAGGCATGG - Intergenic
1149063265 17:52449552-52449574 AGGGCTGGGGGAGACAAGCAAGG - Intergenic
1149599207 17:57882304-57882326 GGGGGTTGGGGAGACTGCCAAGG + Intronic
1149658692 17:58323591-58323613 TGGGCTGGGGCAGGCTGCCCTGG - Intronic
1150614100 17:66755604-66755626 AAGGCTGGGTGAGACAGCCCTGG - Intronic
1151323503 17:73365392-73365414 GGGGCTGCGGGAGACAGCAAAGG + Exonic
1151478140 17:74355200-74355222 TGGGTTGGGGGGAACAGCCAGGG - Exonic
1151646923 17:75439012-75439034 TGGGCTGGGGGAGGCAGTGACGG + Intergenic
1152120195 17:78413777-78413799 TGGGCTGCGGGAGTCGGCCCTGG + Intronic
1152292028 17:79445484-79445506 TGGGCTGGGGTAGACAGTCCTGG - Intronic
1152579491 17:81159832-81159854 TGGCCTGGGGGAGCCAGGCTGGG - Intronic
1152727083 17:81952780-81952802 TGGGCTGTGGGAGAGGGGCAGGG + Exonic
1152930633 17:83107846-83107868 GGGGCGGGGGGAGACGGGCACGG + Intergenic
1152947038 17:83203567-83203589 TGTGCCGGGGGAGGGAGCCAAGG + Intergenic
1155054308 18:22171079-22171101 TGGGGTGGGGGAGACGGGTATGG - Intronic
1157464858 18:47934334-47934356 TGGGCTGGGGAAGCCAGAAAGGG - Intergenic
1157586780 18:48806092-48806114 TGTGGTGGAGGGGACAGCCAGGG + Intronic
1157604075 18:48914787-48914809 TGGGCTGGGGGTGAGAGGCTGGG - Intergenic
1157714709 18:49875800-49875822 TGGCCTGGAGAAGGCAGCCATGG - Exonic
1158105947 18:53885228-53885250 TGGGGTGGGGGAGAAAGACGGGG + Intergenic
1158105959 18:53885266-53885288 TGGGGTGGGGGAGAAAGAGATGG + Intergenic
1159543746 18:69814101-69814123 AGGGATGGGAGAGACACCCAGGG + Intronic
1160214649 18:76917911-76917933 TGGGTTGAGGGAGAAAGTCATGG - Intronic
1160778155 19:866196-866218 TGGGGTGGGCGAGGCAGGCAGGG - Intergenic
1160822531 19:1065191-1065213 CGGGCTGGGGGAGGCAGGCTGGG + Intronic
1161273798 19:3404521-3404543 GGGGCTGGGGGAGGCGGCCCAGG + Intronic
1161301292 19:3544295-3544317 GAGCCTGGAGGAGACAGCCACGG - Exonic
1161741059 19:6021511-6021533 TGGGGTGGGGGTGTCAGGCAGGG + Intronic
1162175169 19:8824865-8824887 TGGGATGGGGGATACAGACGGGG - Intronic
1162299892 19:9838518-9838540 CGGGCAGGGGGAGCCTGCCAGGG + Exonic
1163137624 19:15324133-15324155 TGGGCTGTGGCAGACAGCATTGG - Intronic
1163573802 19:18098964-18098986 TGGGGTAGAGGAGGCAGCCAAGG + Intronic
1163785904 19:19274824-19274846 TGGGGTGGGGGTGGCAGGCAGGG - Intergenic
1163819516 19:19487973-19487995 CTGGCTTGGGGAGACAGGCAGGG - Intronic
1163821256 19:19497819-19497841 GGGGCTGGTGGAGACAGTCAAGG + Intronic
1164529951 19:29041052-29041074 CGGGCAGGTGGAGACAGGCAGGG + Intergenic
1165115430 19:33525380-33525402 TGGGCTGGGGGAGAAAGGAGAGG - Intergenic
1165188249 19:34040221-34040243 TGGGCTGTCAGAGATAGCCAGGG - Intergenic
1165701530 19:37942202-37942224 TAGGTTGGGGGACACAGTCAAGG + Intronic
1165746233 19:38231252-38231274 TGAGCAGGGGGAGACAGCCTGGG + Intergenic
1166054289 19:40279354-40279376 CCAGCTGGGGGAGACAGCCTGGG - Intronic
1166108785 19:40610486-40610508 GGGACTGGGGCAGACAGCCCCGG - Intronic
1166218336 19:41350870-41350892 TTGGCTGGGGAAGACAGATAGGG + Intronic
1166950959 19:46427885-46427907 TGGGCTGGGGGAGAAACCGGAGG - Intergenic
1167038567 19:47008682-47008704 TTGGCTGGGGGAGTCAGGGAGGG - Intergenic
1167245600 19:48371306-48371328 TGGGGTGGGGGAGAGAGTCAAGG - Intronic
1167587430 19:50382903-50382925 CGGGCTAGGGGGGAGAGCCATGG - Exonic
1168072492 19:53960728-53960750 TGGGGTGGGGGAGACAGGCAGGG + Intergenic
1168340734 19:55621774-55621796 GGGGCGGGGGGAGACCGCGAAGG - Exonic
925051538 2:819398-819420 TGAGATGAGGGACACAGCCAGGG + Intergenic
925905098 2:8535432-8535454 AGGCCTGGGGGAGAAAGCCCAGG + Intergenic
926046784 2:9715866-9715888 GGAGATGAGGGAGACAGCCATGG + Intergenic
926353644 2:12020161-12020183 TGGCATGGAGGTGACAGCCAAGG + Intergenic
926798940 2:16641802-16641824 TGGGCTGGGGGTGAGAGCAGAGG + Intronic
928429564 2:31206223-31206245 TGGGATGGGAGAGACATCCTTGG - Intronic
930216408 2:48701696-48701718 TAGGATGGGGAAGACAGACAAGG - Intronic
930253387 2:49061001-49061023 TGGGCAGGGGGAGAAAGGTATGG - Intronic
931224835 2:60320742-60320764 GGTGCTGGGGGAGCCAGCAAGGG - Intergenic
931451410 2:62370290-62370312 TGAGCCTGGGGAGACAGACAGGG + Intergenic
932572213 2:72944059-72944081 TGGGATGGGGCAGGCAGCCTTGG + Exonic
932669988 2:73728781-73728803 TGGGCAAGGGGAGGCAACCAGGG - Intergenic
932740148 2:74284971-74284993 CAGGCTGGGGTAGACAGCGAGGG - Intronic
933724326 2:85418181-85418203 TGGGCTGGGAGACCCAGCCCAGG - Intronic
934109524 2:88729161-88729183 TGGGCTTTGGGAGAGAGCCTGGG + Intronic
934331751 2:92074838-92074860 GAGGCTGGGGGAAAAAGCCACGG - Intergenic
934770894 2:96907146-96907168 TGGGCAGGCGGGGACAGCAAGGG - Intronic
935561859 2:104567950-104567972 TGGGCTGGGGGCCCCATCCACGG + Intergenic
936507380 2:113118177-113118199 TGGGCACGGGGAGGCATCCATGG + Intronic
937107527 2:119331699-119331721 TGGGATTGGGGAAACAGACATGG - Intronic
937246787 2:120498956-120498978 TGGGCTGGGGGAGCCTGGCAGGG - Intergenic
937313370 2:120915744-120915766 AGGGCTGGGAGAGGCTGCCAGGG - Intronic
937324712 2:120983582-120983604 TCTGCTGGGGCTGACAGCCACGG - Intronic
938461641 2:131501457-131501479 TGGGCTGGAGGAGAGTGGCAGGG - Intergenic
938812138 2:134863376-134863398 TGGCCTGGTGGAGACAGGAAAGG - Exonic
938900958 2:135798146-135798168 TAGGGTGGGGGAGACAGCCCAGG + Intronic
940219697 2:151338892-151338914 AGGGGTGGGTGAGACAGTCAGGG + Intergenic
940527337 2:154833438-154833460 TGGGCTGGGGGGAACATGCATGG - Intronic
941876142 2:170435305-170435327 AGGGCTGGTGGAAACAGCAAGGG + Intronic
942454112 2:176125736-176125758 GGGGCTGGGAGGGAAAGCCAAGG + Intergenic
942465479 2:176203392-176203414 TGCCCTGGAGGAGACAGACATGG - Intergenic
946418112 2:219550751-219550773 TGGGCAGGGGTAGAGAGACAAGG - Exonic
947396896 2:229695485-229695507 TGCTCTGGTGGAGACAGCCCTGG + Intronic
948125660 2:235563215-235563237 AGGGCAGGGGGGCACAGCCAAGG - Intronic
1168765896 20:381428-381450 TGGGCTGGGGAAGCCAGGGACGG + Intronic
1168876904 20:1178014-1178036 TGGACTGGCGGTGACAGCCGAGG + Intronic
1169068381 20:2707183-2707205 TGGGCTGGGGGAGGCAGGCCAGG + Intronic
1169200354 20:3706265-3706287 AGGGCTGGGGCTGAGAGCCAAGG + Intronic
1170594375 20:17794134-17794156 TGGAGTGGGGGTGACAGCAAAGG + Intergenic
1170866079 20:20159543-20159565 TGAACTGGTGGAGACAGGCAGGG - Intronic
1170899756 20:20450605-20450627 TGGCCTGGGGCCCACAGCCAGGG - Intronic
1171210673 20:23314576-23314598 TGGGCTGGGCTGGACAGCCCAGG + Intergenic
1171329211 20:24322829-24322851 TGGGGTGGAGGAGAGAGACATGG + Intergenic
1171418309 20:24998774-24998796 TGGCCTGGTGGAGAAAGGCAGGG - Intergenic
1172386290 20:34536356-34536378 TGGGTTGGGGGAAAAAGCCTTGG + Intronic
1172641247 20:36441664-36441686 TGGGATGGGAGAGACAGGGAGGG - Intronic
1172837194 20:37880783-37880805 TGGGCTGGGGGAGGTAGCCATGG - Intergenic
1172964671 20:38826038-38826060 TGTGCTGGGAGAGAAAGGCAGGG + Intronic
1173500694 20:43550638-43550660 GGGGCTGGGCGAGGCTGCCAGGG - Intronic
1173750391 20:45470921-45470943 AGGGCTGGGGGAGGCCCCCAGGG - Intronic
1174140358 20:48408797-48408819 TGGGAAGGAGGAGACAGGCAGGG - Intergenic
1174303013 20:49595752-49595774 TGAGCTGGGGGAGACGACCCTGG - Intergenic
1174555796 20:51394523-51394545 TGGGCTGGGGGTGGCCACCAAGG - Intronic
1174625732 20:51912899-51912921 GTGGCTGGAGGAGCCAGCCAGGG - Intergenic
1175268412 20:57716607-57716629 TGGTCTGGGTGTGACAGCAAAGG + Intergenic
1175293392 20:57893126-57893148 AGGGCTGGGGGTGTCAGGCAGGG - Intergenic
1175480194 20:59305212-59305234 GGGACTGTGGGGGACAGCCAAGG - Intronic
1175516925 20:59575928-59575950 AGGCCTGGGGAAGACAGGCAGGG + Intergenic
1175933228 20:62503213-62503235 GGGGCTGGGGGAGGCAGCCAGGG - Intergenic
1176024925 20:62981040-62981062 CGGGGTGGGGGTGACAGGCACGG + Intergenic
1176025331 20:62982654-62982676 TGGGCTGTGGGGGCCAGGCAGGG - Intergenic
1176028539 20:62998908-62998930 TGGGCTGGGGGAGGTGACCAGGG + Intergenic
1176103286 20:63374217-63374239 TGGGCTGAGGGACACTGCCGGGG + Intronic
1176242629 20:64082207-64082229 TGAGCAGGGGCAGACAGACAGGG - Intronic
1178843595 21:36156867-36156889 CGGGCTGGGGGAGAGAGACTGGG - Intronic
1179711767 21:43267636-43267658 TGGGCTGGGGGTGGCAGCACTGG + Intergenic
1179875205 21:44263440-44263462 TGGGTGGGGGGAGAAAGCCCCGG - Intergenic
1179961027 21:44767077-44767099 TGGGCTGGGGGGGGCACCCTGGG - Intergenic
1180600257 22:17010741-17010763 TGGGCTGTGGGAGCCAGACGAGG - Intergenic
1180840663 22:18957459-18957481 GGGGCTGGGGGAAGCAGCCATGG + Intergenic
1181060825 22:20281315-20281337 GGGGCTGGGGGAAGCAGCCATGG - Intronic
1181174022 22:21025928-21025950 TGGGATGGGGCAGGCAGACAGGG + Intronic
1181272926 22:21670922-21670944 TGGGCTGGCTGAGACTGGCATGG - Intronic
1181523404 22:23462399-23462421 TGGGCTGGGGGATTCATCCACGG - Intergenic
1181584123 22:23843689-23843711 TGGGAAGGGGGAGAGAGCCAGGG + Intergenic
1182557725 22:31138104-31138126 TGGGTTGTGGGGGACACCCAAGG + Intronic
1182766916 22:32764364-32764386 GGGGTTGGGGGTGACATCCATGG - Intronic
1182896724 22:33865012-33865034 TGGGCTGGGCCTGACACCCACGG - Intronic
1183343362 22:37294178-37294200 TGGGCTGGGGGAGGTGGGCAGGG + Intronic
1183693767 22:39407132-39407154 TTGGCTGGGGGAGACAGACATGG + Intronic
1183696719 22:39427879-39427901 TGGGCTTGGGGAGCCAGGCATGG + Intronic
1183977711 22:41523004-41523026 TGGGGTGGGGGAGATGGGCAGGG - Intronic
1184332531 22:43835200-43835222 TGGGGTGGGGCACACAGGCAGGG + Intronic
1184384783 22:44167737-44167759 TGGGCTTGGGGACACACCCGGGG - Intronic
1184718606 22:46296295-46296317 TGCGTTGGAGGAGAGAGCCAGGG - Intergenic
1185221068 22:49629549-49629571 TGGGCTGGAGCAGACAGGCTGGG + Intronic
1185286295 22:50001299-50001321 TGGGAAGGGGGAGAGAGCCCTGG + Intronic
1185295178 22:50049609-50049631 TGGAATGGTGGAGACAGCCCGGG + Intronic
1185331555 22:50254282-50254304 GGGGCTGGGGGAGACAGGCGAGG + Intronic
1185388634 22:50547691-50547713 TGAGCTGGGGGATGAAGCCAGGG - Intergenic
949438979 3:4060006-4060028 TGAGATGGGAGAGACAGGCATGG + Intronic
949718937 3:6966091-6966113 TGGGCTGGGAGAGAGCCCCAAGG - Intronic
949855229 3:8455341-8455363 TGGCCTTGGAGAGGCAGCCAGGG - Intergenic
949996084 3:9618656-9618678 TGGGAAGGGGGAGTCAGCTATGG + Intergenic
950342540 3:12260187-12260209 TGGGCTGGGGGAGGCAAGGAGGG + Intergenic
951791109 3:26485553-26485575 TGGGCTGGGGGAGCAAGAAAAGG - Intergenic
952628031 3:35430238-35430260 TGAGATTGGGGAGACAGCAAGGG - Intergenic
952920008 3:38277596-38277618 TCGGCAGGAGGTGACAGCCATGG - Exonic
953344172 3:42161216-42161238 TGGGCTGTGGGTGAAAGCCCTGG - Intronic
953417429 3:42730974-42730996 AGGGCTGGGAGAGACTGGCAGGG - Intronic
953661424 3:44894175-44894197 TGGGGGGTGGGAGAGAGCCATGG - Intronic
953661432 3:44894195-44894217 TGGGGGGTGGGAGAGAGCCATGG - Intronic
953661440 3:44894215-44894237 TGGGGGGTGGGAGAGAGCCATGG - Intronic
953884464 3:46707579-46707601 GGGGCTGGAGGAGACCTCCAGGG - Intronic
953970861 3:47345773-47345795 TGGGGTGGGGGAGACACCCCAGG - Exonic
954447725 3:50555562-50555584 TGGGTTGGGGGAGAGGGGCAGGG + Intergenic
954849227 3:53586179-53586201 GGGGCTGGGGGACAAACCCATGG + Intronic
954937392 3:54339136-54339158 GGGGCTGGGAGAGACAGGCGTGG - Intronic
955116392 3:56008996-56009018 TGGGCTGGGTGTGTCAGTCAGGG - Intronic
956594094 3:70947772-70947794 GGGGCTGGGAGAGACAGGCCTGG - Intergenic
959911164 3:111765162-111765184 TGTGCTGGTGGAGTGAGCCAAGG - Intronic
960906342 3:122605347-122605369 AGGGCTGGGGAATACAGACAGGG + Intronic
960938906 3:122921000-122921022 TGGTCTTGGTGAGGCAGCCAAGG - Intronic
961311629 3:126005682-126005704 TGGCCTGGCAGAGAAAGCCAGGG - Intergenic
961401980 3:126654066-126654088 AGGGAGGGAGGAGACAGCCAAGG + Intronic
961420613 3:126800272-126800294 TGGGCTTGGGGACAGAGCAAAGG - Intronic
961542201 3:127607607-127607629 AGGCCTGAGGGAGACAGACAGGG - Intronic
961555146 3:127692151-127692173 TGGTCTGGGGGATGCAGGCAGGG - Exonic
962312721 3:134337520-134337542 AGGTCTGGGAGAGACAGACAGGG - Intergenic
962391377 3:134975519-134975541 GGGGCTAGGGGAGACAGTCCTGG - Intronic
962990489 3:140573181-140573203 TATGCTGGTGGAGACACCCAGGG + Exonic
964351842 3:155810685-155810707 TGAGCTTGGAGAGACAGGCAGGG - Intergenic
965792652 3:172406243-172406265 AGGCCTGGGGGAGACAGCAAGGG + Intergenic
966923321 3:184628694-184628716 TGGGCTGGTGGAAACACCCTCGG - Intronic
968663880 4:1810342-1810364 GGGACAGGGGGAGGCAGCCAGGG - Intergenic
968869691 4:3235408-3235430 TGTGCAGAGGAAGACAGCCAGGG - Intronic
969091416 4:4696628-4696650 TGTGCTGTGGGAGGCAGGCACGG + Intergenic
969232153 4:5839480-5839502 GGGGCTGGGGGAGGCAGCTGGGG - Intronic
969481041 4:7447016-7447038 TGTGCTGGGAGAGCCAGCCCCGG - Intronic
969586305 4:8096082-8096104 GGGGTTGGGGGAGAGACCCAAGG - Intronic
971470571 4:27021507-27021529 TGTGCAGTTGGAGACAGCCAGGG + Intronic
973701084 4:53537950-53537972 AAGGCTGGGGGAGAGAGCCTTGG + Intronic
973728274 4:53797667-53797689 TGAGCAGGGGGAGACAGCATAGG - Intronic
975161819 4:71133448-71133470 TCAGCTGCGGGAGTCAGCCAAGG + Intergenic
975969118 4:80012642-80012664 GGGGGTGGGGGAGACAGACGTGG + Intronic
976104354 4:81600993-81601015 GGGGCTAGAGGGGACAGCCATGG + Intronic
977568795 4:98609358-98609380 CTGGCTGGGGGAGAGGGCCAGGG + Intronic
977644189 4:99393415-99393437 TGGGATGGGGAAGACAGGGAGGG + Intergenic
978457828 4:108914512-108914534 TAGGGTCAGGGAGACAGCCAGGG + Intronic
980880705 4:138707475-138707497 TGGGCTGGGGGACAGAGCTGGGG - Intergenic
981603408 4:146517626-146517648 TGTGCTGAGCAAGACAGCCACGG - Intronic
982726958 4:158916486-158916508 GGGTCTGCTGGAGACAGCCATGG - Intronic
982849391 4:160293520-160293542 TGTGTTGTGGGAGACACCCAGGG - Intergenic
984778728 4:183505445-183505467 TGCGCTCGGGGAGACTGTCACGG - Intronic
984962548 4:185111684-185111706 TGGGCTCGGTGAGACAAGCACGG + Intergenic
985853138 5:2403478-2403500 TGGGCTGTAGGGGGCAGCCAGGG + Intergenic
986128755 5:4908004-4908026 TGGAATGGGGAAGAAAGCCAGGG + Intergenic
986479008 5:8165938-8165960 TGGGCTGGAGAACAAAGCCAGGG - Intergenic
986709890 5:10480932-10480954 TGAGCAGGGGGAGACAGGAAGGG + Intergenic
986841311 5:11700522-11700544 CGTGCTGGGGGAGTAAGCCATGG + Intronic
988872542 5:35406715-35406737 TGGGGTGGGGGAGAGAGAGAGGG - Intergenic
988906761 5:35798439-35798461 TTAGCTGGGGAAGACATCCAGGG - Intronic
990602097 5:57369334-57369356 TGGGCAGAAGGAGAAAGCCAAGG - Intergenic
990609759 5:57445315-57445337 TGGGCAGAGACAGACAGCCATGG + Intergenic
990875208 5:60476605-60476627 TGAGGTGGGGGAGACAACAAGGG - Intronic
991095915 5:62739595-62739617 TGGGCTGGGAGAGGAAGTCACGG - Intergenic
992089910 5:73307493-73307515 TGGGCTGGGGGTGACAGGAAGGG + Intergenic
992778753 5:80109843-80109865 GGGGCTGGGGGAGGGAGCCTGGG - Intergenic
997347071 5:133199685-133199707 TGGCCTGGGGCACGCAGCCATGG + Exonic
997385379 5:133468170-133468192 AAGGCTGGGGGAGGCAGGCAGGG + Intronic
997894671 5:137705410-137705432 TGTGCTGGGGGTGAGAGACAAGG - Intronic
998132821 5:139659822-139659844 TGGGCAGTGGGAGAAAGCAAGGG - Intronic
998520507 5:142795950-142795972 TGGGATGGGGGAGGCTGTCAGGG - Intronic
998796860 5:145829641-145829663 TGGGGTGGGGAAGACAGGGATGG - Intronic
999099640 5:149012661-149012683 TGACCTGGGGGAGACAGACAAGG - Exonic
999109560 5:149106749-149106771 TGGCCTGGGGGAGAAAAACAAGG - Intergenic
999204239 5:149836759-149836781 TGGGCTGCTGGAGACCGCCCTGG + Exonic
999256888 5:150214553-150214575 TGTCCTGGGGGAGAAGGCCAAGG - Intronic
999696109 5:154190223-154190245 TGGGCTGGAAGTGACAGCCCCGG + Intronic
1001229664 5:169975274-169975296 TGGGCTGGTGTAGAAAGACATGG + Intronic
1001314743 5:170633896-170633918 TGTGCTGGGGTAGACTGTCAGGG + Intronic
1001422187 5:171596415-171596437 AGGGATGGGGGAGGCATCCAGGG + Intergenic
1002064187 5:176643908-176643930 TGGGCTCAGGGAGAGAGCCTGGG + Intronic
1002066838 5:176656143-176656165 CGGGCTGGGGCAGGCAGGCAGGG + Intronic
1002419434 5:179137941-179137963 CGGGCTGGAGGAGAAAGCAAAGG + Exonic
1002643427 5:180641276-180641298 TGGGCCTGGGGACAGAGCCATGG - Intronic
1002782879 6:380390-380412 TGGGCTGGGGGCGGGACCCAGGG - Intergenic
1002930374 6:1630375-1630397 TGGGCAGGCGGACACAGCCAGGG - Intronic
1002940746 6:1713448-1713470 TGGGCAGTGGGAGGGAGCCACGG - Intronic
1003053959 6:2802789-2802811 TGGGCTGGGGCAGACAGACTTGG - Intergenic
1003116089 6:3284740-3284762 TGGGTGGGGGGAGAAAGCCTGGG - Intronic
1003308680 6:4950196-4950218 TTGACTGGGACAGACAGCCAGGG + Intronic
1004262317 6:14118609-14118631 AGGGCTAGGGGAGGAAGCCAAGG - Intronic
1006130889 6:31868922-31868944 GAGGCTGGGAGAGACAGCCCTGG - Intronic
1006397962 6:33799280-33799302 TGGGCAGATGGAGACAGGCAAGG - Intronic
1007419630 6:41711867-41711889 TGAGCTGGGTGAGCCTGCCAAGG - Intronic
1007570411 6:42886105-42886127 TCAGCTGGGGCAGAAAGCCAGGG + Intronic
1008805825 6:55426609-55426631 TTGGCTGGGGAATAAAGCCAAGG + Intergenic
1010084252 6:71897860-71897882 TGGACTGGAGGAGTCACCCAGGG + Intronic
1011648667 6:89485083-89485105 TGGGCTGGGTGAGACAGTCTGGG - Intronic
1015480415 6:133702280-133702302 TGGGTTGGGGGAGGCAGAGAGGG - Intergenic
1016899108 6:149083430-149083452 AGGGCTGGGGGAGATACACAGGG - Intergenic
1017656134 6:156631355-156631377 TAGGCTGGTGGGGACAGACAGGG + Intergenic
1017774392 6:157669502-157669524 GGAGCTGGAGGAGACAGTCAAGG - Intronic
1018983666 6:168618833-168618855 CGGTCTGGGAGAGACAGCGATGG + Intronic
1019190530 6:170248210-170248232 TGGCCTGCTGCAGACAGCCAGGG + Intergenic
1019446568 7:1074315-1074337 TGTGCTGTGGGACACAGACAAGG - Intronic
1019557734 7:1641063-1641085 TGGGCTGGGGGAGAAAGGCGAGG - Intergenic
1019625071 7:2011803-2011825 TGTGTTGATGGAGACAGCCACGG - Intronic
1020037682 7:4974510-4974532 TGGGCTGGGGTTCACAGGCACGG - Intergenic
1020083645 7:5299173-5299195 GGGGGTGGGGGAGGCAGGCAGGG + Intronic
1020162136 7:5781114-5781136 TGGGCTGGGGTTCACAGGCACGG + Intronic
1020177517 7:5894914-5894936 TAGGCTGGGGGAGAGAGTCGAGG + Intergenic
1021947016 7:25737930-25737952 TGGGGTGGAGAAGACAGGCATGG + Intergenic
1022666649 7:32416994-32417016 TCGGCTGGGAGAGCCAGGCATGG - Intergenic
1024042663 7:45567325-45567347 TGGGGTGGGGGAAACAGAAAGGG + Intergenic
1024587901 7:50857031-50857053 TGGGACGAGGCAGACAGCCAGGG + Intergenic
1025210630 7:57018011-57018033 GGGGGTGGGGGAGGCAGGCAGGG - Intergenic
1025258161 7:57399319-57399341 AGGGCTGGGGGAGGCAGCTGAGG + Intergenic
1025263864 7:57439986-57440008 TGAGCTGGGGGAGTCAGGGAGGG - Intergenic
1025610466 7:63072371-63072393 AGGGCTGGGGGAGGCAGCTGAGG - Intergenic
1025635369 7:63316123-63316145 TGAGCTGGGGGAGTCAGGGAGGG + Intergenic
1025647325 7:63432047-63432069 TGAGCTGGGGGAGTCAGGGAGGG - Intergenic
1025661326 7:63558836-63558858 GGGGGTGGGGGAGGCAGGCAGGG + Intergenic
1026850920 7:73722757-73722779 TGCAGTGGGGGAGACAGACATGG + Intergenic
1027143779 7:75679764-75679786 TGGGCTGTTGGAGACCACCAAGG - Intronic
1028540536 7:91938489-91938511 TGGGTGGGGGTAGAGAGCCACGG - Intergenic
1028570444 7:92280647-92280669 GGGGTTGGGGGATACATCCAAGG - Intronic
1029587899 7:101487053-101487075 GGTGCTGGTGGAGACAGACAGGG + Intronic
1030444092 7:109626913-109626935 TGGGCTCTGGGAAACAGACAGGG - Intergenic
1032239456 7:130149645-130149667 TGGGCTAGAGGAGGAAGCCACGG + Intergenic
1032502468 7:132410192-132410214 TGGGCTGGGGGAGGGGGGCACGG - Intronic
1032855527 7:135830455-135830477 TGGGCTGGGGGACACAGGCTGGG - Intergenic
1032913741 7:136463208-136463230 TGTGCTGTGGGAGAGACCCAGGG - Intergenic
1034211754 7:149369815-149369837 TGCAGTGGGGGAGACAGACAGGG - Intergenic
1034767066 7:153733892-153733914 TGAGCTGTGGGAGAGAGCCTGGG + Intergenic
1034982631 7:155488634-155488656 TGGGCTGAAGGATGCAGCCAGGG - Intronic
1035042088 7:155936384-155936406 TGGACTGAGGTAGCCAGCCAAGG + Intergenic
1035275418 7:157745382-157745404 TGGTCTGCGGGAGGCAGGCATGG + Intronic
1035314484 7:157989666-157989688 TGGTCTGGGGGAGGCAGCGGGGG + Intronic
1035395105 7:158529690-158529712 GGGGCTGGTGGACACAGCCCAGG - Intronic
1035520374 8:271325-271347 TGGGCGGGAGGAAACAGCCTTGG - Intergenic
1035671812 8:1423738-1423760 GCGGGTGGGGAAGACAGCCAGGG + Intergenic
1036748894 8:11430763-11430785 GGGGCTGGAGGAGACGGCCAAGG + Intronic
1039401233 8:37271152-37271174 TGTGCTGGTGGAGTCATCCAGGG - Intergenic
1039951161 8:42173827-42173849 TGGGGTGGGGGAGGCAGCGGGGG - Intergenic
1041465417 8:58153572-58153594 TGAGGTGGTGGACACAGCCAGGG + Intronic
1043435943 8:80236536-80236558 TGGGCTGGAGGGGACAGAGAAGG - Intergenic
1047436992 8:124843045-124843067 TGAGCTGGGGTGGACTGCCAGGG - Intergenic
1047775179 8:128064435-128064457 TGGGCTGGGGGAGGCAATTAGGG - Intergenic
1048955687 8:139534115-139534137 TGGCCTGGGGGGGACAGCGGTGG + Intergenic
1048967777 8:139626651-139626673 TGGGCTGGGGGAGACAGCCATGG - Intronic
1049159200 8:141086570-141086592 TGTGCAGGGGGAGTCAGCCACGG - Intergenic
1049640335 8:143712378-143712400 AGAGCTGGTGGTGACAGCCAAGG + Intronic
1049677041 8:143894638-143894660 TGGGATGGAGGAGACAGTCCAGG + Intergenic
1049865649 8:144933882-144933904 CAGGCTGTGGGTGACAGCCAGGG - Intronic
1053351634 9:37417188-37417210 TGGGCTGGGGGATGCGGTCAGGG + Intergenic
1053364450 9:37512618-37512640 TGGGCAGAAGGTGACAGCCATGG - Exonic
1053430339 9:38038144-38038166 TGGGCTGGGGCACACATGCATGG - Intronic
1054731576 9:68706269-68706291 CAGGCTGGGGGAGAAAGCCTGGG - Intronic
1056761433 9:89418269-89418291 TGTGCTGGGGAAGACAGCACTGG + Intronic
1056796076 9:89659772-89659794 TGGGATGGGGGAGGCAGGCTGGG + Intergenic
1056879920 9:90381236-90381258 TGGCCTGGGGGACTCAGCCCCGG + Intergenic
1057191745 9:93092257-93092279 TGGGCTGTGGGAGACCTTCATGG - Intergenic
1057279633 9:93700476-93700498 TGGGCAGGAGGGGACAGGCAAGG - Intergenic
1057704104 9:97385763-97385785 TGGGCTGGAGGAGCCGGCCCAGG + Intergenic
1058828237 9:108793863-108793885 TGGGATCTGGGTGACAGCCATGG - Intergenic
1059282354 9:113145736-113145758 TGCCGTGGGGGAGACAGCTAGGG - Intergenic
1059656842 9:116365243-116365265 TGGCCTGGGGGAGGCACGCAGGG - Intronic
1059932826 9:119278265-119278287 AGGGCTGTGGGAGAGAGGCAGGG - Intronic
1060214232 9:121728814-121728836 TGGGGAGGGGGGGACAGCCAGGG + Intronic
1060287443 9:122266328-122266350 TGGGCTGTAGGAGATGGCCAAGG + Intronic
1060749144 9:126157443-126157465 TGGGCTTGGAGAGGCAGCCAGGG + Intergenic
1060994442 9:127868152-127868174 TGGGCTCGGGGAGGCAGGCCTGG - Intronic
1061294922 9:129671861-129671883 TGGGCTGGAGGAGTCAGGGAAGG + Intronic
1061903121 9:133683175-133683197 TAGGCTTGGGGAGGCTGCCAGGG + Intronic
1062015317 9:134288280-134288302 TGGGGTGGGGGAGCCACCAAGGG + Intergenic
1062047897 9:134432824-134432846 TGGGCTGGTGGAGGCAGCCCAGG + Intronic
1062204621 9:135329224-135329246 AGGCCTGGGGAAGACAGCCCGGG - Intergenic
1062402788 9:136379743-136379765 GGGGCTGTGGGTGAAAGCCAGGG + Intronic
1062470296 9:136700335-136700357 TGGGCTGGGGGAGGGAGCAGTGG - Intergenic
1062686177 9:137814630-137814652 TGAGCTGGGTGTGACAGGCAGGG + Intronic
1185880551 X:3736215-3736237 GGGGCTGGGGCAGAGAGCCCTGG - Intergenic
1186286982 X:8055657-8055679 TGTACTGGGGTAGACAGCAAAGG + Intergenic
1186463425 X:9765909-9765931 TGGGGTGGGGGAGAGGCCCAGGG - Exonic
1186542995 X:10420095-10420117 TAGGCTGGGGAAGAGAGGCAGGG - Intergenic
1187090913 X:16095789-16095811 TGGGCTGGTGGTGGTAGCCATGG - Intergenic
1188770252 X:34145628-34145650 AGGGCTGGGGGAGAAGGCAACGG + Intergenic
1189419599 X:40844975-40844997 GGGGCTGGGATAGACAGTCAGGG - Intergenic
1190115078 X:47620964-47620986 GGTGCAGGGGGAGACAGCCATGG - Intergenic
1190289523 X:48983094-48983116 TGGGATGGGGCAGACTGTCATGG + Intronic
1192142740 X:68659532-68659554 GGGGCTGGAGGAGAGAGACACGG - Intronic
1195671158 X:107471194-107471216 TGGCCTGTGGGAGGCAGCCAAGG - Intergenic
1196017445 X:110954948-110954970 TGGGTGGGGGAAGACAACCAGGG + Intronic
1198275809 X:135096320-135096342 TGGGCTGGGGCTGAGACCCATGG - Intergenic
1198310710 X:135424417-135424439 TGGGCTGGGGCTGAGACCCATGG + Intergenic
1198617954 X:138479381-138479403 TGGGGTGGGGGACACAGGGAGGG - Intergenic
1198766754 X:140088032-140088054 GGAGCTGTGGGAGGCAGCCATGG + Intergenic
1199834417 X:151574379-151574401 TCCACTGGGGGAGACAGACAAGG + Intronic
1200052643 X:153443104-153443126 TGGGCTGGAGAGGACAGCGACGG - Intergenic
1200151896 X:153955269-153955291 TGGGCTGGGGGTGTCCCCCAAGG + Exonic
1200784602 Y:7249137-7249159 GGGGCTGGGGCAGAGAGCCCTGG + Intergenic
1200923168 Y:8631081-8631103 TAGGCTGGCTGAGACTGCCAAGG + Intergenic
1202115576 Y:21467092-21467114 TAGGCTGGAGAAGACAGCCGGGG - Intergenic