ID: 1048967784

View in Genome Browser
Species Human (GRCh38)
Location 8:139626668-139626690
Sequence AGCCCACAGTTCCCTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048967777_1048967784 -6 Left 1048967777 8:139626651-139626673 CCATGGCTGTCTCCCCCAGCCCA 0: 1
1: 0
2: 4
3: 64
4: 490
Right 1048967784 8:139626668-139626690 AGCCCACAGTTCCCTGGGACAGG No data
1048967776_1048967784 -5 Left 1048967776 8:139626650-139626672 CCCATGGCTGTCTCCCCCAGCCC 0: 1
1: 0
2: 5
3: 37
4: 378
Right 1048967784 8:139626668-139626690 AGCCCACAGTTCCCTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048967784 Original CRISPR AGCCCACAGTTCCCTGGGAC AGG Intronic
No off target data available for this crispr