ID: 1048970872

View in Genome Browser
Species Human (GRCh38)
Location 8:139644423-139644445
Sequence GTGGGCTGTGATCCATTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048970872_1048970879 2 Left 1048970872 8:139644423-139644445 CCCATTAATGGATCACAGCCCAC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1048970879 8:139644448-139644470 CTGAAACCATATTCCAGGGTAGG No data
1048970872_1048970884 21 Left 1048970872 8:139644423-139644445 CCCATTAATGGATCACAGCCCAC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1048970884 8:139644467-139644489 TAGGGTTTTTCAGCCAGAGGTGG No data
1048970872_1048970885 27 Left 1048970872 8:139644423-139644445 CCCATTAATGGATCACAGCCCAC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1048970885 8:139644473-139644495 TTTTCAGCCAGAGGTGGTTCAGG No data
1048970872_1048970878 -2 Left 1048970872 8:139644423-139644445 CCCATTAATGGATCACAGCCCAC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1048970878 8:139644444-139644466 ACGGCTGAAACCATATTCCAGGG No data
1048970872_1048970877 -3 Left 1048970872 8:139644423-139644445 CCCATTAATGGATCACAGCCCAC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1048970877 8:139644443-139644465 CACGGCTGAAACCATATTCCAGG No data
1048970872_1048970883 18 Left 1048970872 8:139644423-139644445 CCCATTAATGGATCACAGCCCAC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1048970883 8:139644464-139644486 GGGTAGGGTTTTTCAGCCAGAGG No data
1048970872_1048970886 28 Left 1048970872 8:139644423-139644445 CCCATTAATGGATCACAGCCCAC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1048970886 8:139644474-139644496 TTTCAGCCAGAGGTGGTTCAGGG No data
1048970872_1048970880 3 Left 1048970872 8:139644423-139644445 CCCATTAATGGATCACAGCCCAC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1048970880 8:139644449-139644471 TGAAACCATATTCCAGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048970872 Original CRISPR GTGGGCTGTGATCCATTAAT GGG (reversed) Intronic
900864388 1:5257445-5257467 GTGGGGTGTGATCCCTGGATGGG - Intergenic
907809511 1:57854719-57854741 ATGTGCTGAGCTCCATTAATGGG + Intronic
910095319 1:83515111-83515133 GTGGGCTCTAATCCAATGATTGG - Intergenic
912543681 1:110435650-110435672 GTGGATTGAGATCCATTAGTGGG + Intergenic
912614526 1:111085078-111085100 TTGGGCTGTGATCCAGTAGATGG + Intergenic
912750619 1:112284159-112284181 GTTGTGTGAGATCCATTAATAGG + Intergenic
915815850 1:158963627-158963649 TTGGGCTGTGATCCAGTAGGTGG - Intronic
917667093 1:177235684-177235706 ATGGACTGTGATCTCTTAATTGG - Intronic
919453498 1:197798575-197798597 TTGGGCTGTGATCCAGTAAGTGG + Intergenic
920453804 1:206082137-206082159 GTGAGCTGTGATACATCAACGGG + Intronic
924919449 1:248612253-248612275 TTGGGCTGTGATCCAGTAGATGG - Intergenic
1067171102 10:43906645-43906667 ATGGGCTGTGAGCCATGAACAGG + Intergenic
1067545578 10:47190182-47190204 GGGGGCTGTGACCCAAGAATGGG - Intergenic
1071197642 10:83179581-83179603 GTCAGCTGTGAGCCATTAGTAGG - Intergenic
1071955594 10:90755552-90755574 TTAGGCCTTGATCCATTAATGGG - Intronic
1074970404 10:118531696-118531718 CAGGGCTATGATCCATTTATGGG + Intergenic
1075356107 10:121778233-121778255 GTAGGCTGTGATCTTTTAGTGGG + Intronic
1077852204 11:6084535-6084557 TTGGGCTGTGATCCAGTAGATGG + Intergenic
1080899227 11:36472088-36472110 TTAGGCTGTGATCCATGAATTGG - Intergenic
1081855239 11:46299208-46299230 GTGGGTGGTGACTCATTAATGGG - Intronic
1086303759 11:85458708-85458730 TTGGGCTGTGATCCAGTAGGTGG + Intronic
1087291436 11:96324944-96324966 GTGGGCTTTCATACATTAAAAGG + Intronic
1090142358 11:124278017-124278039 TTGGGCTGTGATCCAGTAGATGG - Intergenic
1091132693 11:133159802-133159824 GTGGGCTGTGATGCTGGAATAGG - Intronic
1091775229 12:3180525-3180547 GCAGGCTGTGACCCATTATTGGG - Intronic
1093398446 12:18712710-18712732 GTGGGTTATGATCCATTAGTAGG - Intronic
1093612848 12:21183167-21183189 TTGAGCTGTGATCCAGTAAATGG - Intronic
1098641259 12:72840240-72840262 TTGGGCTGTGATCCAGTAGATGG - Intergenic
1099667650 12:85653013-85653035 TTGGGGTGTGATCCATTAGGTGG + Intergenic
1103496918 12:121370135-121370157 GTGGGCAGTGATTGCTTAATGGG - Intronic
1106155691 13:27153539-27153561 CTGTGCTATCATCCATTAATCGG + Intronic
1106323564 13:28665672-28665694 GTGAGCTGTGAGCATTTAATAGG + Intronic
1110919999 13:81071866-81071888 GTGGTCTTTGATCCAGAAATTGG + Intergenic
1111693269 13:91592224-91592246 TTGGGCTGTGATCCAGTAGATGG + Intronic
1111859120 13:93679268-93679290 GTGGCCTGTGGACCAATAATGGG + Intronic
1119591743 14:75895306-75895328 GTGAGCTGTGATTCATAATTGGG - Intronic
1120611523 14:86646886-86646908 TTGGGCTGTGATCCAGTAGATGG - Intergenic
1121100049 14:91244383-91244405 GCGGGTTGTGACCCATTCATGGG - Exonic
1125254359 15:37745520-37745542 TTGGGCTGTGATCCAGTAAGTGG - Intergenic
1126489827 15:49224991-49225013 TTGGGATGTGATCCAGTAAATGG + Intronic
1133600685 16:7337355-7337377 TTGGGCTGTGAAGCATTAGTAGG + Intronic
1139561856 16:67748153-67748175 GTGGGCTGTGATCGTTGACTGGG + Intronic
1141364879 16:83433420-83433442 GTGGGCTATCATTCATTACTGGG + Intronic
1144285182 17:13767343-13767365 CTGGGCTGTGATCCAATTAATGG + Intergenic
1146721118 17:35124177-35124199 GTGGATTGTGACCTATTAATGGG + Intronic
1153733675 18:8042824-8042846 ATGGGCTGTGATCAATTAGCTGG - Intronic
1158240536 18:55372399-55372421 GTGGAGTGTGATGCAATAATCGG + Intronic
1165667561 19:37646629-37646651 GTGAGCTGTAATCAATAAATGGG - Intronic
925618397 2:5766329-5766351 GTGGGCTGTGAGCCGTTCATGGG - Intergenic
928236784 2:29548956-29548978 GTGGTTTGTAACCCATTAATGGG + Intronic
935500229 2:103830515-103830537 TTGGGCTGTGATCCAGTAGGTGG + Intergenic
941527757 2:166628017-166628039 GTGGGGTGTGATCCAGTAGGTGG + Intergenic
943351763 2:186805257-186805279 TTGGGCTGTGATCCAGTATGTGG + Intergenic
943784074 2:191857563-191857585 GTGGGTTGTGACTCATTAGTAGG - Intergenic
944604746 2:201342534-201342556 GGGGGCTGTGCCCCATGAATTGG - Intronic
946599760 2:221346812-221346834 GTAGGCTGTGGTCCTTTATTAGG - Intergenic
1169500628 20:6157507-6157529 TTGGGCTGTGATCCAGTAGATGG + Intergenic
1169880925 20:10345603-10345625 GTGAGGTTTGATCCTTTAATGGG - Intergenic
1170911569 20:20575779-20575801 GTGGCCTGTGGTAAATTAATTGG - Intronic
1171314702 20:24179421-24179443 GTGGGCTGTGGGCAATTCATTGG - Intergenic
1174063599 20:47849266-47849288 GCAGGCTGTGATGCATTAGTGGG - Intergenic
1175496293 20:59416827-59416849 GTGGGCTCTGAGCCATTGGTTGG - Intergenic
1177008669 21:15705186-15705208 GTGGGAGGTGATTCAATAATGGG + Intergenic
1181379898 22:22493643-22493665 CTGGGCTGGGGGCCATTAATAGG - Intronic
1183230180 22:36577297-36577319 GTGGGTTGTGACTCATTACTAGG + Intronic
1183760046 22:39807717-39807739 GTGGGTTGTGACCAATTAGTGGG + Intronic
1183815237 22:40294437-40294459 GTGGGCCCTAATCCATTAACTGG - Intronic
1185025940 22:48412411-48412433 GTGGGCAGAAATCCATTTATAGG - Intergenic
1185413157 22:50696652-50696674 GTGGGCAGTGATCCCCTTATGGG + Intergenic
949462058 3:4303887-4303909 ACCGGCTGCGATCCATTAATAGG - Intronic
952467368 3:33603857-33603879 GTGAGTTATGACCCATTAATAGG + Intronic
956068222 3:65419450-65419472 GTGGGCTGTGACCTATTACTGGG - Intronic
958838479 3:99173226-99173248 TTGGGCTGTGATCCACTAGGTGG - Intergenic
959420340 3:106120540-106120562 ATGGGCTGTGATTCATTTAGTGG + Intergenic
960120166 3:113941101-113941123 GTTGGATGTGCTCCATTAAAAGG - Intronic
962903661 3:139782006-139782028 GTGAGCTGTGAGCCCTGAATAGG + Intergenic
963549425 3:146701440-146701462 TTGGGCTGTGATCCAGTAGATGG - Intergenic
963754981 3:149225539-149225561 TAGGGCCGTGACCCATTAATGGG - Intergenic
964425167 3:156545180-156545202 GTAGGTTGTGACCCATTAGTGGG + Intronic
964518774 3:157541821-157541843 GTGGGAGGTGATTTATTAATTGG + Intergenic
967621892 3:191643245-191643267 TTGGGCTGTGATCCAGTAGACGG - Intergenic
972994976 4:44869369-44869391 TTGGGCTGTGATCCAGTAGATGG + Intergenic
975261672 4:72309495-72309517 GTGGGCTGTGATAAAGAAATTGG - Exonic
975389897 4:73803430-73803452 TTGGGCTGTGATCCAGTAGATGG - Intergenic
978860831 4:113446991-113447013 GTGGCCTGTGATCCAGTTCTGGG + Intergenic
983628524 4:169826874-169826896 TTGGGCTGTGATCCAGTAAATGG - Intergenic
983724889 4:170908821-170908843 GTGGGCTGTGTTCCATTGTTTGG - Intergenic
984564673 4:181313830-181313852 GTGGGTTGTGACCCAGTAGTGGG + Intergenic
984958254 4:185067876-185067898 GTGGGATGGAATCCATTAGTAGG - Intergenic
985103010 4:186476506-186476528 GAGAGCTGTGATCGATGAATGGG - Intronic
985103044 4:186476814-186476836 GAGAGCTGTGATCGATGAATGGG - Intronic
985103068 4:186476982-186477004 GAGAGCTGTGATCGATGAATGGG - Intronic
985103096 4:186477206-186477228 GAGAGCTGTGATCAATGAATGGG - Intronic
985103104 4:186477262-186477284 GAGAGCTGTGATCAATGAATGGG - Intronic
985103123 4:186477402-186477424 GAGAGCTGTGATCAATGAATGGG - Intronic
985103134 4:186477486-186477508 GAGAGCTGTGATCAATGAATGGG - Intronic
985103142 4:186477542-186477564 GAGAGCTGTGATCGATGAATGGG - Intronic
985103159 4:186477682-186477704 GAGAGCTGTGATCAATGAATGGG - Intronic
985103164 4:186477710-186477732 GAGAGCTGTGATCGATGAATGGG - Intronic
985103172 4:186477766-186477788 GAGAGCTGTGATCGATGAATGGG - Intronic
985103189 4:186477906-186477928 GAGAGCTGTGATCAATGAATGGG - Intronic
985103194 4:186477962-186477984 GAGAGCTGTGATCAATGAATGGG - Intronic
985103204 4:186478018-186478040 GAGAGCTGTGATCGATGAATGGG - Intronic
985103215 4:186478102-186478124 GAGAGCTGTGATCAATGAATGGG - Intronic
985103223 4:186478158-186478180 GAGAGCTGTGATCAATGAATGGG - Intronic
985103234 4:186478242-186478264 GAGAGCTGTGATCAATGAATGGG - Intronic
985103242 4:186478298-186478320 GAGAGCTGTGATCGATGAATGGG - Intronic
985103253 4:186478382-186478404 GAGAGCTGTGATCGATGAATGGG - Intronic
985103284 4:186478662-186478684 GAGAGCTGTGATCAATGAATGGG - Intronic
985103292 4:186478718-186478740 GAGAGCTGTGATCAATGAATGGG - Intronic
991157921 5:63459826-63459848 TTGGGCTGTGATCCAGTAGGTGG - Intergenic
993351169 5:86852716-86852738 TTGGGGTGTGATCCAGTAAGTGG + Intergenic
994953243 5:106493471-106493493 GTGAGCTGTGATCCTGTCATTGG + Intergenic
998249272 5:140539857-140539879 GTGGGGTGTGATCCTTTCAGTGG + Intronic
998584060 5:143407177-143407199 GTGGGCTGTGTTCCAGGAGTGGG - Intronic
998714749 5:144870159-144870181 CTGGGCTGAGATCTATTCATTGG - Intergenic
998929569 5:147165948-147165970 GTTGGCCATGATCCACTAATGGG - Intergenic
999678735 5:154034730-154034752 GTGGTCTGTGATACCTGAATAGG + Exonic
999990450 5:157045332-157045354 ATGGGCTGTGTACTATTAATAGG - Intronic
1007433053 6:41787426-41787448 GCGTGCTGTGATCATTTAATTGG - Intronic
1009325169 6:62339647-62339669 TTGGGCTGTGATCCATTATATGG - Intergenic
1012251927 6:96990381-96990403 TTGGGCTGTGATCCAGTAAATGG + Intronic
1013703670 6:112806268-112806290 GTGGGTTCTGATTCATTAAAGGG - Intergenic
1017235153 6:152111152-152111174 GTGGGCTGTGGTCCCTTCCTGGG - Intronic
1018166770 6:161105078-161105100 ATGGGTTGTGAACCATTAGTGGG + Intronic
1020305530 7:6831111-6831133 GTGGACTGAGCTCCATTCATAGG - Intergenic
1023057906 7:36304399-36304421 GTGTACTGTGCTTCATTAATGGG + Intergenic
1024857708 7:53800929-53800951 GTGGGAGGTGATTCATTCATGGG + Intergenic
1029052274 7:97701198-97701220 TTGGGGTGTGATCCATTAGGTGG - Intergenic
1029632911 7:101764331-101764353 GTGGGCTGTGAGCCAGGAAATGG - Intergenic
1031212537 7:118848840-118848862 CTGGGCTGTGATGCAGTAGTTGG + Intergenic
1033400362 7:141017110-141017132 GTGTGCTGTGAATCATTAGTTGG + Intergenic
1033782103 7:144683676-144683698 GTGGGCTGTGATCGAGCCATTGG - Intronic
1036528568 8:9558207-9558229 GCTGCTTGTGATCCATTAATGGG + Intronic
1036814384 8:11890361-11890383 GTGGGCAGTGATTGAATAATGGG + Intergenic
1037388460 8:18366834-18366856 TTGGGCTGTGATCCAGTAGATGG - Intergenic
1038431040 8:27499913-27499935 GTGGGCTCTAATCCAACAATAGG - Intronic
1044551854 8:93521139-93521161 GTGGACCATGATCCATTAGTGGG + Intergenic
1048705250 8:137146533-137146555 GTGGCCTGTGTTTCATTAAACGG + Intergenic
1048970872 8:139644423-139644445 GTGGGCTGTGATCCATTAATGGG - Intronic
1051932812 9:22406824-22406846 TTGGGCTGTGATCCAGTAGATGG - Intergenic
1053066868 9:35075196-35075218 GTGGGCTGGGACACATTAAAGGG + Intronic
1055423735 9:76171309-76171331 CTGGGCTGTGATCCATTAGCAGG + Intronic
1056792348 9:89633944-89633966 GTGGGCTCTGATCTAATGATTGG + Intergenic
1057099018 9:92339963-92339985 GTATGCTGGCATCCATTAATGGG + Intronic
1058221479 9:102309396-102309418 GTGGGCTATGATCCAGTAGAAGG + Intergenic
1062323567 9:136002336-136002358 GTGGGTTGTCATCCGTTCATGGG + Intergenic
1186780952 X:12911501-12911523 GTGGGCCCTGATCCAATAACTGG - Intronic
1188343716 X:29037997-29038019 AGAGGCTGTGATCCACTAATTGG - Intronic
1188941425 X:36242039-36242061 TTGGGCTGTGATCCAGTAGATGG - Intronic
1189912449 X:45824726-45824748 GTGGGCTGTGAGCCCTTCATGGG - Intergenic
1191670340 X:63742860-63742882 GTTGGCATTGAACCATTAATTGG - Intronic
1193357807 X:80542508-80542530 TTGGGCTGTGATCCAGTAGTTGG - Intergenic
1193961142 X:87925705-87925727 TTGGGCTGTGATCCAGTAGATGG - Intergenic
1194100084 X:89693533-89693555 TTGGGCTGTGATCCAGTAGACGG + Intergenic
1194468042 X:94256699-94256721 TTGGGCTGTGATCCAGTAGATGG - Intergenic
1195241634 X:102958929-102958951 TTGGGCTGTGATCCAGTAGATGG + Intergenic
1197886535 X:131223843-131223865 GTGGGTTATGATCCATTTGTGGG + Intergenic
1199245658 X:145600500-145600522 TTGGGCTGTGATCCAGTAGATGG - Intergenic
1200360885 X:155604763-155604785 TTGGGCTGTGATCCAGTAGATGG - Intronic
1200453087 Y:3354892-3354914 TTGGGCTGTGATCCAGTAGACGG + Intergenic
1201038196 Y:9803945-9803967 GAGGGTTGTGCTCCATTAACTGG - Intergenic