ID: 1048970873

View in Genome Browser
Species Human (GRCh38)
Location 8:139644424-139644446
Sequence CGTGGGCTGTGATCCATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 47}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048970873_1048970884 20 Left 1048970873 8:139644424-139644446 CCATTAATGGATCACAGCCCACG 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1048970884 8:139644467-139644489 TAGGGTTTTTCAGCCAGAGGTGG No data
1048970873_1048970880 2 Left 1048970873 8:139644424-139644446 CCATTAATGGATCACAGCCCACG 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1048970880 8:139644449-139644471 TGAAACCATATTCCAGGGTAGGG No data
1048970873_1048970877 -4 Left 1048970873 8:139644424-139644446 CCATTAATGGATCACAGCCCACG 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1048970877 8:139644443-139644465 CACGGCTGAAACCATATTCCAGG No data
1048970873_1048970886 27 Left 1048970873 8:139644424-139644446 CCATTAATGGATCACAGCCCACG 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1048970886 8:139644474-139644496 TTTCAGCCAGAGGTGGTTCAGGG No data
1048970873_1048970887 30 Left 1048970873 8:139644424-139644446 CCATTAATGGATCACAGCCCACG 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1048970887 8:139644477-139644499 CAGCCAGAGGTGGTTCAGGGTGG No data
1048970873_1048970883 17 Left 1048970873 8:139644424-139644446 CCATTAATGGATCACAGCCCACG 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1048970883 8:139644464-139644486 GGGTAGGGTTTTTCAGCCAGAGG No data
1048970873_1048970885 26 Left 1048970873 8:139644424-139644446 CCATTAATGGATCACAGCCCACG 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1048970885 8:139644473-139644495 TTTTCAGCCAGAGGTGGTTCAGG No data
1048970873_1048970878 -3 Left 1048970873 8:139644424-139644446 CCATTAATGGATCACAGCCCACG 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1048970878 8:139644444-139644466 ACGGCTGAAACCATATTCCAGGG No data
1048970873_1048970879 1 Left 1048970873 8:139644424-139644446 CCATTAATGGATCACAGCCCACG 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1048970879 8:139644448-139644470 CTGAAACCATATTCCAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048970873 Original CRISPR CGTGGGCTGTGATCCATTAA TGG (reversed) Intronic
904414148 1:30345642-30345664 CTTTGGCTGTGTTCCAATAAAGG + Intergenic
906266921 1:44438648-44438670 GGTGGCCTGTGACCCATTTAAGG + Intronic
920453803 1:206082136-206082158 AGTGAGCTGTGATACATCAACGG + Intronic
1074970403 10:118531695-118531717 CCAGGGCTATGATCCATTTATGG + Intergenic
1075670454 10:124260750-124260772 TGTGGGCTGTGATCCATGGAAGG + Intergenic
1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG + Intronic
1080954863 11:37081673-37081695 AATGGGCTGTGATACATTAGTGG + Intergenic
1085515228 11:77107689-77107711 CCTGGGATGTGATCCACCAACGG - Intronic
1091037661 11:132248008-132248030 TGTGGGCTGTGACCATTTAATGG - Intronic
1101564898 12:105895865-105895887 CAGGGGCTGTGATCCAGTAGGGG - Intergenic
1106773366 13:32984457-32984479 GGTGGCCTGTGATGCATTCATGG + Intergenic
1117027515 14:51636687-51636709 TGTGGGATGTGACCCCTTAAAGG + Intronic
1129684487 15:77677370-77677392 CTGAGGGTGTGATCCATTAAGGG - Intronic
1132624524 16:885174-885196 GGTGAGCTGTGATGGATTAAAGG + Intronic
1135652193 16:24216154-24216176 CGGGGGCTGTGGCCCATTCAGGG + Exonic
1139649697 16:68356124-68356146 CCTGAGCTGTGATCCAACAAGGG - Intronic
1143930131 17:10413960-10413982 CAGGGGCTGTGATGCATTATGGG - Exonic
1143938469 17:10512466-10512488 CAGGGGCTGTGATGCATTATGGG - Exonic
1143940860 17:10539986-10540008 CGGGGGCTGTGATGCATTATGGG - Exonic
1144640991 17:16936410-16936432 GGTTGGCTGTGATTAATTAAAGG + Intronic
1144874091 17:18388107-18388129 GGTTGGCTGTGATTAATTAAAGG - Intronic
1145158129 17:20556309-20556331 GGTTGGCTGTGATTAATTAAAGG + Intergenic
1160267979 18:77357142-77357164 CTGGGGATGAGATCCATTAATGG - Intergenic
1165991597 19:39818356-39818378 CTTGGGCTGTGAAGCGTTAAGGG - Intergenic
1167812143 19:51842706-51842728 CATGGTCTGTGAACCTTTAAGGG - Intergenic
925478831 2:4247910-4247932 CGTGGGCTCTGATCCAATGAGGG + Intergenic
925618398 2:5766330-5766352 AGTGGGCTGTGAGCCGTTCATGG - Intergenic
931494288 2:62785236-62785258 TGTGGGTTATGATCCATTAGTGG - Intronic
1174063600 20:47849267-47849289 CGCAGGCTGTGATGCATTAGTGG - Intergenic
1175378101 20:58543084-58543106 CGGTGGCTGTGTTCCAGTAAAGG - Intergenic
949353774 3:3155376-3155398 TGTGGGCAGTGATTCATTAAGGG + Intronic
950862887 3:16165786-16165808 CGGGGTCTGTGATCCATGGAAGG - Intergenic
956068223 3:65419451-65419473 TGTGGGCTGTGACCTATTACTGG - Intronic
980968867 4:139550427-139550449 CCTAGGGTGTGATCAATTAAAGG + Intronic
982615097 4:157631607-157631629 TGTGGGCTGTGATCTGGTAAGGG - Intergenic
1000092466 5:157941657-157941679 ACAGTGCTGTGATCCATTAATGG - Intergenic
1002613383 5:180435844-180435866 CCTGGGCTGTGAGCCCTGAAAGG - Intergenic
1013181394 6:107719579-107719601 GATGGGCTGTGATCTGTTAAGGG + Intronic
1013703671 6:112806269-112806291 TGTGGGTTCTGATTCATTAAAGG - Intergenic
1014916116 6:127150665-127150687 CTTGGGCTGAGATCTCTTAAAGG + Intronic
1022132036 7:27413679-27413701 CCTTGGCTGTCATCTATTAAAGG + Intergenic
1027390071 7:77695853-77695875 CATGTGCTGTAATCCATTGAAGG - Intergenic
1027413014 7:77942577-77942599 TGTGGGCTGTGATCAACTGATGG + Intronic
1030755070 7:113277542-113277564 GGTGGTCTGTGATCATTTAAAGG - Intergenic
1033277397 7:139982727-139982749 TGTGGGCTGTGATCCTTTAGGGG - Intronic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1051179650 9:14396853-14396875 TGTGGTCTTTGAGCCATTAATGG + Intronic
1052339478 9:27351206-27351228 AGTGGGCTTTAATCCATGAAGGG + Intronic
1053066867 9:35075195-35075217 GGTGGGCTGGGACACATTAAAGG + Intronic
1053895502 9:42737892-42737914 GGTCGGCTGTGATCCGTTAAAGG + Intergenic
1062077455 9:134598637-134598659 CATGGGCTGTGATCCACCGAGGG - Intergenic
1062099994 9:134723069-134723091 CGGGGGCTGTGACCCACAAAGGG - Intronic
1186148002 X:6645085-6645107 CCTGGGCTGCGATCAATTATGGG - Intergenic
1189912450 X:45824727-45824749 GGTGGGCTGTGAGCCCTTCATGG - Intergenic