ID: 1048970875

View in Genome Browser
Species Human (GRCh38)
Location 8:139644441-139644463
Sequence TGGAATATGGTTTCAGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048970875_1048970885 9 Left 1048970875 8:139644441-139644463 CCCACGGCTGAAACCATATTCCA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1048970885 8:139644473-139644495 TTTTCAGCCAGAGGTGGTTCAGG No data
1048970875_1048970887 13 Left 1048970875 8:139644441-139644463 CCCACGGCTGAAACCATATTCCA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1048970887 8:139644477-139644499 CAGCCAGAGGTGGTTCAGGGTGG No data
1048970875_1048970883 0 Left 1048970875 8:139644441-139644463 CCCACGGCTGAAACCATATTCCA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1048970883 8:139644464-139644486 GGGTAGGGTTTTTCAGCCAGAGG No data
1048970875_1048970888 14 Left 1048970875 8:139644441-139644463 CCCACGGCTGAAACCATATTCCA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1048970888 8:139644478-139644500 AGCCAGAGGTGGTTCAGGGTGGG No data
1048970875_1048970886 10 Left 1048970875 8:139644441-139644463 CCCACGGCTGAAACCATATTCCA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1048970886 8:139644474-139644496 TTTCAGCCAGAGGTGGTTCAGGG No data
1048970875_1048970884 3 Left 1048970875 8:139644441-139644463 CCCACGGCTGAAACCATATTCCA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1048970884 8:139644467-139644489 TAGGGTTTTTCAGCCAGAGGTGG No data
1048970875_1048970890 29 Left 1048970875 8:139644441-139644463 CCCACGGCTGAAACCATATTCCA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1048970890 8:139644493-139644515 AGGGTGGGCTCCCGCTGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048970875 Original CRISPR TGGAATATGGTTTCAGCCGT GGG (reversed) Intronic
901303990 1:8219009-8219031 TGGAATATGCTCTCAGCTGAGGG + Intergenic
905159943 1:36023588-36023610 TTGAACATGGTTTCAACAGTTGG + Intronic
905615714 1:39396607-39396629 TGGTAAATGGTCTCAGCCTTAGG + Intronic
906409271 1:45566077-45566099 TGGAAGATGGTTTCAGTCTAAGG - Intronic
907441346 1:54480515-54480537 TGGAATCTGGCCTCAGCCTTGGG - Intergenic
910546478 1:88424674-88424696 TGGAATATGGTATCATTGGTTGG - Intergenic
911616082 1:100012779-100012801 AGGATTATTGTTTCAGCCATTGG + Intronic
911648613 1:100361883-100361905 TGGATTAGGGTTGCAGCAGTGGG + Intronic
912011017 1:104963203-104963225 AGGAATATTATTTCAGCCTTAGG - Intergenic
916063244 1:161116560-161116582 TGGAATATGGTTTCTGACTTGGG - Intronic
919559868 1:199103534-199103556 TTGAGTATGGTTTTAGCTGTGGG + Intergenic
1066212476 10:33253302-33253324 TGGAAAATGGGGTCAGCGGTGGG + Intronic
1067277050 10:44845281-44845303 AGGAATTAGGTTTCAGCCCTTGG - Intergenic
1069585082 10:69594258-69594280 TGGTATCTTATTTCAGCCGTGGG + Intergenic
1078123807 11:8538093-8538115 AGGAGGATGGTTTCAGCCGTGGG + Intronic
1079658000 11:23005499-23005521 AGGAATATGGATACAGCTGTAGG + Intergenic
1081534656 11:43987987-43988009 TGGAAAATGGTTTCAGTCCCAGG + Intergenic
1090094673 11:123730799-123730821 TGGAAGATGATTTCACCTGTCGG - Exonic
1092897300 12:13024786-13024808 TTGAACATGGTTTCAACAGTTGG + Intergenic
1094284464 12:28777266-28777288 TGCAAAATGGTCTCAGCGGTAGG - Intergenic
1095663428 12:44765439-44765461 TGGAATTTGGGTTAAGCCATAGG - Intronic
1100843057 12:98632597-98632619 TGGAATCTGGTTGTAGCTGTTGG - Intronic
1101310962 12:103578740-103578762 TTGAACATGGTTTAAGCAGTTGG - Intergenic
1104277028 12:127338706-127338728 ATGGATATGGTTTCTGCCGTTGG - Intergenic
1104702721 12:130919281-130919303 TGGAATATGATTTCAGCATAAGG - Intergenic
1104702749 12:130919530-130919552 TGGAATATGATTTCAGCATGAGG - Intergenic
1104965622 12:132507678-132507700 TGGAATATGGTGTCACCTGGGGG + Intronic
1107912448 13:45118129-45118151 TGGGATATGGTCTCAGCTCTTGG + Intergenic
1108898597 13:55367178-55367200 TAGAATATGGTATAAGCAGTAGG + Intergenic
1110291926 13:73817690-73817712 TTGAATCTGGTTTCAACAGTTGG - Intronic
1110439652 13:75513409-75513431 TGGAACATGGTTTGAACAGTTGG - Intergenic
1112606032 13:100907358-100907380 TGGAAGATGTTTTCAGTTGTGGG - Intergenic
1115324652 14:32126200-32126222 TGGAGTATGATATCAGCTGTGGG + Intronic
1115427240 14:33274176-33274198 TTGAATATGGTTTGAACAGTTGG + Intronic
1117190460 14:53285256-53285278 TTGAACATGGTTTGAGCAGTTGG - Intergenic
1120503028 14:85320847-85320869 TGGTAGATGGTTTCAGACTTAGG - Intergenic
1122758565 14:104002548-104002570 TTGAATGTGGTTTGAGCAGTTGG + Intronic
1123904217 15:24906216-24906238 TGGAATATGGCTTGAGCCCATGG - Intronic
1130175456 15:81564586-81564608 TGGAATATGGATGCTGCCATTGG - Intergenic
1134672736 16:16067801-16067823 TGGAAGATGGTTTCAGGCAGAGG + Intronic
1134688342 16:16174265-16174287 TGGAACATGGTTTGAACGGTTGG - Intronic
1137541651 16:49366810-49366832 TTGAATATGGTTTGAACAGTTGG - Intergenic
1138482164 16:57310711-57310733 TGGAAAAGGGCTTCAGCTGTGGG - Intergenic
1139118161 16:63982323-63982345 TTGAATATGGTTTGAACAGTGGG + Intergenic
1139802929 16:69538651-69538673 TGTAAAATGGTTTCAGCCCTTGG - Intergenic
1140907248 16:79419301-79419323 TGGAACAAGGCTTCAGCCTTTGG + Intergenic
1144391091 17:14794024-14794046 TGGAACATGGTTTGAGCAGTTGG - Intergenic
1151103302 17:71581038-71581060 TTGAACATGGTTTGAGCAGTTGG - Intergenic
1156890272 18:42182941-42182963 TTGAATGTGGTTTGAGCAGTTGG - Intergenic
1158066742 18:53419797-53419819 TGGAATGTGGTTTCTGGGGTTGG - Intronic
1160115177 18:76072578-76072600 TGGAAGTTGGTTCCAGCTGTTGG - Intergenic
1165663092 19:37599610-37599632 TGGTTTATGGTTTCAGGCATTGG + Exonic
1168574128 19:57494246-57494268 TGGAAAAAGGTTTCAGCCAAAGG + Exonic
925864440 2:8214165-8214187 TGTTTTCTGGTTTCAGCCGTGGG - Intergenic
926287413 2:11500713-11500735 GGGAAGATGGTTTCAGCAGTTGG + Intergenic
928782241 2:34837843-34837865 TTGAATATGATGTTAGCCGTAGG - Intergenic
931123764 2:59250863-59250885 AGGAACATGGTTGCAGGCGTAGG + Intergenic
931858062 2:66324666-66324688 TGAAACATGTTTTCAGCCTTAGG - Intergenic
932567294 2:72917937-72917959 TGGAACATGGTCGCAGCCGCGGG - Exonic
932939755 2:76149713-76149735 TGGAATATTGTTACAGAGGTAGG - Intergenic
933551182 2:83778066-83778088 TTGAATATGATTTTAGCTGTAGG + Intergenic
937708216 2:124946197-124946219 TGGAATATGGTTTAAATCTTTGG + Intergenic
942809359 2:179979074-179979096 TGGAATCTGATTTCAGCTGCAGG + Intronic
943922860 2:193731803-193731825 TTGAATATGTATTCAGCAGTTGG - Intergenic
944751998 2:202718321-202718343 TTGAATATGGTGTTAGCTGTGGG + Intronic
946721370 2:222611929-222611951 TGTAATACTGTTTCAGCAGTAGG - Intronic
948327093 2:237133090-237133112 TGGAATGGGATTTCAGCTGTAGG + Intergenic
1169925066 20:10774465-10774487 TGGAATATGATGTTAGCTGTGGG - Intergenic
1175708014 20:61195496-61195518 TAGAATATGGTTCCAGCCTCCGG + Intergenic
1183313327 22:37123576-37123598 TGGAATATGGCTTAAGGCCTGGG - Intergenic
951343236 3:21514599-21514621 TTGAATTTGGTTTGAACCGTTGG - Intronic
952593877 3:34990379-34990401 AGGAATATTTTTTCAGCAGTAGG - Intergenic
957593379 3:82228084-82228106 TCAAATATGGTGTCAGCAGTAGG + Intergenic
960017464 3:112908270-112908292 TGGAAGATGGCTTCAGCTTTTGG - Intergenic
965707463 3:171523638-171523660 TGAAGTATGGTTTCAGGCTTTGG + Intergenic
965935151 3:174100390-174100412 TGGAATATGTTTCTAGCAGTGGG - Intronic
966590914 3:181681976-181681998 TTGAATATGTATTCAGCAGTGGG + Intergenic
972648756 4:40995123-40995145 GGGAACATGGTTTCAGCCAAAGG - Intronic
974220800 4:58968571-58968593 AGCAATATGGTTGCAGCCGGAGG + Intergenic
982206925 4:153003702-153003724 TGGAATATCGATTTAGCCGCAGG - Intergenic
983969436 4:173852942-173852964 TTGAACATGGTTTAAGCAGTTGG + Intergenic
987927777 5:24364523-24364545 TGGACTATGGTGTCTGCCTTGGG - Intergenic
993585661 5:89724559-89724581 TGGAATATGAATTCAGACATAGG - Intergenic
997728763 5:136147529-136147551 TGGAATATGGATTCTGCAGCTGG + Intronic
1011396970 6:86920268-86920290 TGGGATATGGTTTAAGCCTCAGG - Intergenic
1015114961 6:129637651-129637673 TTGAATATGGTTTGAACAGTTGG - Intronic
1018143021 6:160858687-160858709 TTGAACATGGTTTGAGCAGTTGG - Intergenic
1022824589 7:33995897-33995919 TGGAACATGGTTTCTGGAGTTGG + Intronic
1025925337 7:65954727-65954749 TGTAATATGTTTTTAGCCGATGG + Exonic
1026261649 7:68760708-68760730 TTGAACATGGTTTCAACAGTTGG - Intergenic
1030296750 7:107936480-107936502 TGGATTTTGGTTTCTGCAGTGGG + Intronic
1031177049 7:118366572-118366594 TGAAATATGGTTACATGCGTGGG + Intergenic
1033437999 7:141351663-141351685 TGTAAAATGGTATCAGCCTTTGG - Intronic
1038149741 8:24931742-24931764 TTGAATATGGTTTGAACAGTGGG - Intergenic
1038381498 8:27099166-27099188 TGGATTATGGTGTTAGCAGTGGG - Intergenic
1040651954 8:49458698-49458720 TTGAATATGTTTTCAGCCTTTGG + Intergenic
1042813611 8:72853393-72853415 AGGAATATGGTCTCAGCTGGAGG - Intronic
1044304506 8:90622388-90622410 TGGAATTTTGTTTCAGCCAGAGG - Exonic
1046145769 8:110156445-110156467 TAGAATATGCGTTCAGCCCTGGG - Intergenic
1048970875 8:139644441-139644463 TGGAATATGGTTTCAGCCGTGGG - Intronic
1051061677 9:13052753-13052775 GGGAATATGGGTTCAGCCATTGG + Intergenic
1051379500 9:16441096-16441118 TGGAAGATGGCTTAAGCCCTAGG + Intronic
1056203686 9:84300409-84300431 TGGAATATGTTATCTGCCCTTGG + Intronic
1057125472 9:92612830-92612852 GGGAATATGCCTCCAGCCGTAGG + Intronic
1057390814 9:94640055-94640077 TGGATTAAGGATTCAGACGTGGG - Exonic
1060097436 9:120804534-120804556 TGGTAGATGGCTTCAGCAGTTGG + Intergenic
1060940510 9:127540670-127540692 TGGAACAGGGTTTCAGGCTTAGG - Intronic
1194795257 X:98203249-98203271 GCGAATATAGTTTCAGCCATAGG - Intergenic
1196527455 X:116742888-116742910 TGGAACATGGGTGCAGCTGTAGG - Intergenic
1197762706 X:130039001-130039023 TGTAATATGGTTTAAGACTTAGG - Intronic
1198092501 X:133345577-133345599 TTGAACATGGTTTGAACCGTTGG - Intronic
1199088836 X:143667017-143667039 TTGAATATGATGTCAGCTGTGGG + Intergenic
1201983833 Y:19939425-19939447 AGGAATATGGTTGGAGCCGAAGG - Intergenic