ID: 1048970876

View in Genome Browser
Species Human (GRCh38)
Location 8:139644442-139644464
Sequence CTGGAATATGGTTTCAGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048970876_1048970885 8 Left 1048970876 8:139644442-139644464 CCACGGCTGAAACCATATTCCAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1048970885 8:139644473-139644495 TTTTCAGCCAGAGGTGGTTCAGG No data
1048970876_1048970888 13 Left 1048970876 8:139644442-139644464 CCACGGCTGAAACCATATTCCAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1048970888 8:139644478-139644500 AGCCAGAGGTGGTTCAGGGTGGG No data
1048970876_1048970884 2 Left 1048970876 8:139644442-139644464 CCACGGCTGAAACCATATTCCAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1048970884 8:139644467-139644489 TAGGGTTTTTCAGCCAGAGGTGG No data
1048970876_1048970887 12 Left 1048970876 8:139644442-139644464 CCACGGCTGAAACCATATTCCAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1048970887 8:139644477-139644499 CAGCCAGAGGTGGTTCAGGGTGG No data
1048970876_1048970890 28 Left 1048970876 8:139644442-139644464 CCACGGCTGAAACCATATTCCAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1048970890 8:139644493-139644515 AGGGTGGGCTCCCGCTGCATAGG No data
1048970876_1048970883 -1 Left 1048970876 8:139644442-139644464 CCACGGCTGAAACCATATTCCAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1048970883 8:139644464-139644486 GGGTAGGGTTTTTCAGCCAGAGG No data
1048970876_1048970886 9 Left 1048970876 8:139644442-139644464 CCACGGCTGAAACCATATTCCAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1048970886 8:139644474-139644496 TTTCAGCCAGAGGTGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048970876 Original CRISPR CTGGAATATGGTTTCAGCCG TGG (reversed) Intronic
901303989 1:8219008-8219030 ATGGAATATGCTCTCAGCTGAGG + Intergenic
901402154 1:9021856-9021878 CTGGAAAATGGGTTCAGACAAGG + Intronic
904454324 1:30638211-30638233 CTGGAATCTGGCTTCAGCCGAGG + Intergenic
907441347 1:54480516-54480538 CTGGAATCTGGCCTCAGCCTTGG - Intergenic
910525397 1:88172275-88172297 CTGGAAGATGGCTTGAGCCCGGG + Intergenic
912564354 1:110575341-110575363 CTGGAAAATTGTTTGAGCCCAGG - Intergenic
915384215 1:155474606-155474628 CTGGAAAATGGCTTGAGCCCAGG + Intronic
915390563 1:155539673-155539695 CTGGAAGATCGTTTGAGCCCAGG - Intronic
916063245 1:161116561-161116583 ATGGAATATGGTTTCTGACTTGG - Intronic
916551079 1:165850530-165850552 CAGGAAGATGGTTTCAGCCCAGG - Intronic
916719261 1:167471693-167471715 CTGGAAGATCGTTTGAGCCCAGG - Intronic
916902336 1:169242014-169242036 CAGGAATATTGTTTGAGCCTAGG - Intronic
918512846 1:185330149-185330171 GTGGAAGATGGTTTGAGCCCGGG - Intergenic
918514568 1:185348641-185348663 TTGGAGAATGGTTTCAGCCCAGG - Intergenic
919490486 1:198199206-198199228 CTGCAATATGGTTGCAGTAGAGG + Intronic
922317229 1:224453261-224453283 CTGGAAGATGGGTTGAGCCCAGG - Intronic
1063378970 10:5572379-5572401 CTGAAATTTGGTTTTAGCCATGG + Intergenic
1066212475 10:33253301-33253323 CTGGAAAATGGGGTCAGCGGTGG + Intronic
1066329657 10:34406618-34406640 CTGGAGTATTGTTTGAGCCTAGG - Intronic
1066667915 10:37804195-37804217 CTGAAATATCGCTTGAGCCGGGG - Intronic
1068518971 10:58058496-58058518 CTGAAGTATGGTTTCAGGCGTGG - Intergenic
1070000643 10:72374351-72374373 CAGGAAGATGGTTTGAGCCCAGG - Intronic
1070947221 10:80402708-80402730 CAGGAAGATGGTTTGAGCCCAGG + Intergenic
1073089233 10:100919977-100919999 GTAAAATATGGTTTCAGCCTTGG - Intronic
1073305295 10:102498698-102498720 CTGGAAGATCGTTTGAGCCCAGG - Intronic
1074127514 10:110541025-110541047 AGGGAATATGGGTTTAGCCGTGG - Intergenic
1074708879 10:116160567-116160589 GTGGATTATGGTTTCATCCCAGG - Intronic
1074822023 10:117186855-117186877 ATGGGTTATGGTTTCAGCCAAGG + Intergenic
1074862420 10:117521000-117521022 CAGGAAGATGGTTTGAGCCCAGG + Intergenic
1075781680 10:125021405-125021427 CAGGAATATGATTTCAGCCCAGG - Intronic
1078123806 11:8538092-8538114 TAGGAGGATGGTTTCAGCCGTGG + Intronic
1079282410 11:19099233-19099255 CTGGGATCTGGTTGCAGGCGTGG - Intergenic
1085106706 11:73850005-73850027 CAGGAATATTGTTTAAGCCCGGG + Intronic
1089999537 11:122943100-122943122 CAGGAAGATGGCTTGAGCCGAGG - Intronic
1090997599 11:131880956-131880978 CTGGAATGTTGTTTCAGTGGTGG - Intronic
1096477608 12:51917902-51917924 CTGTAATCTGGTGTCAGCCCCGG + Intronic
1098929272 12:76391668-76391690 CTGGAAGATGGCTTGAGCCCAGG + Intronic
1103996803 12:124835349-124835371 CAGGAAGATGGTTTGAGCCCAGG - Intronic
1104965621 12:132507677-132507699 CTGGAATATGGTGTCACCTGGGG + Intronic
1106137552 13:26985044-26985066 CTGGAGGATGGCTTCAGCCTGGG - Intergenic
1106621923 13:31378497-31378519 CTGAAATATGGTTTAACCCCAGG - Intergenic
1108369311 13:49751813-49751835 CAGGAAGATGGCTTCAGCCCAGG + Intronic
1111833545 13:93359191-93359213 CTGGAAGATTGCTTCAGCCAAGG - Intronic
1112487214 13:99830789-99830811 ATGGAATATGCTTCCAGTCGTGG + Intronic
1117380619 14:55159171-55159193 ATGAAATATGGTTTCAGCATAGG - Intronic
1121246496 14:92464740-92464762 CTGGAATATGGGGGCTGCCGAGG + Intronic
1124223518 15:27870031-27870053 CTGGAATTTAGTTTCTGCCTAGG - Intronic
1125116293 15:36095994-36096016 CAGGAGGATGGCTTCAGCCGAGG + Intergenic
1127846236 15:62873953-62873975 CAGGAATGTGGTTTTAGCCTTGG - Intergenic
1128093170 15:64932854-64932876 CTGGAATATTGCTTGAGCCCAGG + Intronic
1131469182 15:92681564-92681586 CTGAAAGATGGTTACAGCTGTGG + Intronic
1131940055 15:97552567-97552589 CAGGAAAATTGTTTCAGCCATGG + Intergenic
1132301246 15:100777167-100777189 CAGGAATATCATTTCAGCCCCGG + Intergenic
1132634539 16:936872-936894 CTGGAAGATGGCTTAAGCCCAGG + Intronic
1132740729 16:1411437-1411459 CAGGAAGATGGTTTGAGCCCTGG + Intronic
1133133274 16:3691446-3691468 CGGGAAGATGGTTTCAGCCCAGG - Intronic
1134680667 16:16122789-16122811 CTGGAGGATCGTTTCAGCCCAGG + Intronic
1135594956 16:23734793-23734815 CGGGAGTATGGTTTGAGCCCAGG - Intergenic
1136104011 16:28015939-28015961 CTGGCCTATTGTTTCAGCAGAGG - Intronic
1136845949 16:33575881-33575903 CTGGAGGATGGCTTCAGCCTGGG + Intergenic
1140355527 16:74302648-74302670 CGGGAATATTGTTTGAGCCCAGG + Intronic
1140959186 16:79896091-79896113 CTGGAATCTGGTTGCGGGCGAGG - Intergenic
1142074438 16:88109278-88109300 CTGCAATGTGGTTGCAGCAGAGG - Intronic
1142156822 16:88536262-88536284 CAGGAAGATGGTTTCAGCTCAGG - Exonic
1142284278 16:89165409-89165431 CTGGACTATAGATGCAGCCGGGG + Intergenic
1203107657 16_KI270728v1_random:1424534-1424556 CTGGAGGATGGCTTCAGCCTGGG + Intergenic
1144106343 17:11989230-11989252 CAGGAGTATGGTTTGAGCCCGGG + Intronic
1146729003 17:35177990-35178012 CTGGAAAATAGCTTCAGCCCTGG - Intronic
1147228684 17:39001559-39001581 CTGGAAGATGGTTTGAGCCTGGG - Intergenic
1147270370 17:39265833-39265855 CTGGAAGATGGCTTGAGCCTGGG - Intronic
1147944167 17:44070909-44070931 CTGGACTCTGGTTTCCGCCCTGG + Exonic
1148097236 17:45060988-45061010 CTGGTTTAGGGTTTCAGGCGTGG - Exonic
1150286340 17:63956332-63956354 CAGGAAGATGGTTTGAGCCGTGG - Intronic
1151595103 17:75073648-75073670 TGGGAATATGGCTTCAGCCAGGG + Intergenic
1151735769 17:75939456-75939478 CTGGGAAAGGGTTTCAGCCTTGG - Intronic
1152985988 18:321547-321569 CTGCAATTAGGTTTCAGCCCTGG - Intronic
1157526828 18:48389673-48389695 CAGGAATGTGGTTTCAGCTGGGG - Intronic
1163168014 19:15510889-15510911 CTGGAGGATGGTTTGAGCCCAGG + Intronic
1164966621 19:32490222-32490244 CTGGAATTTGGGTCCAGCTGGGG + Intergenic
1165030230 19:32992898-32992920 CAGGAGTATGGTTTGAGCCCAGG + Intronic
1165035185 19:33028247-33028269 CTGGAGGATGGCTTCAGCCTGGG - Intronic
1166113644 19:40639519-40639541 CTGGAGGATGGCTTGAGCCGAGG - Intergenic
926435293 2:12831190-12831212 CTTTAACATGGTTTCAGCCCAGG - Intergenic
927041318 2:19233261-19233283 CTGTAATATGCTTTCAGCTATGG + Intergenic
930637332 2:53820890-53820912 CTGGAAGATGGCTTGAGCCCAGG + Intergenic
932567295 2:72917938-72917960 CTGGAACATGGTCGCAGCCGCGG - Exonic
938762884 2:134441580-134441602 CTGGAATATGCCTTCAGCCCAGG - Intronic
940335039 2:152517835-152517857 CTGGTATATGGTTAAAGCCCAGG + Intronic
943588945 2:189774249-189774271 CAGGAAGATGGTTTGAGCCTAGG - Intronic
948791161 2:240377535-240377557 CGGGAGGATGGTTTAAGCCGGGG + Intergenic
1168800494 20:641495-641517 CTGGAGGATGGTTTGAGCCTGGG + Intergenic
1172611185 20:36253608-36253630 CTGGAATGGGGTTTCAGATGTGG + Intronic
1172629782 20:36370270-36370292 CAGGAAGATGGTTTGAGCCCAGG + Intronic
1177833144 21:26162234-26162256 CAGGAAGATGGCTTCAGCCCAGG + Intronic
1178068977 21:28940270-28940292 CTTGAAGATAGTTTGAGCCGGGG - Intronic
1178215285 21:30590322-30590344 CTGGACTATGGTTGCAGCTATGG - Exonic
1179367644 21:40773083-40773105 CAGGGATGTGGTTTCAGCTGGGG - Intronic
1180489295 22:15827365-15827387 CTGGAAGATGGCTTGAGCCTAGG + Intergenic
1183641651 22:39096439-39096461 CTGGTCTATGGTGTCAGCCCTGG + Intergenic
1184201561 22:42972787-42972809 CGGGAACATGGCTTCAGCCCAGG - Intronic
949948590 3:9210392-9210414 CTGGAGTATCGCTTGAGCCGAGG + Intronic
950644720 3:14370240-14370262 CAGGAAGATGGTTTGAGCCCAGG + Intergenic
950759672 3:15210091-15210113 CTGGAAGATTGTTTTAGCCCAGG - Intronic
951063631 3:18238747-18238769 CTGAAATACGGTTCCAGGCGAGG - Intronic
951351357 3:21610884-21610906 CTGGAATGTGGTCTCATCTGAGG + Intronic
954921272 3:54193186-54193208 TTGGAACCTGGTTTCAGCCCAGG + Intronic
955455736 3:59119283-59119305 CTGGAAGATTGCTTGAGCCGAGG + Intergenic
959040568 3:101418459-101418481 ATGGAATATAGTTTCTGCAGTGG + Intronic
966188563 3:177249739-177249761 CTGGAGGATTGTTTCAGCCCAGG + Intergenic
972661295 4:41119044-41119066 CAGGAAGATGGTTTGAGCCCTGG + Intronic
975387345 4:73773218-73773240 CAGGAGGATTGTTTCAGCCGAGG - Intergenic
977039672 4:92001038-92001060 CTGGAAGATGATTTGAGCCCAGG + Intergenic
977168513 4:93730780-93730802 CTGTAAGGTGGTTTCAGCAGAGG + Intronic
977293315 4:95186644-95186666 GTGGAATGTGGTTTCAGACAGGG + Intronic
979586809 4:122429340-122429362 CTGGAAGATGGCTTGAGCCCAGG + Intronic
981093074 4:140753319-140753341 CTGGAGGATGGTTTGAGCCTAGG - Intronic
984776703 4:183487329-183487351 CAGGAAGATGGTTTGAGCCTGGG + Intergenic
987927778 5:24364524-24364546 CTGGACTATGGTGTCTGCCTTGG - Intergenic
989492376 5:42073107-42073129 TTGGATTATGGTTTCACCCTAGG + Intergenic
990852838 5:60226693-60226715 CTGGAATGTGGTTTCAAGAGTGG + Intronic
990939397 5:61186918-61186940 CTGGCATATGGTATCAGCCTGGG - Intergenic
997011175 5:129879853-129879875 CTGGAATATGGTTCCTGTCTGGG - Intergenic
997020904 5:130000802-130000824 CTGGAATATGACTTAAGCCCAGG - Intronic
997096638 5:130920581-130920603 CAGGAAGATGGTTTGAGCCCAGG + Intergenic
997179941 5:131817521-131817543 CTGGAATATGGTGTGAACCTGGG + Intronic
1002189311 5:177470491-177470513 CTGGGGTATGGTTTCTGCTGGGG - Intronic
1003273783 6:4630617-4630639 CTGGAGTATGGCTTGAGCCCAGG - Intergenic
1003374168 6:5559309-5559331 CAGGAATATTGCTTGAGCCGGGG + Intronic
1006774654 6:36582747-36582769 CAGGAATATGGCTTGAGCCCAGG + Intergenic
1019535237 7:1525838-1525860 CAGGAAGATGGTTTGAGCCCAGG + Intergenic
1021823565 7:24522544-24522566 CTGGAGCATTGTTTCAGCTGAGG - Intergenic
1026796975 7:73372384-73372406 CAGGAAGATGGCTTGAGCCGGGG - Intergenic
1031177048 7:118366571-118366593 CTGAAATATGGTTACATGCGTGG + Intergenic
1032354584 7:131198275-131198297 CTGGAATATAGTTTAAGACAAGG - Intronic
1034196710 7:149253996-149254018 TTGGTCTGTGGTTTCAGCCGTGG - Exonic
1036495100 8:9263112-9263134 CTGGAATGTGGATGCAGCTGGGG + Intergenic
1037066641 8:14587442-14587464 CAGGAATATGGCTTAAGCCTAGG + Intronic
1037506267 8:19532653-19532675 CTGGAATATGGTAGGAGCCAAGG - Intronic
1039400764 8:37267049-37267071 CTGGGAGCTGGTTTCAGCCTGGG + Intergenic
1040018480 8:42719552-42719574 TTGGAAGATGGTTTGAGCCCAGG + Intronic
1040109406 8:43560319-43560341 CTGGAATATGGATTGAGTCAAGG + Intergenic
1042522009 8:69723476-69723498 CTGGAGTATGGCTTGAGCCCAGG - Intronic
1046054717 8:109065618-109065640 CTGGAAGATGGCTTGAGCCCAGG - Intergenic
1046145770 8:110156446-110156468 CTAGAATATGCGTTCAGCCCTGG - Intergenic
1047517663 8:125569244-125569266 CTGGAAAATGATTTCTGCAGGGG + Intergenic
1048970876 8:139644442-139644464 CTGGAATATGGTTTCAGCCGTGG - Intronic
1049192543 8:141296405-141296427 CAGGAAGATGGCTTCAGCCCAGG + Intronic
1052572645 9:30247138-30247160 CTGAAATATTATTTCAGCCTAGG + Intergenic
1052963932 9:34324566-34324588 CTGGAAGATGGTTTGAGGAGGGG - Intronic
1053011223 9:34634920-34634942 GTGGAAGCTGGTTTCAGCCCAGG - Exonic
1055793464 9:79948644-79948666 CTGGCAGATGGCTTGAGCCGAGG - Intergenic
1056071888 9:82995671-82995693 CAGGCAGATGGTTTGAGCCGAGG - Intronic
1057390815 9:94640056-94640078 CTGGATTAAGGATTCAGACGTGG - Exonic
1060781036 9:126413071-126413093 ATGGAATATGATCTCAGCTGTGG - Intronic
1186352945 X:8758313-8758335 CTGTCATATGTTTTCAGCTGTGG + Intergenic
1186912819 X:14187584-14187606 CTGCAAAATGGCTTCAGCAGAGG - Intergenic
1186946599 X:14575552-14575574 CAGGAATATCGTTTGAGCCCAGG - Intronic
1187081230 X:15990065-15990087 CTTGAATATATTTTCAGCCTTGG - Intergenic
1188309563 X:28599838-28599860 CTGCAATGTGGTTGCAGCTGGGG + Intronic
1188710522 X:33391686-33391708 CTGGAATATAGTGTCAGAAGTGG - Intergenic
1189911688 X:45816505-45816527 CTGGTAGATGGTTTGAGCCTAGG + Intergenic
1190413173 X:50156695-50156717 CAGGAATATGATCTCAGCCCTGG + Intergenic
1192105408 X:68311180-68311202 CTGGAGGATGGCTTCAGCCTGGG + Intronic
1200278384 X:154755864-154755886 CTGGAAGATGGCTTCAGCCCAGG + Intergenic