ID: 1048970877

View in Genome Browser
Species Human (GRCh38)
Location 8:139644443-139644465
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048970869_1048970877 18 Left 1048970869 8:139644402-139644424 CCCACTAACTTGATTTCATGACC 0: 1
1: 4
2: 34
3: 117
4: 234
Right 1048970877 8:139644443-139644465 CACGGCTGAAACCATATTCCAGG No data
1048970872_1048970877 -3 Left 1048970872 8:139644423-139644445 CCCATTAATGGATCACAGCCCAC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1048970877 8:139644443-139644465 CACGGCTGAAACCATATTCCAGG No data
1048970870_1048970877 17 Left 1048970870 8:139644403-139644425 CCACTAACTTGATTTCATGACCC 0: 2
1: 7
2: 34
3: 109
4: 281
Right 1048970877 8:139644443-139644465 CACGGCTGAAACCATATTCCAGG No data
1048970873_1048970877 -4 Left 1048970873 8:139644424-139644446 CCATTAATGGATCACAGCCCACG 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1048970877 8:139644443-139644465 CACGGCTGAAACCATATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr