ID: 1048970881

View in Genome Browser
Species Human (GRCh38)
Location 8:139644454-139644476
Sequence AAAAACCCTACCCTGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 167}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048970881_1048970886 -3 Left 1048970881 8:139644454-139644476 CCATATTCCAGGGTAGGGTTTTT 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1048970886 8:139644474-139644496 TTTCAGCCAGAGGTGGTTCAGGG No data
1048970881_1048970892 21 Left 1048970881 8:139644454-139644476 CCATATTCCAGGGTAGGGTTTTT 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1048970892 8:139644498-139644520 GGGCTCCCGCTGCATAGGCTGGG No data
1048970881_1048970890 16 Left 1048970881 8:139644454-139644476 CCATATTCCAGGGTAGGGTTTTT 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1048970890 8:139644493-139644515 AGGGTGGGCTCCCGCTGCATAGG No data
1048970881_1048970885 -4 Left 1048970881 8:139644454-139644476 CCATATTCCAGGGTAGGGTTTTT 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1048970885 8:139644473-139644495 TTTTCAGCCAGAGGTGGTTCAGG No data
1048970881_1048970887 0 Left 1048970881 8:139644454-139644476 CCATATTCCAGGGTAGGGTTTTT 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1048970887 8:139644477-139644499 CAGCCAGAGGTGGTTCAGGGTGG No data
1048970881_1048970884 -10 Left 1048970881 8:139644454-139644476 CCATATTCCAGGGTAGGGTTTTT 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1048970884 8:139644467-139644489 TAGGGTTTTTCAGCCAGAGGTGG No data
1048970881_1048970888 1 Left 1048970881 8:139644454-139644476 CCATATTCCAGGGTAGGGTTTTT 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1048970888 8:139644478-139644500 AGCCAGAGGTGGTTCAGGGTGGG No data
1048970881_1048970891 20 Left 1048970881 8:139644454-139644476 CCATATTCCAGGGTAGGGTTTTT 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1048970891 8:139644497-139644519 TGGGCTCCCGCTGCATAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048970881 Original CRISPR AAAAACCCTACCCTGGAATA TGG (reversed) Intronic
903944416 1:26952539-26952561 AAAAACCCTTGCCTGGGATGTGG + Intronic
907557740 1:55359345-55359367 AAAAACCCTACACTGGATTAAGG - Intergenic
908771678 1:67602847-67602869 CAAAAGCATACCCTGGAAAAAGG + Intergenic
909659404 1:78065326-78065348 AAAAAAAATACCCAGGAATACGG + Intronic
910933843 1:92469764-92469786 AAAAATATTTCCCTGGAATAAGG + Intergenic
911205277 1:95086292-95086314 GAAAACAATGCCCTGGAATATGG + Intergenic
915780622 1:158546215-158546237 AAAAACCCTACTTTCAAATATGG + Intergenic
916657684 1:166891604-166891626 AAAAGGCATACCCTGAAATAAGG - Intergenic
918358372 1:183728468-183728490 AAAACCCCTACCCTGAAAACTGG + Intronic
919614489 1:199788270-199788292 TAAATCCCCACCCTGGAATCTGG + Intergenic
920339463 1:205266951-205266973 TAAAACCCTAACCTGCAATTAGG - Intronic
921498356 1:215868617-215868639 AAAAACCCTATCTTCCAATAAGG - Intronic
921687542 1:218106919-218106941 AAAAAGCCTCTCCTGGAATCAGG - Intergenic
922067872 1:222161445-222161467 AGTAACCATGCCCTGGAATATGG - Intergenic
1062782045 10:221527-221549 AAAATCCACACCCTGAAATACGG - Intronic
1065644346 10:27818890-27818912 AAAACCCATACCCTTGACTATGG - Intronic
1065644454 10:27819741-27819763 AAAACCCATACCCTTGACTATGG + Intronic
1068936179 10:62637760-62637782 AAAAACCCCATTCTGGGATATGG + Intronic
1070165512 10:73894679-73894701 AAACACAATACCCTGGAATTTGG - Intergenic
1072816631 10:98515958-98515980 AGAAACCCTAACCTGGACTTGGG - Intronic
1073449386 10:103600635-103600657 AAAAACCCTCCCCAGGAAGGAGG - Exonic
1074353887 10:112764163-112764185 AAAATCCCTACCCTTAACTAAGG - Intronic
1078150073 11:8750895-8750917 GAAACCCCTGGCCTGGAATACGG + Intronic
1079722720 11:23838572-23838594 AAAAACCCTGGACTGAAATAAGG - Intergenic
1079963178 11:26949102-26949124 GAAATCCCTAGCCTAGAATATGG + Intergenic
1080132418 11:28812475-28812497 AAAAAGCCAAGCCTGGAAAATGG + Intergenic
1080132888 11:28817233-28817255 AAAAACCCTATGCTGTAATATGG - Intergenic
1085733488 11:79019014-79019036 CAAACCACTACCATGGAATAGGG - Intronic
1085919901 11:80940767-80940789 AAAACTCCTCCCATGGAATAAGG - Intergenic
1088377339 11:109157028-109157050 AAAGACCACACCCTAGAATAAGG - Intergenic
1090808049 11:130215173-130215195 CAAACCCCTAGCCTGGAAAATGG - Intergenic
1091804238 12:3344299-3344321 AAAAGCCCTCCCCTGGTATGGGG - Intergenic
1092983030 12:13816884-13816906 AAAAACCCTACACTTGAAATTGG + Intronic
1099999592 12:89817254-89817276 AAAAATCTTACCCTGGAAGGTGG + Intergenic
1100334560 12:93617237-93617259 AAAAATCCCACCCTGGGATGTGG - Intergenic
1101689112 12:107058791-107058813 ATAAATTCTAACCTGGAATAAGG + Intronic
1102282500 12:111629482-111629504 AAAAACCCTATCTTCAAATAAGG - Intergenic
1103112207 12:118290429-118290451 AAAAAACCTACCCTAGCTTAGGG - Intronic
1103743654 12:123107742-123107764 CAAAACCCTCCCCTAGAAAATGG - Intronic
1104513823 12:129405380-129405402 AAAAACCCCACACTGGAGTTAGG + Intronic
1105982265 13:25530088-25530110 AAAAACCATTACCTGTAATAAGG - Exonic
1106648042 13:31657714-31657736 AATAAACCTACCCTAGCATAAGG + Intergenic
1107458282 13:40575835-40575857 AAAGGCCCTACGCTGGAATTGGG + Intronic
1108004845 13:45935855-45935877 AAAAACCCTACCCCTGACTGTGG - Intergenic
1110146210 13:72193402-72193424 AAAAAGCTCACCGTGGAATATGG + Intergenic
1111949763 13:94701509-94701531 AAAAACTGTTCCCTGGAAAATGG - Intergenic
1112442934 13:99437840-99437862 ATAAACCCTAGTCTAGAATATGG + Intergenic
1114004893 14:18301706-18301728 CCAAACCCAGCCCTGGAATAAGG + Intergenic
1118936002 14:70289017-70289039 AATTACCCTACCCTTGAATCTGG + Intergenic
1123389352 15:19853940-19853962 CCAAACCCAGCCCTGGAATAAGG + Intergenic
1126890509 15:53199482-53199504 AAATCCCCTAGCCTGGAATCTGG - Intergenic
1128640006 15:69329029-69329051 ACAAATCCTGCCCTGGAATGGGG + Intronic
1129752463 15:78075991-78076013 AGAAAGCCCAACCTGGAATACGG + Intronic
1129783129 15:78287903-78287925 AACAGCCCTACCCTTGAAAATGG + Intronic
1134562114 16:15219707-15219729 AAATCCCCTACCCTGGAAAGTGG - Intergenic
1134901773 16:17944589-17944611 AGAAACCCAACCCTGGTAGAGGG + Intergenic
1134922652 16:18131331-18131353 AAATCCCCTACCCTGGAAAGTGG - Intergenic
1135987071 16:27191686-27191708 AAAGACCCTACCTGGGAATAAGG + Intergenic
1137486699 16:48897204-48897226 AAGAAGCAGACCCTGGAATAAGG + Intergenic
1137747026 16:50829947-50829969 GATAATCCTGCCCTGGAATATGG - Intergenic
1139935446 16:70567442-70567464 CAACACCCTCCCCTGGAATGGGG - Exonic
1140158678 16:72461173-72461195 AAAAACCCAACTCTGAAATTGGG + Intergenic
1141223541 16:82093645-82093667 AAAAACCCTCTCTTGGAATCTGG - Intronic
1142585527 17:970460-970482 AAAAACACCACCATGGAAAAAGG + Intronic
1142727751 17:1829338-1829360 ACCAACCCTACCCTGGCTTATGG + Intronic
1143720261 17:8804212-8804234 ACATGCCCTACCCTGGAATCTGG + Intronic
1144595199 17:16563959-16563981 CAAAACCCTCCCCTGACATATGG + Intronic
1146652149 17:34613532-34613554 GAAAACCCTATCCTGGAGTCAGG - Intronic
1147481969 17:40774361-40774383 AAAAACTTTATCCTGAAATAAGG - Intergenic
1148209895 17:45801909-45801931 AAGAACCCTCCCCGGGAAAATGG + Intronic
1151515850 17:74594993-74595015 ATAAACCCTACACTGGTTTAGGG - Intergenic
1154532529 18:15362172-15362194 CCAAACCCAGCCCTGGAATAAGG - Intergenic
1155643635 18:28050600-28050622 AAAAATCTTACTCTGAAATATGG - Intronic
1156068996 18:33181928-33181950 AAACACCATACCGTGTAATAAGG + Intronic
1158372876 18:56829494-56829516 ATCAAGCCTACCCTGGAAAATGG - Intronic
1159638944 18:70840611-70840633 AAAAGCCCGACCCTTGAAAAAGG + Intergenic
1160045792 18:75386192-75386214 AAAAGCCCTATCCTGGGAGATGG - Intergenic
1160441868 18:78899231-78899253 TAGAAACTTACCCTGGAATAAGG + Intergenic
1162967740 19:14164036-14164058 GAAACCCCTATCCTGGAATAGGG - Intronic
1163327932 19:16617250-16617272 GAAAACCCTGGCCTGGAATGGGG - Intronic
1164865424 19:31600662-31600684 GAAAACCCTGCCCTGGAGGAAGG + Intergenic
1166023155 19:40051904-40051926 AAAAACCCTATCTTAGTATATGG + Intronic
1166026109 19:40086660-40086682 AAAAACCCTATCTTAGTATATGG + Intronic
1168488314 19:56784650-56784672 AACAAACCTACACTGGAATAAGG + Intronic
925392455 2:3505748-3505770 TGAAACCCTACCCTCTAATATGG + Intronic
925882490 2:8364650-8364672 TCAAACCCAACTCTGGAATATGG + Intergenic
926869710 2:17400671-17400693 AAAAGCCCACCCCTTGAATATGG + Intergenic
926913519 2:17872781-17872803 AGAAACTCTACCCTTGAAGATGG + Intergenic
930010522 2:46934748-46934770 ACAATCCCAATCCTGGAATAAGG + Intronic
933898479 2:86832867-86832889 AAAAACTTTCCCCTGGAAAAGGG - Intronic
938531631 2:132193393-132193415 CCAAACCCAGCCCTGGAATAAGG - Intronic
941053819 2:160765070-160765092 AAAAACCCTAAACTGGAACATGG - Intergenic
942215146 2:173712156-173712178 AAAATGCCTACCCTGATATATGG + Intergenic
942259364 2:174142505-174142527 AAAAACCATACCCTCAAATCAGG - Intronic
945845035 2:214933748-214933770 AAGAAACCTACCATGGAAGAAGG + Intronic
945891131 2:215432545-215432567 ATAAACCCTAACATGAAATATGG + Intronic
947500193 2:230665938-230665960 AAAAAACCCACCCTGGAAACAGG + Intergenic
1171311302 20:24146914-24146936 AAAATTCCTACCCTGGGTTATGG - Intergenic
1173282544 20:41642476-41642498 TAAAACCATATCCAGGAATAAGG + Intergenic
1176764829 21:13006037-13006059 CCAAACCCAGCCCTGGAATAAGG + Intergenic
1177748675 21:25253207-25253229 TGAAACCCTAACCTGCAATATGG + Intergenic
1178112223 21:29379782-29379804 AAAAGCCCTACAGTGGAAAAGGG - Intronic
1180429407 22:15232496-15232518 CCAAACCCAGCCCTGGAATAAGG + Intergenic
1181730667 22:24843994-24844016 AAAAAACCTGCCCTGGAATCAGG - Intronic
949293294 3:2490722-2490744 AAAAATCTCACCCTGAAATATGG + Intronic
949333182 3:2945097-2945119 AAAAACTCTGCCCAAGAATATGG - Intronic
950231489 3:11279729-11279751 AAAAACCCCACCTTGGCTTAAGG + Intronic
951696573 3:25451112-25451134 AAAAACCCTGCCCTAGATTAAGG + Intronic
952979357 3:38722527-38722549 AAAAATTCTTTCCTGGAATATGG + Intronic
954087435 3:48256424-48256446 AAAAGGCCTCCCCTGGAACAGGG - Intronic
955054640 3:55444691-55444713 GCAACCCCTCCCCTGGAATAGGG + Intergenic
956014242 3:64864414-64864436 AAAGATCATACCCTGGAATAAGG + Intergenic
956448806 3:69352660-69352682 AAAAAACCTTCCCTTTAATAAGG + Intronic
957297424 3:78350830-78350852 AACCACGCTACCCTGAAATATGG - Intergenic
957519714 3:81302668-81302690 AAAAGACCTCCCCTGGAAAAAGG - Intergenic
961033628 3:123627262-123627284 AATGACGCCACCCTGGAATAGGG - Intronic
962409544 3:135129182-135129204 AAAACCCTTCCCCTGGAATGGGG + Intronic
963179442 3:142338658-142338680 AAAAACCACACCCTGGAATTGGG - Intronic
965122817 3:164584696-164584718 AAAAACCCTACCCTGGGTAATGG + Intergenic
968323891 3:197795309-197795331 ATGAACCCCACCCTGGCATAGGG + Intronic
968343057 3:197974812-197974834 AAGAACCCTCTCCTGGAATCTGG - Intronic
971521548 4:27558040-27558062 AAAAACCCAGCCCTGGCACAGGG - Intergenic
971655439 4:29338408-29338430 TAATACCCAACCCTGCAATAGGG + Intergenic
974281928 4:59806471-59806493 AAAAAACATACCTAGGAATATGG - Intergenic
976224547 4:82785176-82785198 AAATACACTACTCTGGCATAAGG + Intronic
976359644 4:84162329-84162351 AAAAACCCTACTCAGGTACAGGG + Intergenic
976474411 4:85467432-85467454 AAAAACCTTAAACAGGAATATGG + Intergenic
981140872 4:141267499-141267521 AAAAATCCTAACCTGAACTAAGG - Intergenic
982430039 4:155312549-155312571 AAAAACCCTACCCTTTCAAATGG + Intergenic
982443552 4:155463904-155463926 ACACACCCTACCCAGGAACAGGG - Intergenic
984963002 4:185115895-185115917 TAATCCCCTTCCCTGGAATATGG + Intergenic
990063473 5:51681727-51681749 CAAAACTCTTCCCTGCAATATGG + Intergenic
991542774 5:67748204-67748226 AAAAAACCTTCCCTGGAAGGAGG + Intergenic
993485209 5:88475655-88475677 AAAACCACTAACCTGGAACATGG + Intergenic
993614474 5:90094752-90094774 AAAAACCCCACTCTCGACTATGG - Intergenic
994338129 5:98593414-98593436 AAAAATCTTACTCTGAAATATGG + Intergenic
994645785 5:102467263-102467285 AAAAACATTATCCTGGTATAAGG + Intronic
995807167 5:116066071-116066093 AAAAAACCTATAATGGAATATGG - Intergenic
996072365 5:119147844-119147866 AAAACCACTGCTCTGGAATAAGG - Intronic
996797746 5:127368297-127368319 GAAAACTCTACCCTGGACCAGGG + Intronic
999833040 5:155338885-155338907 AAAAACCCAAACCTGGTTTATGG + Intergenic
1002804999 6:564815-564837 AAAAACCCTACCCTGTGAAAAGG + Intronic
1003967046 6:11262625-11262647 AAGAACCCTATTCTGGGATAGGG - Intronic
1005246666 6:23893466-23893488 AAAAATGCTACCCTAAAATATGG + Intergenic
1005850537 6:29817458-29817480 GAAAACCCACCCATGGAATATGG - Intergenic
1006482316 6:34306521-34306543 AAAAATCCTTTCCTGGAATGTGG + Intronic
1009027688 6:58019643-58019665 AATAATCCTACCATGGAAAATGG - Intergenic
1009203224 6:60771120-60771142 AATAATCCTACCATGGAAAATGG - Intergenic
1011941703 6:92850599-92850621 AAAAATCCTAACCTGGAGGAGGG + Intergenic
1014717849 6:124887088-124887110 ACAAAATCTACCCTGGCATAAGG + Intergenic
1015867769 6:137744578-137744600 AAAAACACCACTCTAGAATAAGG + Intergenic
1021128580 7:16883201-16883223 ATAAACAATACCCTGGATTAAGG - Intergenic
1022043445 7:26602624-26602646 AAAAGCCCTACACTGTAATGTGG - Intergenic
1022482429 7:30752741-30752763 AAAAGCCCTGCCCTGGGACAAGG + Intronic
1028590640 7:92490131-92490153 AAAAAACCTACCCTGTGTTATGG - Intronic
1030385831 7:108867115-108867137 AAGAACCCCACCCTTGGATAAGG + Intergenic
1031781301 7:125969494-125969516 AAAAAAAATACCCTGGAATATGG + Intergenic
1032186176 7:129728489-129728511 AAAAAACCAATCCTGGAATGAGG + Intronic
1036093991 8:5702957-5702979 AAAACCACTACCCTGAAATCTGG - Intergenic
1036495506 8:9266711-9266733 CAAAACCTTGCCCTGGAAGAGGG + Intergenic
1036524118 8:9519172-9519194 AACAACCCCACCCTGGGATCAGG - Intergenic
1036799168 8:11776981-11777003 GGAAACCCTACACTGGAACAGGG - Intronic
1038964876 8:32561139-32561161 AAAATCCTTACCCTGAAATCTGG - Intronic
1039386593 8:37141626-37141648 AAGTACCCTGCCCTGGAAAATGG + Intergenic
1039690991 8:39864558-39864580 AAAAATCCTACTCTCGAAAAAGG + Intergenic
1040824975 8:51611044-51611066 AATGACCCTGCCCTGGAATGTGG - Intronic
1041684794 8:60633401-60633423 GAAACTCCTACCCTGTAATAAGG + Intergenic
1042955845 8:74250003-74250025 TAAAACACTGCCCTGGAATGTGG - Intronic
1046405322 8:113765144-113765166 AAAAATCTTATCCTGGAAAATGG + Intergenic
1048970881 8:139644454-139644476 AAAAACCCTACCCTGGAATATGG - Intronic
1049248839 8:141577454-141577476 AGAAACCCTCCCCTGGAATTTGG + Intergenic
1050627145 9:7517373-7517395 AACAACTCTGCCCTGGAAAAGGG - Intergenic
1051047781 9:12895752-12895774 AAAAACCATATCATGGAAAATGG - Intergenic
1056139827 9:83665019-83665041 AATAAGCCTACCCTGGGATGAGG + Exonic
1056847474 9:90053470-90053492 AAAAGCCCTATCCTCAAATAAGG + Intergenic
1057280702 9:93709084-93709106 AGAAACCCTACCCTGGAATGGGG + Intergenic
1060296588 9:122347368-122347390 AAAAACCCAACCCTGTGCTACGG + Intergenic
1061834152 9:133317999-133318021 AAAAGCCCTGCCCTGAAAGATGG + Intergenic
1192571094 X:72205789-72205811 ACAAACCCTGCTCTGGAATTAGG + Exonic
1193866287 X:86734487-86734509 ATAAATTCTACCCTGGAATAGGG + Intronic
1194787099 X:98099675-98099697 AATTCCCCTACCCTTGAATATGG - Intergenic
1195143427 X:101987403-101987425 AAAAACCCTATCTTCAAATAAGG - Intergenic
1197770485 X:130086304-130086326 AGAAACCCTATGCTGGAATCAGG - Intronic
1201706967 Y:16948268-16948290 AAAAACCCCTTCCTGGAATCTGG + Intergenic