ID: 1048970887

View in Genome Browser
Species Human (GRCh38)
Location 8:139644477-139644499
Sequence CAGCCAGAGGTGGTTCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048970873_1048970887 30 Left 1048970873 8:139644424-139644446 CCATTAATGGATCACAGCCCACG 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1048970887 8:139644477-139644499 CAGCCAGAGGTGGTTCAGGGTGG No data
1048970875_1048970887 13 Left 1048970875 8:139644441-139644463 CCCACGGCTGAAACCATATTCCA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1048970887 8:139644477-139644499 CAGCCAGAGGTGGTTCAGGGTGG No data
1048970882_1048970887 -7 Left 1048970882 8:139644461-139644483 CCAGGGTAGGGTTTTTCAGCCAG 0: 1
1: 0
2: 1
3: 13
4: 125
Right 1048970887 8:139644477-139644499 CAGCCAGAGGTGGTTCAGGGTGG No data
1048970876_1048970887 12 Left 1048970876 8:139644442-139644464 CCACGGCTGAAACCATATTCCAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1048970887 8:139644477-139644499 CAGCCAGAGGTGGTTCAGGGTGG No data
1048970881_1048970887 0 Left 1048970881 8:139644454-139644476 CCATATTCCAGGGTAGGGTTTTT 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1048970887 8:139644477-139644499 CAGCCAGAGGTGGTTCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048970887 Original CRISPR CAGCCAGAGGTGGTTCAGGG TGG Intronic
No off target data available for this crispr