ID: 1048970888

View in Genome Browser
Species Human (GRCh38)
Location 8:139644478-139644500
Sequence AGCCAGAGGTGGTTCAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048970882_1048970888 -6 Left 1048970882 8:139644461-139644483 CCAGGGTAGGGTTTTTCAGCCAG 0: 1
1: 0
2: 1
3: 13
4: 125
Right 1048970888 8:139644478-139644500 AGCCAGAGGTGGTTCAGGGTGGG No data
1048970875_1048970888 14 Left 1048970875 8:139644441-139644463 CCCACGGCTGAAACCATATTCCA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1048970888 8:139644478-139644500 AGCCAGAGGTGGTTCAGGGTGGG No data
1048970876_1048970888 13 Left 1048970876 8:139644442-139644464 CCACGGCTGAAACCATATTCCAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1048970888 8:139644478-139644500 AGCCAGAGGTGGTTCAGGGTGGG No data
1048970881_1048970888 1 Left 1048970881 8:139644454-139644476 CCATATTCCAGGGTAGGGTTTTT 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1048970888 8:139644478-139644500 AGCCAGAGGTGGTTCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048970888 Original CRISPR AGCCAGAGGTGGTTCAGGGT GGG Intronic
No off target data available for this crispr