ID: 1048977457

View in Genome Browser
Species Human (GRCh38)
Location 8:139680884-139680906
Sequence CAGGCTGCTGGGCAGGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 3, 2: 16, 3: 73, 4: 521}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048977457 Original CRISPR CAGGCTGCTGGGCAGGACCA TGG (reversed) Intronic
900177004 1:1295402-1295424 CAGGTGGCAGGGCAGGGCCAAGG - Intronic
900501047 1:3004822-3004844 CAGTCTGGTGGGCAGGAGCAGGG - Intergenic
900507745 1:3038208-3038230 CAGGCTGCTGGGCAGGAAGGGGG - Intergenic
900518610 1:3095112-3095134 CAGGCAGGTGGGCAGGGCCCTGG - Intronic
900520934 1:3105227-3105249 GAGGCTGGTGGGCAGGACAGTGG - Intronic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900628069 1:3618547-3618569 CAGGCTGCGGGGAAGTAGCAGGG - Intergenic
900645653 1:3707557-3707579 CAATCTGCTGAGCAGCACCATGG + Exonic
901195586 1:7438198-7438220 CAGGCAGCTGGGCAGGGCCTGGG + Intronic
901820919 1:11828886-11828908 CAAGCTGCTCGGCAGGGCCACGG - Intronic
901884026 1:12210179-12210201 CAGGCTGGAGGACAGGACCATGG - Intergenic
902737769 1:18412617-18412639 CAGGCAACTGGGCAGGTCCCAGG - Intergenic
903361452 1:22779755-22779777 GAGGCGGTTGGGCTGGACCAGGG + Intronic
904384851 1:30134581-30134603 CAGGATTCAGGGCAGGAGCAGGG - Intergenic
904808874 1:33150662-33150684 CAGGCAGCTTGTCAGAACCAGGG + Intronic
905017584 1:34788142-34788164 CAGGCTGTGGGCCAGGACCATGG + Intronic
905196885 1:36286801-36286823 CAGGCTGCCGGGGATAACCAGGG + Exonic
905734153 1:40314796-40314818 CAGACTGCAGGGCAGGAGAACGG + Intronic
905789578 1:40783148-40783170 CGGGCTGCTAGGCAGCATCAGGG - Intergenic
905890810 1:41517195-41517217 CTGCCTGGTGGGCTGGACCAGGG - Intronic
906051828 1:42880800-42880822 CAGGATTCTGGGCAGGTCCCCGG - Intergenic
907249585 1:53129386-53129408 AAGGCTACAGGGCAGGAACAGGG - Intronic
907718734 1:56951966-56951988 CAGGCTGTCAGGCCGGACCATGG + Intronic
908257424 1:62314490-62314512 CGGGCTGCTGGGCAGAAACCAGG + Intronic
909391182 1:75124612-75124634 CAGGGTGATGGTCAGGCCCAAGG + Intergenic
910243094 1:85109579-85109601 CAGGATGCAGTGCAGGCCCAGGG + Intronic
911036038 1:93549317-93549339 CATGCTGCTGGGGTGGCCCACGG - Exonic
912318996 1:108692770-108692792 CAGGATGTTGGTCAGGATCATGG - Exonic
912391241 1:109304619-109304641 CCTCCTGCTGGGCAGTACCACGG - Intronic
912391505 1:109306378-109306400 CCTCCTGCTGGGCAGTACCACGG - Intronic
913515639 1:119603414-119603436 GAGGCTGCTGGGGAGGACATGGG - Intergenic
915523136 1:156459790-156459812 CAGCCAGCTGGGCAGGACAAGGG + Intergenic
915594420 1:156888072-156888094 CAGGCTGGTGGGCAGGCCAAAGG + Intergenic
916414737 1:164581604-164581626 CAGCCTGGTATGCAGGACCAGGG + Intronic
919763039 1:201110370-201110392 CAGGCTGCTGGACAGGCTCATGG + Intronic
919817247 1:201449197-201449219 CAGGCTGCCCAGCAGGACAAGGG - Intergenic
919883570 1:201916739-201916761 CAGGCTGCGAGGCAGGTCCTGGG - Intronic
922152230 1:223016460-223016482 CAGCCTGCTGGGCTGGTCCTAGG + Intergenic
922740951 1:228013983-228014005 CAGGCAGGTGTGGAGGACCAGGG - Intronic
1062973039 10:1662786-1662808 CAGGGTGCTGGGCAGGAAGTTGG + Intronic
1064001445 10:11666755-11666777 CAGCCTGCGGGGCAGGACACTGG + Intergenic
1064145950 10:12826617-12826639 CAGGCTGCAGGGCTGCTCCATGG - Intronic
1064195217 10:13238777-13238799 CATGCAGCTGGGCAAGTCCAGGG + Intergenic
1064366861 10:14716279-14716301 CAAGATGTTGGCCAGGACCATGG + Intronic
1064901829 10:20303507-20303529 CTGGCTTCTGAGCAGGACAAAGG + Intergenic
1066422719 10:35277408-35277430 CAGGTCTCTGGGCAGGATCAGGG - Intronic
1067917987 10:50421476-50421498 CAGCCTGCTAGGCAGGACTTGGG - Intronic
1068303716 10:55177446-55177468 CAGGCTGCTGGACTGGATCTTGG - Intronic
1069533924 10:69239377-69239399 GTGGCTGCTGGGGAGGCCCAGGG - Intronic
1069773670 10:70914737-70914759 CAGGTTGCTGGTCAGCACCCGGG + Intergenic
1070104028 10:73414792-73414814 CAGGTTGCTGGGCACCACCCGGG - Intergenic
1070845682 10:79521238-79521260 CAAGCAGGTGGGCAGGACCCAGG + Intergenic
1070890793 10:79941234-79941256 CAGGCTGGAAGGCAGGAGCATGG - Intronic
1070928111 10:80239076-80239098 CAAGCAGGTGGGCAGGACCCAGG - Intergenic
1072682442 10:97516940-97516962 CTGACTGCGGGGCAGGGCCATGG + Intronic
1072728161 10:97827547-97827569 CAGGGTGCTGGCAAGGGCCAGGG - Intergenic
1073099128 10:100997884-100997906 CCGGCTGCTGGGCAGGGCTGGGG + Intronic
1073590255 10:104750500-104750522 TAGACTGGAGGGCAGGACCAAGG - Intronic
1075078555 10:119367953-119367975 CAGGCGCCTCGGCAGGGCCAGGG + Intronic
1076183991 10:128432278-128432300 CAGGCAGCTGGGCAGATGCATGG + Intergenic
1076273678 10:129178386-129178408 CAGGATGCTGGGCAGGACCATGG - Intergenic
1076557092 10:131333590-131333612 CAGGCAGCCGGGCATGACCTTGG - Intergenic
1076706460 10:132304767-132304789 CAGGCAGTGAGGCAGGACCAGGG - Intronic
1076915092 10:133419450-133419472 TAGGCTGCAGGTCAGCACCAGGG - Intronic
1077010691 11:377884-377906 CAGGCTGGTGGGCAGGAGTGGGG + Intronic
1077198554 11:1293661-1293683 CAGGGTGCGGGAGAGGACCAAGG + Intronic
1077412168 11:2408693-2408715 CAGCCTGCGGGGCAGGAGGAGGG + Intronic
1077810866 11:5635358-5635380 CGGGATGCTGGGCAGGAGAATGG - Intronic
1077817190 11:5697377-5697399 CAGGAATCTGGGCAGGACCCTGG + Intronic
1077915206 11:6607123-6607145 GAGGCTGCTGGCCCAGACCACGG + Intronic
1078402198 11:11038204-11038226 CAAACTGCTGGGCAGGATCCAGG + Intergenic
1078666474 11:13329806-13329828 CAGCCTGCTGGGCTGGGCAACGG + Intronic
1078930728 11:15910538-15910560 CAGGCTGCTGGCCAGGAGCAGGG - Intergenic
1078934738 11:15941033-15941055 CAGGCTGCTGGGCAGGCAGAGGG - Intergenic
1079005524 11:16789057-16789079 CAGGCAGCGGGGCAGGGACAGGG - Exonic
1079117985 11:17652766-17652788 GAGGCTGCTGGGCTGAGCCAGGG + Intergenic
1079398620 11:20087226-20087248 CACTCAGCTGTGCAGGACCATGG + Intronic
1081731776 11:45376783-45376805 ACGGCTGCAGGGCTGGACCAGGG - Intergenic
1081931672 11:46875768-46875790 CAGGCTCCTGGGAAGCAGCAGGG + Intronic
1083308877 11:61774629-61774651 CAGGCTGAGGGGCAGGCACAGGG - Intronic
1083432339 11:62620546-62620568 CAGGGGGCTGGGCAGGGGCAGGG + Exonic
1083770465 11:64864205-64864227 CAGGCTGGAGGCCAGGACCCCGG - Intronic
1083840612 11:65302146-65302168 CTGGCTGCTGGGCAGAAGCCTGG - Intronic
1083897293 11:65626277-65626299 CAGGAAGGAGGGCAGGACCAGGG - Intronic
1084198589 11:67540712-67540734 CAGGCTGCTGGGAATGACCCAGG + Intergenic
1084603107 11:70158324-70158346 CAAGCTGTTGGGCTGGACGAGGG - Intronic
1084768482 11:71327433-71327455 CAGGCAGCTCGGCATGAACAGGG - Intergenic
1084891052 11:72237429-72237451 CAGGCTGGGGGGCAGGAAGATGG - Exonic
1085388681 11:76171354-76171376 CAGGCGGCTGGTCAGGACTCAGG - Intergenic
1085713700 11:78853429-78853451 CAGGCTTCTGAGCTGGCCCAGGG + Intronic
1086002484 11:81999496-81999518 CAGGCTGCTAGGCTGGACCCTGG + Intergenic
1086924860 11:92629464-92629486 CAGGCTGCTAGGCTGGAGTATGG + Intronic
1088287240 11:108201533-108201555 CAGGTTTCTGGGCTGGACCTTGG - Intronic
1088691748 11:112334392-112334414 AAGGCTGCAGGGCAGGATCTTGG - Intergenic
1089201837 11:116729378-116729400 AAGGCTTCTGGACAGGGCCAAGG - Intergenic
1089257472 11:117201464-117201486 CAGGCTCCTGGTAATGACCAGGG - Intronic
1089261987 11:117229782-117229804 GAGGCAGGTGGGCAGGCCCAGGG + Exonic
1090650567 11:128802458-128802480 CAGGCTGCTGGGATGGACGTTGG + Intronic
1090806898 11:130208589-130208611 CAGGCAGATGGGCCGCACCATGG - Exonic
1090920678 11:131203648-131203670 CAAGCTGCAGGGCAGCTCCACGG + Intergenic
1091568461 12:1663967-1663989 CAAGCTGCTGAGATGGACCATGG + Intergenic
1093262095 12:16950848-16950870 CAAGCAGCTGGGCTGGCCCAGGG - Intergenic
1094100880 12:26761059-26761081 CAGGCTTCAGGCCAGGCCCATGG + Intronic
1094273802 12:28646031-28646053 CAGGCTGCTGTGCTGGCCCGCGG + Intergenic
1094526230 12:31233140-31233162 CTGGCTGTAGGGCAGGAACAGGG - Intergenic
1094691428 12:32773252-32773274 CAAGCTGCAGAGCAGGACAAGGG - Intergenic
1096572927 12:52534021-52534043 CAGGCTGCAGGCCAGGAGCTGGG + Intergenic
1096627282 12:52903654-52903676 CAGGCCGCTGGGGCGGAGCAGGG + Intronic
1096778770 12:53979987-53980009 CAGGTTGAGGGGCAGGTCCAGGG - Intergenic
1097180998 12:57171901-57171923 CAGGCTGGAGGGCAGGGCCAGGG - Intronic
1098092617 12:66920363-66920385 CAGGTTGATGGCAAGGACCAGGG - Intergenic
1098158536 12:67624819-67624841 CAGGATGGTGGGTAAGACCAGGG - Intergenic
1100282028 12:93127331-93127353 AAGGTTGCAGGGCAGGAGCAAGG + Intergenic
1100608351 12:96170103-96170125 CAGGGTGTTGGGCAGGGCCCAGG - Intergenic
1101642245 12:106595475-106595497 CAGGCTGCTGAGGATGCCCACGG + Intronic
1101922273 12:108942633-108942655 AAGGCTGCTGGACAGGAGCTAGG - Intronic
1101991442 12:109488802-109488824 CAGTCTGATGGTCAGCACCAAGG - Intronic
1102512048 12:113422423-113422445 CAGGCTGGAGGGCAGGAGCTGGG + Exonic
1103567753 12:121825394-121825416 GAGCCTGCTGGGCTGGGCCACGG + Intronic
1103740097 12:123085250-123085272 GGGGCTCCTGGGCAGGACCTGGG + Intronic
1104647724 12:130509049-130509071 CAGGCTGGTGGGGAGGGCCGGGG - Intronic
1104815783 12:131644675-131644697 CAGGCCCTTGGGGAGGACCAAGG + Intergenic
1104935851 12:132364065-132364087 CTGGCTGCTGGCCAGGAACTGGG - Intergenic
1105707472 13:22977132-22977154 CAGGGTGCAGGGGAGGAACAAGG + Intergenic
1107337764 13:39373593-39373615 AAGGCAGCTGGTCAGGACCCAGG - Intronic
1107447777 13:40483731-40483753 CAGGCTTCTTGCCAGGACCCAGG - Intergenic
1108847445 13:54694671-54694693 TAGGCTGCTGGGCTGGACCTTGG + Intergenic
1111975819 13:94966556-94966578 AGGGCTGCTGGCCAGAACCATGG - Intergenic
1112196031 13:97227264-97227286 CAGACAGATGGGCAGGTCCAAGG + Intronic
1112286282 13:98107306-98107328 CAGGCTGCTGCACAGGACCCTGG + Intergenic
1113616110 13:111681665-111681687 CAGGCTGCAGGGCAGCGTCAGGG - Intergenic
1113621578 13:111766558-111766580 CAGGCTGCAGGGCAGCGTCAGGG - Intergenic
1114446471 14:22792504-22792526 CAGGCTGGTGTGCAGTAGCATGG - Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1117456998 14:55907899-55907921 CATGCTGCTGGAGAGGAACATGG - Intergenic
1118254748 14:64195900-64195922 CAGGCTGATGGGAAGGAAAATGG - Intronic
1118632894 14:67722496-67722518 CAGGCTGCTGCTCAGCACCCAGG + Exonic
1118725065 14:68623166-68623188 CAGGTTTCTGGGCAGGATTATGG + Intronic
1119932079 14:78557093-78557115 CAGGCTGCAGTGCATGATCATGG + Intronic
1120473837 14:84961702-84961724 CAAGCTGCTGTGCAGCTCCATGG + Intergenic
1121525239 14:94614882-94614904 CAGTCTGCTGGACAGGTTCACGG + Exonic
1121733888 14:96204900-96204922 CAGGCTGCCCCGCAGTACCAGGG + Exonic
1121789254 14:96686712-96686734 CAGCATCCTGGGCAGGACTATGG - Intergenic
1122281350 14:100624281-100624303 CAGGCTGGCGGGCAGGAACCTGG + Intergenic
1122642596 14:103169035-103169057 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1122858656 14:104572270-104572292 GAGGAAGCTGGGCAGGGCCAAGG - Intronic
1122930512 14:104931240-104931262 CAGACTGCTGGGCGAGGCCAAGG + Intronic
1122940951 14:104981161-104981183 CAGGCTGAGGGGCAGGACCAGGG - Intergenic
1123113157 14:105882337-105882359 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123115507 14:105892489-105892511 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1123833014 15:24160970-24160992 CACGCTGCTGGACAGCACCAGGG + Intergenic
1123839737 15:24236032-24236054 CACGCTGCTGGACAGCACCAGGG + Intergenic
1123849600 15:24341654-24341676 CACGCTGCTGGACAGCACCAGGG + Intergenic
1123852801 15:24377735-24377757 CACGCTGCTGGACAGCACCAGGG + Intergenic
1123857303 15:24426757-24426779 GAGGCTCCTGGGCTGGGCCAGGG + Intergenic
1123861933 15:24477285-24477307 GAGGCTCCTGGGCGGGGCCAGGG + Intergenic
1123868654 15:24549153-24549175 CACGCTGCTGGACAGCACCAGGG + Intergenic
1124067190 15:26355183-26355205 AGGGCTGCTGGGGAGGACCCAGG - Intergenic
1125462583 15:39920647-39920669 CAGGCTGCTGGGGACGCTCAGGG - Exonic
1125604870 15:40934509-40934531 CAAGCAGCTGAGCAGGGCCAGGG - Intronic
1125713711 15:41806755-41806777 CACCCTGCTGGGCAGGGTCAGGG + Intronic
1125751724 15:42033757-42033779 CAGGCTGCGGGGCGGCAGCAGGG - Intronic
1126881922 15:53108503-53108525 CAGGCTGATGGGAAGTTCCAAGG - Intergenic
1127775304 15:62259998-62260020 CAGGCCGCTGGCCAGATCCATGG + Intergenic
1127808838 15:62545671-62545693 CAGGCTGCTGTCCAAGAACAGGG - Intronic
1128110652 15:65074153-65074175 CAGGCTGGGGTACAGGACCAGGG - Intronic
1128279395 15:66382426-66382448 CAGGCTGGTGTGCAAGATCATGG + Intronic
1128529137 15:68432046-68432068 CAGGCCCCTGGGCAGGTCCATGG + Exonic
1128716766 15:69914296-69914318 AGGGCTGCAGGGCAGGAGCAGGG - Intergenic
1128811777 15:70578323-70578345 CAGAAGGCTCGGCAGGACCATGG - Intergenic
1129248854 15:74297101-74297123 CTGTCTGCTGGGCATGCCCAGGG + Intronic
1129543339 15:76369821-76369843 CAGGCTGCGGGGCAAGGGCAGGG - Intronic
1129736953 15:77971976-77971998 CAGGCTGTTGGGCGGCACCCTGG - Intergenic
1129849117 15:78781645-78781667 CAGGCTGTTGGGCAGCACCCTGG + Intronic
1130531209 15:84748766-84748788 CAGGCTGCAGGGCCGGGCCCCGG - Intronic
1130957710 15:88639136-88639158 CAGGCTGCGGGGCAGGCCAGAGG + Intronic
1131108606 15:89750675-89750697 CAGGCTGAGGGGCAGGGGCAGGG - Exonic
1131453094 15:92562610-92562632 CAAGCAGCAGGGCAGGAACAGGG - Intergenic
1132381417 15:101369175-101369197 CAGGCTGCTGGGCAGTGCTGTGG + Intronic
1132381724 15:101370858-101370880 CAGGCTGCTGGGCAGTGCTGTGG + Intronic
1132628165 16:902205-902227 CCGGCTGCTGCGCTGGCCCAGGG - Intronic
1132676456 16:1123198-1123220 CAGGCTGTGGGGCAGGCTCAGGG + Intergenic
1132710646 16:1265620-1265642 CAAGCTGCTGCCCAGGCCCATGG + Intergenic
1132765989 16:1534422-1534444 CTGGCTGGTGGACAGGACCCGGG + Exonic
1132779407 16:1614437-1614459 CGGGCTGGTGGGCAGGGCCGGGG + Intronic
1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG + Intronic
1133201611 16:4207457-4207479 CAGGCTCCTCGCCAGGCCCAGGG + Intronic
1133284455 16:4684092-4684114 CAGGATGCGGGCCAGGGCCATGG + Intronic
1133349565 16:5092507-5092529 CATGCTTCTGGGGAGGACTAGGG + Intronic
1133417632 16:5618885-5618907 GTTGCTGCTGGGCAGGATCATGG + Intergenic
1134167577 16:11942735-11942757 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1134493124 16:14710977-14710999 CAAGCAGGTGGGCAGGACCCAGG - Intronic
1134498505 16:14750101-14750123 CAAGCAGGTGGGCAGGACCCAGG - Intronic
1134525057 16:14936731-14936753 CAAGCAGGTGGGCAGGACCCAGG - Intronic
1134547838 16:15124188-15124210 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1134555269 16:15158779-15158801 GAGGCTGTTGGGCAGGAAAATGG - Intergenic
1134582071 16:15378984-15379006 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1134712647 16:16335218-16335240 CAAGCAGGTGGGCAGGACCCAGG - Intergenic
1134954180 16:18373475-18373497 CAAGCAGGTGGGCAGGACCCAGG + Intergenic
1135182799 16:20290232-20290254 CAGGCTGCAGTGCAGCAGCAGGG + Intergenic
1135313004 16:21420387-21420409 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1135365928 16:21852667-21852689 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1135445887 16:22518495-22518517 CAAGCAGGTGGGCAGGACCCAGG - Intronic
1136114584 16:28086754-28086776 CGGGCAGCTGGGCCGCACCAGGG + Intergenic
1136194586 16:28643064-28643086 CAAGCAGGTGGGCAGGACCCAGG - Intronic
1136255640 16:29037122-29037144 CAAGCAGGTGGGCAGGACCCAGG - Intergenic
1136293347 16:29288714-29288736 CTTGGTGCTGGGCAGGGCCAGGG + Intergenic
1136309674 16:29399115-29399137 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1136323117 16:29500895-29500917 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1136437801 16:30240863-30240885 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1136547751 16:30965184-30965206 CAGGCTGCTGTGCTGGGCGAAGG - Exonic
1137343875 16:47636807-47636829 CAGGCTCCTGGGCGGGTCCCTGG + Intronic
1137773443 16:51036693-51036715 CAGGTGGCAGGGCAGGACCCAGG + Intergenic
1138201402 16:55091391-55091413 GAGGCTGCAGGGCAGAGCCAGGG + Intergenic
1138515354 16:57533043-57533065 AAGCCTGTTGGGCAGGGCCAGGG + Intronic
1138574546 16:57899260-57899282 CAGGTAGCTGGCCAGGACAAGGG - Intronic
1138586783 16:57975867-57975889 CAGGATGGTGGGCAGGCCCCAGG + Intergenic
1139218424 16:65152790-65152812 CAGGCTACTGAGCAAAACCAGGG + Intergenic
1139955111 16:70689482-70689504 CAGCCTGCTGGGCAGGACCAGGG + Intronic
1140266700 16:73427538-73427560 CAGGATGCTGTGCAAGACCTAGG + Intergenic
1140365317 16:74376426-74376448 CAAGCAGGTGGGCAGGACCCAGG - Intergenic
1140928105 16:79601382-79601404 CAGCCTTCTGGGCAGGCGCATGG - Intergenic
1141461097 16:84179327-84179349 GAGGCAGCAGGGCAGGACCTCGG - Exonic
1141487464 16:84350321-84350343 CAGACTGCGGGGCAGGGACAGGG + Intergenic
1141669852 16:85485979-85486001 CAGGCTTCTGGGCCAGAACAGGG - Intergenic
1142099229 16:88262721-88262743 CTTGATGCTGGGCAGGGCCAGGG + Intergenic
1142178872 16:88657633-88657655 CGGGCAGGTGGGCAGGAGCAGGG - Intronic
1142283121 16:89159850-89159872 CAGGCAGGTGGGCAAGGCCACGG + Intergenic
1142395200 16:89828202-89828224 CGGGGTGCTGGGCAGGACCGGGG - Intronic
1142409915 16:89910769-89910791 CAGGGAGCAGGGAAGGACCAAGG + Intronic
1142537782 17:631783-631805 CAGGTTGATGAGCAGGACCCAGG + Intronic
1142752266 17:1996059-1996081 CAGGCTGCCTGGCAGGAGAAGGG + Intronic
1142757589 17:2025071-2025093 GGGGCTGCCGGGCAGCACCACGG - Exonic
1143572758 17:7770684-7770706 CAGGCTGCAGAGTGGGACCAAGG + Intronic
1143577636 17:7803917-7803939 CAGGCAGGTGGGCTGGCCCAGGG - Intronic
1143611529 17:8020542-8020564 CAGGCTGCTGGAAAAGACCAGGG + Intergenic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1144215131 17:13048747-13048769 CAGCCTGCTGGGTAAGAGCACGG - Intergenic
1144624350 17:16837150-16837172 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1144732663 17:17537489-17537511 CAGGCTGCTGGGCACGGGGATGG - Intronic
1144882077 17:18435570-18435592 CAGGCTTCAGGGCAGGAGGAAGG - Intergenic
1144954329 17:19011593-19011615 CAGGAGGCTGGGGAGGAGCATGG + Intronic
1145012723 17:19378814-19378836 CGGGCTGGGGAGCAGGACCAGGG - Intronic
1145150156 17:20508816-20508838 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1145249498 17:21289505-21289527 AGGGCTGCTGGGCAGCAGCATGG + Intronic
1145275237 17:21425112-21425134 CAGGCAGATGGGGAGGACTAAGG + Intergenic
1145313090 17:21711009-21711031 CAGGCAGATGGGGAGGACTAAGG + Intergenic
1145711514 17:26982823-26982845 CAGGCAGATGGGGAGGACTAGGG + Intergenic
1145840944 17:27993856-27993878 CAAGCTGTTGGCCAGGAACATGG + Intergenic
1146162087 17:30565461-30565483 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1146446529 17:32936894-32936916 GAGGCTGCTGGCCTGGGCCAGGG - Intronic
1147578486 17:41615871-41615893 CAGGCTTCAGGGCAGGAGGAAGG + Intronic
1148142475 17:45338470-45338492 CAGGCTGCTGGAAAGGGACATGG - Intergenic
1148873944 17:50675603-50675625 GAGGCAGCTGGTCAGGCCCAGGG - Intronic
1150003481 17:61456019-61456041 CAGGCTGGAGGGCAGGGCCCAGG - Intronic
1150135368 17:62692455-62692477 CAGGCGCGTGGGCAGGGCCAGGG + Exonic
1150387875 17:64775117-64775139 CAGGCTACTGGGCAAGGCCAGGG - Intergenic
1150452304 17:65279114-65279136 AAGGCTGCTGATCAGGACCCGGG - Intergenic
1150855229 17:68745830-68745852 CAGGCTGCTGGACAAGCACAAGG + Intergenic
1151308599 17:73279874-73279896 GGCTCTGCTGGGCAGGACCAGGG - Intergenic
1151344107 17:73491255-73491277 CAGGCTGCTTTGCTGGGCCAGGG - Intronic
1151491699 17:74435507-74435529 CTGGCTGCTGGGCAGCAGCATGG + Intronic
1151829260 17:76540152-76540174 CAGGGTGCTGAGCAGGAAAAGGG - Exonic
1152208771 17:78991632-78991654 CAGGATGCTGGGCATGCGCACGG - Intergenic
1152264707 17:79287598-79287620 CAGGCAGCTGGGCCAGGCCAGGG + Intronic
1152615367 17:81335398-81335420 CACTATGCTGGGCAGGAGCAGGG + Intergenic
1152726308 17:81948425-81948447 CAGGCTGTCCTGCAGGACCAGGG - Intergenic
1154118803 18:11634742-11634764 CAAGCAGGTGGGCAGGACCCAGG + Intergenic
1154241329 18:12657171-12657193 CAGGCCGCTGGCCCGGAGCAGGG + Intronic
1155123213 18:22843601-22843623 CAGACTGCAGTGCAGTACCAAGG - Intronic
1155300732 18:24426729-24426751 GCGGCTGCAGGGCAGGTCCAGGG + Exonic
1155407632 18:25506636-25506658 CAGGATATTGGGCATGACCATGG + Intergenic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1156595717 18:38545471-38545493 CTAGCTGCTGCACAGGACCATGG + Intergenic
1157246445 18:46058854-46058876 CAGGCAGGTGGCCAGGACCTAGG + Intronic
1157332129 18:46711816-46711838 AAGGCTGCTGAGCCGGGCCATGG - Intronic
1157490560 18:48120858-48120880 GAGGATGCTGGGAAGGAGCAAGG + Intronic
1158283287 18:55851073-55851095 CAGGCTGCTGGGCTGGGCCCTGG - Intergenic
1159211491 18:65327960-65327982 CAGGCTGGAGGGCATGATCATGG + Intergenic
1159331903 18:67005677-67005699 CATGCAGCTGGAGAGGACCATGG - Intergenic
1160749564 19:727520-727542 CAGAGTCGTGGGCAGGACCAGGG - Intronic
1160810906 19:1012570-1012592 CACACTGCAGGGCAGAACCAGGG + Exonic
1160862890 19:1245156-1245178 GAGGCTGGTGGGCAGGGCCAAGG - Intergenic
1160930209 19:1566836-1566858 CAGCCTGCTGGGCAGGCCGGCGG - Intronic
1161035139 19:2080205-2080227 CAGGGTGCTGGGCAGGGCGGGGG + Intronic
1161208286 19:3053600-3053622 CAGGCTGCAGGGGAGGAGGAGGG + Exonic
1161237202 19:3204053-3204075 CAGGCTGCTGCCCCGGCCCACGG - Exonic
1162013132 19:7830140-7830162 CTGGCTGGTGGGCGGGGCCAGGG + Intergenic
1162153969 19:8664364-8664386 CAGGCTGATGGGCAGGAAGTGGG - Intergenic
1162341049 19:10091770-10091792 GAGCCTCCTGGGCAAGACCACGG - Intronic
1162398767 19:10432355-10432377 CGCGCTGCTGGCCAGGCCCAAGG - Intronic
1162858367 19:13487272-13487294 CAGGCTGATGAGTAGAACCAGGG + Intronic
1162926499 19:13932951-13932973 CAGGCCAGTGGGCAGGCCCATGG + Exonic
1163005400 19:14394151-14394173 CAGGCAGCTGGGCAGAGACATGG + Intronic
1163368769 19:16890344-16890366 CAGGTTGCTGGGCACGAAGAAGG - Exonic
1163422972 19:17225407-17225429 CAGGCTGGAGGGCATGATCATGG - Intergenic
1164506784 19:28867478-28867500 CAGTCTGCTGCCCAGGACCAGGG - Intergenic
1165248850 19:34513948-34513970 CAGGGCCCTGGGCAGGTCCAGGG + Intergenic
1165306452 19:35005586-35005608 GAGGCTGCTGGGATGGCCCAGGG + Intronic
1165309678 19:35022633-35022655 CAGGCTTCTGGGCAGGAGTGTGG - Intronic
1165310747 19:35028258-35028280 CAGGGTGTGGGGCAGGACCATGG - Intergenic
1165328347 19:35126813-35126835 CAGGCTGCTGGACAGGCAGAAGG + Intronic
1165569931 19:36767190-36767212 CAGGCTGCAGTGCAGTGCCACGG - Intronic
1165739664 19:38197795-38197817 GGTGATGCTGGGCAGGACCAGGG - Intronic
1167015518 19:46838587-46838609 CAGGATGCTGGCCCGGACCCTGG + Intronic
1167212648 19:48143060-48143082 CATGCTGCTGAGAAGGACCAGGG + Intronic
1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG + Intergenic
1167620699 19:50558817-50558839 GAGGTAGCTGGGCAGGGCCAAGG - Intronic
1168182349 19:54670958-54670980 AAGGCTTCAGGGCAGGACCATGG + Intronic
1168328358 19:55550238-55550260 GAGGCTGGTGGGCAGGACGGAGG - Intergenic
925283179 2:2699085-2699107 CAGGCTTCAGGACAGGAGCACGG + Intergenic
925451463 2:3973096-3973118 CAGACTCCTGGGAAGGAGCAAGG + Intergenic
925812495 2:7714071-7714093 AAGGCTGCTGGGCAGGACAGAGG - Intergenic
926125212 2:10267737-10267759 CAGGCCGCTGGGCTGGAGCCTGG - Intergenic
926560234 2:14408740-14408762 CAGACTGCTCTGCAGGACCCGGG + Intergenic
927878295 2:26673470-26673492 CTGGCTTCTGGGCAGAACCTGGG + Intergenic
927940505 2:27100309-27100331 CAGGCTGGTGGGCAGGGCAGAGG - Exonic
929441452 2:41968405-41968427 CAGGTTGCAGGGCAGGACTCAGG - Intergenic
930529208 2:52570875-52570897 CAGGCTGGTGTCCAGGCCCAAGG - Intergenic
930604239 2:53476104-53476126 TAGGGAGTTGGGCAGGACCAGGG - Intergenic
932050061 2:68389290-68389312 AAGGCTGCTTTGCAGGACCAAGG + Intronic
932293948 2:70608949-70608971 CACGCTGCTGACCAGGCCCATGG + Intronic
932422660 2:71610821-71610843 CAGGCTGGCGGGCAGGCACATGG + Intronic
933595966 2:84283672-84283694 CAGGCTGCTAGGCAACATCAAGG + Intergenic
933761544 2:85675630-85675652 TAGCCTGCTGGGAAGGAGCATGG + Intergenic
933807613 2:86011711-86011733 CTGGCATCTGGGCAGGGCCAAGG + Intergenic
933855377 2:86408729-86408751 CAGGCTGGAGTGCAGTACCATGG - Intergenic
933990056 2:87627649-87627671 CAGGCAGCTGTGCTGGTCCAAGG + Intergenic
934564087 2:95328900-95328922 CAGGCTGCTGGCTGGGGCCAGGG + Intronic
934704968 2:96470874-96470896 CAGGCTGCTGTGCCGCACCCAGG + Intergenic
934716509 2:96547635-96547657 CTGGCTGCTGGGCAGGGCCAGGG - Intronic
936303790 2:111323175-111323197 CAGGCAGCTGTGCTGGTCCAAGG - Intergenic
937127296 2:119482735-119482757 CAGGCATCTGGGTAGGCCCAGGG - Intronic
937258354 2:120570155-120570177 CAGGCTGCTGAGAAGGCCCTGGG + Intergenic
937263621 2:120602004-120602026 GAGGCTGCTGGGCAGGGGCATGG - Intergenic
938083215 2:128381166-128381188 CAGGCTGCTGGACATCCCCATGG + Intergenic
938085275 2:128395838-128395860 CAGGCTGCTGGACAGGCCTTGGG + Intergenic
938742852 2:134248990-134249012 CAGGCTCCTGGCCAGGAGCCTGG - Intronic
939670327 2:145002855-145002877 CATGATGCTGGGCAGCAACAGGG - Intergenic
940020977 2:149155590-149155612 GAGGCTGGTGAGCAAGACCAGGG + Intronic
940818116 2:158319187-158319209 CATTCTGGTGGGCAGGAGCAGGG - Intronic
940851229 2:158689898-158689920 AACTCTGCTGGGCAGGAGCAGGG + Intergenic
941352245 2:164451077-164451099 CAGGCTGCAGTGCAGTAGCATGG - Intergenic
941658473 2:168169980-168170002 AAAGCTGCTGTGCAGGACAATGG - Intronic
941771549 2:169350791-169350813 CAGGCTGCTGAAAAGGACCCAGG - Intronic
942110245 2:172674806-172674828 CAGGCTGCCGGGCCGGGCCCTGG + Intergenic
942183751 2:173404796-173404818 CATGCAGCTGGGCATGAGCAAGG - Intergenic
943383008 2:187173670-187173692 CAGGCTGCTGGGCTGGACCCTGG + Intergenic
944159187 2:196640779-196640801 GATGCTGCTGGCCAGAACCAAGG - Intronic
945195903 2:207237606-207237628 CAGGCTGGTTTGAAGGACCAGGG - Intergenic
946352610 2:219165216-219165238 CGGGCTGCTGGGAAGCCCCATGG - Exonic
947578321 2:231294365-231294387 CAGGTCACTGGGCAGGAGCAAGG + Intronic
947633204 2:231666655-231666677 GAGGCTGCTGGGGAGGGCCAGGG + Intergenic
947859481 2:233348533-233348555 CAGGCTTCTGGGATGGAACATGG + Intergenic
947871476 2:233441197-233441219 GACGCTGCTGGGCAGGGGCAGGG + Intronic
948002988 2:234583392-234583414 TAGGTTGCTGGGAAGGTCCAAGG + Intergenic
948212749 2:236207158-236207180 CAGGATGCAGAGCAGGACCCAGG + Intronic
948374428 2:237512110-237512132 CCGGCAGCTGGGCACGTCCAGGG + Intronic
948577317 2:238963322-238963344 GAGGCTGCTGGTGAGGCCCACGG - Intergenic
948592416 2:239059901-239059923 CAGGCTGGTGGGTGGGTCCAAGG - Intronic
948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG + Intergenic
1168970798 20:1929563-1929585 CACACTGCTGGGCAGGAGCGGGG - Intronic
1169735614 20:8834525-8834547 CAGGCTGCTGGTCAGCACAGTGG + Intronic
1171344136 20:24452836-24452858 CAGGGAGCAGGGCAGGACCTAGG - Intergenic
1172183822 20:33019405-33019427 CAGGCCGCTGGACAAGACGAGGG - Intronic
1172481496 20:35274482-35274504 CAGGATGCAGGGGATGACCACGG - Exonic
1172531623 20:35634952-35634974 CAGGCTGCTGGGCAACTCCTCGG + Intronic
1172637364 20:36418958-36418980 CAGCCTGGTGGGCAGGGCCATGG + Intronic
1173846779 20:46193394-46193416 GAGGGTCCAGGGCAGGACCAGGG - Intronic
1174309018 20:49635942-49635964 CAGGCTCCACGGCAGGACCACGG + Exonic
1174354134 20:49987225-49987247 CAGGCTGCTGGCCGGGCCCCAGG + Intronic
1175273099 20:57748738-57748760 CAGGCAGCTGGGGACGCCCATGG - Intergenic
1175399555 20:58692787-58692809 CGGGCTGCCGGGCAGGGCCGGGG + Exonic
1175562188 20:59939890-59939912 CAGGGCGCTAGGCAGGACCGCGG + Exonic
1175605425 20:60308616-60308638 CTGGCAGCAGGGCAGGACCCTGG - Intergenic
1176074048 20:63240485-63240507 CAGGCTGCTGGGTACCTCCAGGG - Exonic
1176163881 20:63662893-63662915 CAAGCAGCTGGGTGGGACCAGGG + Intronic
1176218279 20:63958303-63958325 CTGGGGGCTGGGCTGGACCAGGG - Exonic
1176299049 21:5090045-5090067 CAGCCTTCTGGGCTGGAGCATGG - Intergenic
1176308323 21:5135967-5135989 CAGGATGCTGGGCAGGAGGATGG - Exonic
1176366722 21:6037626-6037648 GAGGGTGCTGGGCGGGGCCAGGG - Intergenic
1176388498 21:6151511-6151533 CTGGCTGCTGGGCGGGCCCCAGG - Intergenic
1176419222 21:6500408-6500430 CAGACTGTGGGGCAGGACCATGG + Intergenic
1176515509 21:7780671-7780693 AAGGCTGGTGGGCAGGTACAGGG + Intergenic
1176517038 21:7793048-7793070 CAGCCTGCTGTGCAGAACAAAGG + Intergenic
1178649537 21:34410683-34410705 AAGGCTGGTGGGCAGGTACAGGG + Intergenic
1178651066 21:34423060-34423082 CAGCCTGCTGTGCAGAACAAAGG + Intronic
1179465410 21:41568384-41568406 CAGCCTGCTGGGCAAGGCAAAGG - Intergenic
1179636427 21:42713943-42713965 CAGGCTGGAGTGCATGACCATGG + Intronic
1179694715 21:43108730-43108752 CAGACTGTGGGGCAGGACCATGG + Intergenic
1179734974 21:43386737-43386759 CTGGCTGCTGGGCGGGCCCCAGG + Intergenic
1179756796 21:43500918-43500940 GAGGGTGCTGGGCGGGGCCAGGG + Intergenic
1179809138 21:43859160-43859182 AAGGCTGGTGGCCAGGAGCATGG + Intergenic
1179848737 21:44126065-44126087 CAGGATGCTGGGCAGGAGGATGG + Exonic
1179857976 21:44171903-44171925 CAGCCTTCTGGGCTGGAGCATGG + Intergenic
1179884375 21:44307164-44307186 CAGGAGGCTGGGGAGGACAAGGG - Intronic
1180626106 22:17194489-17194511 CAGGCAGCGGGGCAGCACCCTGG - Intronic
1180791006 22:18575607-18575629 TGGGCTGCTGGCCAAGACCAAGG + Intergenic
1180967581 22:19798614-19798636 CAGGCTGCTGGGCAGGAGCTGGG - Intronic
1181230730 22:21419707-21419729 TGGGCTGCTGGCCAAGACCAAGG - Intronic
1181247918 22:21515162-21515184 TGGGCTGCTGGCCAAGACCAAGG + Intergenic
1181433078 22:22894662-22894684 CAGGCTGCTGGGGTGGGCCTGGG + Intronic
1181589936 22:23877750-23877772 CAGGCAGCTGGCCAGCAGCAGGG - Exonic
1182143294 22:27981027-27981049 CAGGAGGCTGGCCAGGGCCAAGG + Exonic
1182424726 22:30266028-30266050 CTGGCTGTTGGGGAGGGCCAAGG + Intronic
1182658349 22:31907183-31907205 TAGGCCACTGGGCAGGAGCAAGG + Intergenic
1182676553 22:32043621-32043643 CAGCCTGCCAGGAAGGACCAAGG + Intronic
1182722618 22:32415539-32415561 CAGGCAGCTGGAAAGGAGCATGG - Intronic
1183324488 22:37184005-37184027 CAGGCTGCTGAGCTGGGCCCAGG + Intronic
1183991053 22:41597246-41597268 CAGGGTGTGGGGTAGGACCAGGG + Intergenic
1184120204 22:42444976-42444998 CAGGTTGCTGGGTTGGACCCTGG + Intergenic
1184476088 22:44722202-44722224 GAAGCTGCTGGCCAGGAGCAGGG + Intronic
1184484103 22:44765786-44765808 CAGGCAGCTGGTCAGGAAGAAGG - Intronic
1184829226 22:46973275-46973297 CAGGCTGCTCGGCATAGCCACGG + Intronic
1185119697 22:48958588-48958610 CTGGCTGCTGGGCAGGCTGATGG + Intergenic
1185139226 22:49090990-49091012 CTGTCTGCTGGGCAGCACCAGGG - Intergenic
1185343641 22:50302192-50302214 CAGGGTGTTGGGCAGGACCTGGG + Intronic
1185363355 22:50422706-50422728 CATGCTGCTGAGCAGGGCAAAGG - Intronic
950221025 3:11196218-11196240 GAGGCTGCTGCGCAGGGCCAGGG - Intronic
950831643 3:15880121-15880143 CAGGCAGGTGGCCATGACCAGGG - Intergenic
951292612 3:20891938-20891960 CAGGGGGCTGGGCAGGAATATGG - Intergenic
952444684 3:33369655-33369677 CAGGCTGGAGTGCAGTACCATGG + Intronic
952931110 3:38361674-38361696 CAGGCTTGGGGGCAGGGCCAAGG + Intronic
953032566 3:39188013-39188035 GATTCTGCTGGGCAGGCCCAGGG - Exonic
953398446 3:42591123-42591145 CAGGCGCCGGGGCAGGACCCCGG + Intronic
953608074 3:44424729-44424751 AAGGCTGCTGGGCAAGCCCCTGG - Intergenic
954215406 3:49121689-49121711 CAGCCTCCTGGGCACGACCCTGG + Exonic
954245075 3:49324898-49324920 CAGGATGCTGGGCTATACCAGGG - Exonic
954370096 3:50165789-50165811 CAGCCTGCTGGGCAGCCCCAGGG + Intronic
954410315 3:50367739-50367761 CCTTCTGCTGGGCAGGTCCAGGG + Intronic
954420310 3:50415532-50415554 GAGGGGTCTGGGCAGGACCAGGG - Intronic
954665525 3:52249417-52249439 CTGGCAGCTGGCCAGGATCAGGG + Intronic
954745456 3:52785206-52785228 AAGGCTGATGTGCAGGCCCATGG + Exonic
955289707 3:57679933-57679955 CAGGGTGCTGAGCAGGATTATGG + Intronic
955405413 3:58622753-58622775 GAGGCTGCTGGGCAGGAGGGGGG + Intronic
958437060 3:94109659-94109681 CAGGTTCCTGTGCAGGTCCATGG - Intronic
961220192 3:125193585-125193607 CAGGCTGAGGGGCAGGACCACGG + Intronic
961511862 3:127408350-127408372 CTGCCTGCTGGGCAGCTCCATGG - Intergenic
961782711 3:129330364-129330386 GAGGCTGCTGGGGAGCACGAGGG - Intergenic
962438100 3:135384863-135384885 CAGGCTGCTGGCCTGGGCCTGGG + Intergenic
962968912 3:140380841-140380863 CTGGCTTATGCGCAGGACCAAGG + Intronic
963642876 3:147880372-147880394 CAGGCTGCTGGGCTGGACCTTGG + Intergenic
963761085 3:149287883-149287905 CAGGATGCTGGGCAAGAGCTTGG + Intergenic
964703044 3:159590154-159590176 CAGACTGCAGGTCAGGAACAAGG + Intronic
964790873 3:160452583-160452605 CAGGGGGCTGGGCAGGGGCAGGG - Intronic
965197596 3:165621502-165621524 CAGGCTACTGGGCTGTACCCTGG + Intergenic
965672207 3:171158492-171158514 TAGGCTGCTGTGCAGAATCAAGG - Intronic
965709512 3:171543215-171543237 CAGGCTGCAGGGCAGGAAAAAGG - Intergenic
965795654 3:172436196-172436218 CATGCTGCTAGACAAGACCATGG + Intergenic
966837192 3:184058434-184058456 CATGCTGCTGGGCATGGACAAGG + Exonic
967087451 3:186108347-186108369 CAGCCTGCTGGGTGGGAGCAGGG + Intronic
967884159 3:194322028-194322050 GAGGCTGCTGGGGTTGACCAGGG + Intergenic
968013520 3:195304117-195304139 CAGGCTGGTGTGCAGGGGCACGG - Intronic
968090881 3:195897468-195897490 GAGGCTTCAGGGCTGGACCATGG - Intronic
968525056 4:1052499-1052521 CTGGCAGGGGGGCAGGACCACGG - Intergenic
968645823 4:1740059-1740081 CAGGGTGCAGGGCAGGGCCAGGG - Intronic
968664424 4:1813349-1813371 CAGCCGGCTGGGCAGGAGGATGG + Exonic
968664583 4:1814148-1814170 GAGGCAGCTGGGCTGGGCCAAGG - Exonic
968762208 4:2448636-2448658 CAGCATCCTGGGCAGGAGCAAGG + Intronic
969017444 4:4113342-4113364 CAGGATGGTTGGCTGGACCAAGG + Intergenic
969366354 4:6696803-6696825 ACTGCTGCTGGGCAGGAGCAGGG - Intronic
969469978 4:7381986-7382008 CAGGCAGGTGAACAGGACCAGGG + Intronic
969682324 4:8650099-8650121 AAGGCTGCAGGGCTTGACCAAGG - Intergenic
971859630 4:32087514-32087536 CAGGCTGCTGGGCTGGATCTTGG + Intergenic
975758444 4:77594593-77594615 CAGGCAGCTGGGCAGGTCCAGGG + Intronic
976687823 4:87835575-87835597 CAGGCTGATGAGGATGACCAGGG + Intronic
977557400 4:98499244-98499266 GAGGCATCTGGGCAGGGCCAGGG + Intronic
978511265 4:109521485-109521507 CAGCCTGAAGTGCAGGACCAAGG - Exonic
978866487 4:113518770-113518792 CAGACTGCTGGACAGGAGCAGGG - Intronic
979282085 4:118879762-118879784 CTGACTGCTGGCCAAGACCACGG - Intronic
979284658 4:118909046-118909068 CAGGCTGCTGGGCATGTTGAGGG - Intronic
980173156 4:129313452-129313474 CAGGATTCTGGGCAGGAAGAGGG - Intergenic
981788764 4:148511305-148511327 CAGACTTCTGGGTAGGAGCAAGG - Intergenic
983907523 4:173199531-173199553 CAGGCATCTGAGCTGGACCATGG - Intronic
985012793 4:185601256-185601278 CAGGCTGTTGGGTAGGCACATGG + Intronic
985064169 4:186105080-186105102 AAGGCTGCTGTGCTGGACCTTGG + Intronic
985270319 4:188188223-188188245 CAGGCTGAAGTGCAGGACCTTGG + Intergenic
985520788 5:373243-373265 CCGGGTGCAGGGCAGGGCCAGGG - Intronic
985633905 5:1026805-1026827 GATGCGGCTGGGCAGGACCAAGG - Intronic
985780694 5:1869393-1869415 CAGGGGCCTGGGCAGGAGCAGGG + Intergenic
985882241 5:2646828-2646850 CAGGCTTCTGGACAGAGCCAAGG + Intergenic
986317988 5:6603893-6603915 CAGGCTGCTGGGCAGCAGCAGGG + Intronic
986897829 5:12392380-12392402 CAGGATGCTGGGCAAGGTCACGG - Intergenic
988161502 5:27523677-27523699 CAGCCTGCTGGGCCGGCCGAGGG - Intergenic
988270031 5:29002256-29002278 CACGCTGGTGGGCAGGCCCCAGG + Intergenic
989091336 5:37736192-37736214 CAGGCTGCTGGCCAGGGTCCAGG - Intronic
990043529 5:51399904-51399926 CAGCCTGTTAGGGAGGACCAAGG - Intergenic
990316173 5:54585245-54585267 CAGGCTGGAGTGCAGGAGCATGG - Intergenic
990816743 5:59794441-59794463 CAGGCTGCCGGGAAGCACCAGGG - Intronic
991166264 5:63567617-63567639 CAGGTTGCTGGGTGGGACCCCGG - Intergenic
992528057 5:77630474-77630496 CAGGCTGTTGGACAGGCCCATGG + Exonic
994497826 5:100535707-100535729 CCGGCTGCTGGGCAGGGGTAGGG - Exonic
995360443 5:111290573-111290595 CAGGATGCGGGGCAGAGCCAAGG + Intronic
996568050 5:124902490-124902512 AAGACTGCTGGGCAGGGCCATGG - Intergenic
997340840 5:133143470-133143492 CAGGCTATAGGGCAGGGCCAGGG - Intergenic
997399430 5:133591095-133591117 CAGGATGGAGGGGAGGACCAGGG + Intronic
997633418 5:135386975-135386997 CAGGCTGCTGTGAAGGCCAAAGG - Intronic
997910765 5:137870858-137870880 CATGCTGCTGGGGAGAAGCAGGG - Exonic
998040222 5:138946848-138946870 CAGGCTCCAGGGCAGGAACCTGG - Exonic
998757324 5:145395226-145395248 CAGGGTGGTGGGCAGGAAAAGGG - Intergenic
998988058 5:147783583-147783605 CAGGGTGGTGGGCAGGAAAAGGG + Intergenic
1001315003 5:170635820-170635842 CACGCTGATGGGCTAGACCATGG + Intronic
1001559381 5:172659338-172659360 CAGGCTTCTGGGCACCACCCAGG + Intronic
1001673078 5:173490731-173490753 CAGAGTGCAGGGCAGGACAAAGG + Intergenic
1002107023 5:176884661-176884683 CAGGCCCCTGGGCAGGATGAAGG + Intronic
1002212396 5:177606771-177606793 CGGGCAGCTGGGCAGGGCGAGGG - Intronic
1002318796 5:178362829-178362851 CGGGCTGCTGGGCTGTGCCATGG - Intronic
1002427263 5:179183691-179183713 CAGGCTTCAGGGCAAGCCCAGGG + Intronic
1002457573 5:179354281-179354303 CAGGCTGCTGGGAGGGAGGATGG + Intergenic
1002590885 5:180291393-180291415 CAGACGCCTGGGCAGGACCCCGG - Intronic
1002806625 6:582492-582514 CGGGCTGCTGTGCAGGACAACGG - Intronic
1005596307 6:27381691-27381713 CAGGCTGCAGGGCAGTGGCACGG - Intronic
1006276171 6:33007142-33007164 CAGGCCGATGGCCAGGCCCAGGG + Exonic
1006670546 6:35727576-35727598 CAGGCTTCTGTGAAGGATCAGGG + Intronic
1006804259 6:36778171-36778193 CAGGCTGCTGGGGAAGACCTAGG + Intronic
1007125767 6:39424304-39424326 CAGGGTGCTGGGGAGCACCTGGG - Intronic
1008060240 6:46989500-46989522 CATGCTGCTGGGCACTGCCAAGG - Intergenic
1009940504 6:70283074-70283096 CAGGCTGCAGAGCCGGGCCAAGG - Intronic
1012475742 6:99613616-99613638 CAGGCTGCTGGGCGGGGGCCGGG + Exonic
1016462456 6:144291196-144291218 GAAGAAGCTGGGCAGGACCAGGG - Intronic
1018051935 6:160016686-160016708 CAGGCTGGTGAGCAGGCTCAGGG - Intronic
1018070758 6:160162302-160162324 CATGCTGCTGAGCAGGACAGAGG + Intergenic
1018391225 6:163343324-163343346 CAGGCTGATGGGGAGGTCAAAGG + Intergenic
1019043097 6:169122259-169122281 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1019449240 7:1088264-1088286 CAGCCTGATGGGCCTGACCAAGG + Exonic
1019635706 7:2074570-2074592 CAGGCTGCTGGGAGGGGGCAAGG + Intronic
1019756618 7:2775624-2775646 CAGGCTGTTGGGTAGGACACAGG - Intronic
1020095950 7:5369454-5369476 AAGGCTGCTGAGCAGGCCCAGGG + Intronic
1020099902 7:5388883-5388905 GAGGCTGCCCGGCAGGACGAGGG - Exonic
1021526778 7:21596960-21596982 CAGGCTTCTGGTGAGGAACATGG + Intronic
1021678499 7:23105765-23105787 CAGGCTCCTGGGCAGGGCTCGGG + Exonic
1022477775 7:30723032-30723054 CAGCCTCCTGGGAAGGACAAGGG + Intronic
1022646366 7:32232480-32232502 CAGGCCACTGGGCAGGAGGACGG - Intronic
1022729052 7:33005842-33005864 CAGGCTGCTGGGAAGAGCCATGG - Exonic
1023585028 7:41720240-41720262 CAGGCGGCTGGGCAGTACCTAGG - Intergenic
1023854345 7:44172690-44172712 CAGGGTGCTTGTTAGGACCAGGG + Intronic
1024627383 7:51219767-51219789 CAGCCCACTAGGCAGGACCACGG + Exonic
1025044599 7:55682136-55682158 CAGGCTGCTGGGAAGAGCCATGG + Intergenic
1026579265 7:71600267-71600289 AAGGCTCCTGGGCAGGAATAGGG + Intronic
1026601510 7:71781459-71781481 CAGACTGATGGGCAGCCCCATGG + Exonic
1027345936 7:77259698-77259720 CAGGAGGCTGGTCAGGACGAGGG + Intronic
1027352090 7:77322307-77322329 GTGGCTGCTGGGCAGGGGCAGGG + Intronic
1029000357 7:97147957-97147979 CAGGCTGCAGTGCAGGCTCACGG + Intronic
1029021058 7:97364884-97364906 CAGGCAGATGGGCAGGTCCTTGG - Intergenic
1029439162 7:100577782-100577804 CCGGGAGCTGGGCTGGACCAGGG - Intronic
1029728379 7:102423725-102423747 CAGGCTGCCGTGCAGTAGCATGG + Intronic
1032074314 7:128829424-128829446 CAGGTGGGTAGGCAGGACCAGGG - Intergenic
1032265604 7:130368040-130368062 CTGGCTGCAGGGCAGTGCCAAGG + Intronic
1032436367 7:131904209-131904231 CAGGAGGCTGGGCAGGAGAATGG + Intergenic
1032500406 7:132395577-132395599 CATGCTGCTGGGCAGAACCAGGG + Intronic
1033278225 7:139988534-139988556 CAGGGTTCTGGGCAGGACCACGG - Intronic
1033511632 7:142065397-142065419 CTGGCCGCTGGGCAGGACATTGG + Exonic
1033514704 7:142094426-142094448 CTGGCCGCTGGGCAGGACATTGG + Intronic
1034463884 7:151214234-151214256 CAGTCTGCTGGGCAGAGGCAGGG - Intronic
1034524175 7:151645409-151645431 CAAGATGTTGGCCAGGACCAGGG - Intronic
1034930306 7:155156145-155156167 CAGGGTACTGGGCAGACCCAAGG - Intergenic
1035161577 7:156954222-156954244 CAGTCTGCTGGGCATGGCCGAGG - Exonic
1035557822 8:579606-579628 GAGGCTTCTGGGGAGCACCACGG - Intergenic
1036048163 8:5166898-5166920 CAGGCTGCTGTGAATGACCCTGG - Intergenic
1036207549 8:6816038-6816060 CAGGCTGCTGAGGAGTACCCAGG + Intronic
1036815368 8:11898555-11898577 GAGGTCGCTGGGCAGGACCAAGG + Intergenic
1037469660 8:19195024-19195046 CAGGCTGGTGGTAAGGAACATGG - Intergenic
1037579141 8:20234501-20234523 CAGGCTGTTGGGCAGGTCGCAGG - Intergenic
1039427119 8:37495241-37495263 CAGGCAGCTTGTCAGGAACAAGG + Intergenic
1041093539 8:54326940-54326962 CAGGGAGCTGGGCAGGCTCAGGG - Intergenic
1041722379 8:60987877-60987899 CAGGCTGGAGGGCATGATCATGG - Intergenic
1041930335 8:63279898-63279920 GATGCTGGTGGACAGGACCAGGG - Intergenic
1043752754 8:83960995-83961017 CAGGATTCTGGGCAGGACCTAGG + Intergenic
1043769743 8:84183416-84183438 CAGGCAGCGGGGAAGGACCGAGG - Intronic
1044016055 8:87049931-87049953 CAGACTGCTGGGATGGACCTTGG + Intronic
1044219281 8:89650125-89650147 AAGGCTGCTTGGCTGGCCCATGG - Intergenic
1047022847 8:120794827-120794849 CAGTCTTCTGAGAAGGACCATGG + Intronic
1047371958 8:124263486-124263508 CCTGCTGCTGGTCAGGACCTGGG - Intergenic
1048269573 8:133017836-133017858 CCGGCTGCTGGGCAGGTCCCAGG + Exonic
1048269702 8:133018802-133018824 CTGGCTGCTAAGCAGGTCCATGG + Intronic
1048511808 8:135069885-135069907 TAGGGGGCAGGGCAGGACCATGG - Intergenic
1048977457 8:139680884-139680906 CAGGCTGCTGGGCAGGACCATGG - Intronic
1049415636 8:142493620-142493642 CTGGCTGCCGGGCAGGGTCAAGG - Intronic
1049619604 8:143592095-143592117 CAGGCTGATGGGCAGAGGCAGGG + Intronic
1051169407 9:14304215-14304237 GAGGCTGCTGGGCATGAAGAAGG + Intronic
1052941044 9:34132605-34132627 CAGGCAGGTGGCCATGACCAGGG + Intergenic
1052991611 9:34522124-34522146 AAGCTTGGTGGGCAGGACCAGGG - Intronic
1053010066 9:34627971-34627993 CAGGCAGCTCGGCTGGCCCAGGG - Exonic
1053147498 9:35721749-35721771 CAGGCTTCTGGGCATCACCAAGG - Exonic
1056257391 9:84813917-84813939 CAGGCTGCTGAGCTAGACTAAGG + Intronic
1057042467 9:91857611-91857633 CCGGCTGCTAGGCAGGACCCAGG + Intronic
1060723653 9:125994106-125994128 AAGGCTGCTGGGCCAGGCCAAGG - Intergenic
1061033350 9:128100042-128100064 GAGGCGGCTTGGGAGGACCACGG + Intronic
1061161227 9:128895560-128895582 CAGGTTCCTGGCCAGGGCCAGGG - Intronic
1061379070 9:130243553-130243575 CAGGCATCTGGGAGGGACCAGGG - Intergenic
1061821348 9:133228562-133228584 GAGGCTGATGGCCAGGAGCAGGG + Intergenic
1061919836 9:133776662-133776684 CAGGCGGCAGGGGAGGACAAGGG - Intronic
1062034782 9:134378134-134378156 CAGGGTTCTGGGCAGGGCCGGGG + Intronic
1062114166 9:134798630-134798652 CAGGCTGTGAGGCAGGGCCAGGG + Intronic
1062130767 9:134891887-134891909 CAGGCAGCTGAACAGGACCAGGG - Intergenic
1062170746 9:135133401-135133423 CAAGCTGGTAGGCAGGGCCAAGG + Intergenic
1062412594 9:136432510-136432532 CACATTTCTGGGCAGGACCAGGG + Exonic
1203363971 Un_KI270442v1:241918-241940 CAGGCTGGAGGGCAGTAGCATGG + Intergenic
1186175671 X:6923638-6923660 CATGGTGCTGGCCAAGACCAGGG - Intergenic
1189414295 X:40801284-40801306 CAGGCTGCTGGGCTAGACCCTGG + Intergenic
1189446385 X:41085248-41085270 GAGGGGGCTGGGCAGGAGCAGGG + Intergenic
1190302610 X:49065372-49065394 CAGGCTGGGGGGCAAGGCCATGG - Intronic
1193615374 X:83681570-83681592 CAAGGTGCTGGTCAGGACTAGGG - Intergenic
1194123751 X:89989919-89989941 CAGGATGCTGGGCTGGACCTTGG + Intergenic
1195721671 X:107874494-107874516 CAGGCTGCTGGGCTGGACCAGGG + Intronic
1196730673 X:118938310-118938332 CAGCTTGCTGGGCAGGACCATGG - Intergenic
1199814054 X:151381648-151381670 CAGGAGGCTGGGCAGGAGAATGG + Intergenic
1200009300 X:153109188-153109210 CCAGCTGGTGGCCAGGACCAGGG - Intergenic
1200030300 X:153290734-153290756 CCAGCTGGTGGCCAGGACCAGGG + Intergenic
1200124306 X:153806037-153806059 CAGGCTGCAGGCCTGGCCCAAGG - Intronic
1200476637 Y:3647540-3647562 CAGGATGCTGGGCTGGACCTTGG + Intergenic
1201237469 Y:11924837-11924859 CAGGCTGGAGTGCAGCACCATGG - Intergenic