ID: 1048979656

View in Genome Browser
Species Human (GRCh38)
Location 8:139696588-139696610
Sequence CAACTCACTTGCTTATTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048979656_1048979669 19 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979669 8:139696630-139696652 GAGGAGGGAGGGAAGGAGGGAGG No data
1048979656_1048979664 7 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979664 8:139696618-139696640 ACTGAGTACACAGAGGAGGGAGG No data
1048979656_1048979671 27 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979671 8:139696638-139696660 AGGGAAGGAGGGAGGGAAGAAGG No data
1048979656_1048979672 28 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979672 8:139696639-139696661 GGGAAGGAGGGAGGGAAGAAGGG 0: 11
1: 388
2: 3651
3: 17814
4: 67817
1048979656_1048979666 12 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979666 8:139696623-139696645 GTACACAGAGGAGGGAGGGAAGG No data
1048979656_1048979667 15 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979667 8:139696626-139696648 CACAGAGGAGGGAGGGAAGGAGG No data
1048979656_1048979660 3 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979660 8:139696614-139696636 ACCCACTGAGTACACAGAGGAGG No data
1048979656_1048979659 0 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979659 8:139696611-139696633 AGGACCCACTGAGTACACAGAGG No data
1048979656_1048979662 4 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979662 8:139696615-139696637 CCCACTGAGTACACAGAGGAGGG No data
1048979656_1048979668 16 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979668 8:139696627-139696649 ACAGAGGAGGGAGGGAAGGAGGG No data
1048979656_1048979665 8 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG No data
1048979656_1048979670 20 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979670 8:139696631-139696653 AGGAGGGAGGGAAGGAGGGAGGG 0: 166
1: 2124
2: 13165
3: 58461
4: 59179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048979656 Original CRISPR CAACTCACTTGCTTATTGGA CGG (reversed) Intronic
902164058 1:14555147-14555169 CCACTCAATTGCTATTTGGAAGG - Intergenic
908854090 1:68404988-68405010 CAATTCACATAGTTATTGGAAGG - Intergenic
909950091 1:81708902-81708924 CAACTTACTTGCTCGTTAGATGG + Intronic
910216778 1:84851368-84851390 CAACAAACATGCTTATTGGGTGG - Intronic
910398186 1:86812374-86812396 CAGCTCATTGGCTTTTTGGAAGG + Intergenic
910552105 1:88486826-88486848 CAAGTCATTTGCTTAATGTACGG + Intergenic
912112471 1:106359889-106359911 AAAGTCACTTTCTTATAGGAAGG - Intergenic
913123999 1:115768512-115768534 GAACTCACTTGTTTATTGTGGGG - Exonic
914945874 1:152065654-152065676 AAATTCACTTGCTGTTTGGATGG - Intergenic
919546033 1:198920079-198920101 GAACTCACTTGTCAATTGGAGGG + Intergenic
1064302816 10:14137968-14137990 GCACACACTTGCTTATTGGCAGG - Intronic
1064658527 10:17580929-17580951 TACCTCACTTGTTTCTTGGACGG - Intergenic
1067838772 10:49659004-49659026 CAAATAACTTGCTTAATAGATGG + Intronic
1067963939 10:50887943-50887965 CATGTCAGTTGCTTATTTGATGG + Intergenic
1067974025 10:51003766-51003788 GAACTCACCTGCTTATTTGGAGG + Intronic
1072205665 10:93203278-93203300 CAATTTTATTGCTTATTGGAGGG + Intergenic
1072556204 10:96515592-96515614 CAACTGGCTTCCTTATTAGAAGG + Intergenic
1073659641 10:105460769-105460791 GAAGACACTTGGTTATTGGAAGG + Intergenic
1075431918 10:122391822-122391844 CAACACACAAACTTATTGGATGG + Intronic
1082888129 11:58109886-58109908 AAATTCACTTGCTTATTGTCTGG + Intronic
1084499948 11:69529591-69529613 CAGCTCACCTGCCTAATGGAGGG + Intergenic
1085891044 11:80579393-80579415 CAACTCACTTGATCATTAGCTGG + Intergenic
1086462113 11:87016411-87016433 CCACTCACTATCTTAATGGAAGG - Intergenic
1087832164 11:102831142-102831164 AAGCACACTTGCATATTGGATGG - Intergenic
1089854775 11:121533620-121533642 TAACTCTCTTGTTTATTGCAAGG + Intronic
1092811925 12:12279108-12279130 TGACTCACTTGGTTGTTGGAAGG - Intergenic
1093653385 12:21669444-21669466 CAAGTCCCTAGCTGATTGGATGG - Intronic
1096013235 12:48241574-48241596 CAACAGACTTGCTTAATGCAGGG - Intergenic
1096230487 12:49894165-49894187 CAACTCACTGGCCTGTTGGGAGG + Intronic
1100713711 12:97283817-97283839 CAACTCACCTGCTCCCTGGAGGG + Intergenic
1104439781 12:128785360-128785382 CAAGGCACTGGCTGATTGGATGG - Intergenic
1104456690 12:128920106-128920128 AAACTCACTTGTTTTTTGTATGG + Intronic
1109651987 13:65339236-65339258 CATTTCAATGGCTTATTGGAGGG - Intergenic
1109688643 13:65855341-65855363 CATCTCACCTGATTATTGCAAGG - Intergenic
1110098193 13:71559115-71559137 AAAATCACTTGTTAATTGGATGG + Intronic
1110403156 13:75117575-75117597 CAACTCACTTGCTGAGTTTACGG + Intergenic
1110500312 13:76219698-76219720 CATCTCACTGGCTTTTTGAAAGG + Intergenic
1113220617 13:108097681-108097703 CAAATGATTTGCTTATTGTAAGG - Intergenic
1113508779 13:110834958-110834980 CAACTCTCTTGCTAATTTGTGGG + Intergenic
1115797148 14:36950801-36950823 CAACTGACATTCTTATTGCACGG + Intronic
1117553681 14:56862447-56862469 CAACCCACTTTATTTTTGGATGG + Intergenic
1117851977 14:59982834-59982856 AAAATCCCTTGCTAATTGGAAGG - Intronic
1119181512 14:72608437-72608459 CAACTCACTGCCTTCATGGAAGG + Intergenic
1119528104 14:75338880-75338902 CAACTCACTTTCCTTATGGATGG + Intergenic
1119888297 14:78162919-78162941 CAACTCAAGTCCTTGTTGGATGG - Intergenic
1121214659 14:92238365-92238387 CAACTCACTTGCTTTTGGGCTGG - Intergenic
1127528135 15:59814437-59814459 AAACTCACGTGGTTATTGGCAGG + Intergenic
1135890585 16:26353495-26353517 CACATCAGTTGCTTATTGGCTGG + Intergenic
1137445567 16:48529810-48529832 CACCTCACTTGGGTATGGGAAGG - Intergenic
1140651473 16:77093092-77093114 AGACTCACTTGCTTATTGTGGGG - Intergenic
1140890578 16:79281439-79281461 CAGCTCACTTGCTTAAAGCAAGG - Intergenic
1151646197 17:75433719-75433741 CACCTCACTTGGTTATTTGTTGG - Intergenic
1153997224 18:10453836-10453858 CAAGTCATTTGCCTAGTGGAAGG + Intergenic
1154964906 18:21346980-21347002 CACCACACTTGCTTCTTGAAAGG + Intronic
1156022686 18:32617824-32617846 CCACTCCCTTGCCTATAGGAGGG + Intergenic
1158034805 18:53014197-53014219 TGAATCACTTGCTTATTGGCAGG + Intronic
1158206737 18:55001411-55001433 CAGCTCTCTTTCTTATGGGAAGG - Intergenic
1159641984 18:70874378-70874400 CACCTCAGTTGCTTGTTTGAAGG - Intergenic
1162986360 19:14272705-14272727 AAACACACTTGATTATGGGAGGG - Intergenic
1164967415 19:32497323-32497345 CAACTCACCTGATCATGGGACGG + Intergenic
925787909 2:7450977-7450999 CTTCTCACTTGCTTACTAGAAGG + Intergenic
926972957 2:18485080-18485102 CATCTCACCTGCTTCTTGGCTGG + Intergenic
931256218 2:60576099-60576121 CAACTCTTTTACTTATTGCAAGG - Intergenic
935350697 2:102149766-102149788 CAGCTCCCTTCCATATTGGAAGG - Intronic
937595324 2:123665288-123665310 CAACTCTATAGCTTATTGGGTGG - Intergenic
941787873 2:169518361-169518383 CAACTCACTTATTTGTTGTAAGG - Exonic
943419967 2:187658022-187658044 CTTCTCTCTTGCTTGTTGGAGGG + Intergenic
943559353 2:189442215-189442237 CATCTCACGTGGTTATTGGGAGG + Intronic
944475174 2:200096227-200096249 CAACTCACTGGGTTATTAGAAGG - Intergenic
944869362 2:203894256-203894278 TATCTGACTTGCTTATTGCAGGG + Intergenic
1171425987 20:25048954-25048976 TCACTCACTGGCTTATCGGAGGG + Intronic
1174893851 20:54427992-54428014 GAACTCACATCCTAATTGGAAGG + Intergenic
1176012440 20:62906249-62906271 CAACACACTTGCGTATTCGGTGG + Intronic
1181378352 22:22478790-22478812 AAACTCACTTGGGTATTGGCAGG - Intergenic
1182174184 22:28266451-28266473 CAACCCACATCCCTATTGGAAGG - Intronic
1182514791 22:30849562-30849584 CAAATCTTTTGCTTATGGGAGGG + Intronic
960021511 3:112960350-112960372 CAACTTATTTCCTTGTTGGAAGG - Intronic
967864739 3:194180976-194180998 CAATTCACTGGCTTAGTGAATGG + Intergenic
970091362 4:12411788-12411810 CAGCTTCCTTGCTTCTTGGATGG + Intergenic
978242334 4:106531285-106531307 CCATTCACTTGCCTATTAGAGGG - Intergenic
980890111 4:138805761-138805783 CATCTCACTTGTTTATGGGATGG - Intergenic
982100882 4:151966307-151966329 CAACTCACTCGTTTATTGAGTGG + Intergenic
982868026 4:160542620-160542642 AAAGTCACTTGCCTATTGCATGG - Intergenic
986050525 5:4085958-4085980 CAACTCACTTCCTAATGGAAGGG + Intergenic
986881434 5:12176732-12176754 GAACTCACTTGCTTTTTAAAAGG - Intergenic
988145292 5:27298110-27298132 CAACACAGTTGATTACTGGATGG + Intergenic
989138219 5:38176343-38176365 GAACTCACTTCCTTATTAGAAGG + Intergenic
994728968 5:103469850-103469872 CAATTCACTTCCTTATAGGTGGG - Intergenic
996308812 5:122079643-122079665 CCACTCAGTTGCATAGTGGAAGG + Intergenic
996977836 5:129456582-129456604 AAACTCACTTGGTTATTGACAGG - Intergenic
998425887 5:142028315-142028337 TCACTCACATGCTTATTGGTAGG + Intergenic
1000104258 5:158043851-158043873 CAGCTCCCTTGCTTCTTGGTGGG - Intergenic
1000472909 5:161668422-161668444 CAACTAACATTCTAATTGGAAGG + Intronic
1000671500 5:164068534-164068556 CAAATCAGTTGCTTGGTGGATGG + Intergenic
1001103833 5:168836073-168836095 CTACCCACTGGCTTAATGGAAGG - Intronic
1001270103 5:170304627-170304649 CAACAAAGTTACTTATTGGAAGG - Intergenic
1003256344 6:4478317-4478339 CAACTCACGTGGTTATTTGGAGG + Intergenic
1008308046 6:49929474-49929496 CAACTCACTTACTTCAGGGAAGG - Intergenic
1017224386 6:152003303-152003325 CAACTTACTTGTTAAATGGAGGG + Intronic
1018126551 6:160688712-160688734 CCACTTACTTGCTTATCGGAAGG + Intergenic
1020200689 7:6077494-6077516 AAACTCACTTTCTTCTTGGCAGG - Intergenic
1021206350 7:17786239-17786261 AAACTCACCAACTTATTGGAGGG + Intergenic
1022272690 7:28825626-28825648 CAACCACCTTCCTTATTGGAAGG + Exonic
1023307463 7:38846038-38846060 CAAGTCACTGGATTATTGCAAGG + Intronic
1025072421 7:55912098-55912120 CATCTCCTTTGCATATTGGAAGG + Intronic
1026365240 7:69642042-69642064 CAACTCCCTCAGTTATTGGAAGG - Intronic
1028849406 7:95519861-95519883 TAACTCACTTGATAATTGGTGGG + Intronic
1036285125 8:7437645-7437667 TCACTCACATGGTTATTGGAGGG - Intergenic
1036336351 8:7873884-7873906 TCACTCACATGGTTATTGGAGGG + Intergenic
1036907279 8:12717805-12717827 CAACTCACTTTGATATTAGAAGG - Intergenic
1039912320 8:41835030-41835052 CAACTCACTGTCTGATTTGAAGG + Intronic
1040849538 8:51884827-51884849 TACCTCAATGGCTTATTGGATGG - Intronic
1041774940 8:61513607-61513629 CAACTCACCTGCCTATTGTTGGG - Intronic
1047196404 8:122725933-122725955 CGACTTACTTGTTTCTTGGAGGG - Intergenic
1048113268 8:131491105-131491127 AAACTCACTGTCATATTGGATGG - Intergenic
1048979656 8:139696588-139696610 CAACTCACTTGCTTATTGGACGG - Intronic
1051630462 9:19135924-19135946 CAGCTCACAGGATTATTGGAAGG + Intronic
1052426998 9:28318028-28318050 CAACTCAGTTGCTTCTTGTATGG - Intronic
1056562837 9:87747543-87747565 CAAATCATTTTCTTATAGGAGGG - Intergenic
1056839305 9:89985762-89985784 CAAGTTATTTGCTTATTGGTTGG + Intergenic
1058408248 9:104701730-104701752 CAACCCATTTGCTTATTGATTGG - Intergenic
1188704670 X:33312535-33312557 CAACCCACTTGCATAGTGTAGGG - Intronic
1190608152 X:52166456-52166478 GAACTCACTTGCTTCTTGGTTGG - Intergenic
1192754512 X:74033258-74033280 CAACTGACTTGCTGGATGGAGGG - Intergenic
1194756535 X:97745346-97745368 CAACTCATTTTCTTCTTGGCTGG - Intergenic