ID: 1048979658

View in Genome Browser
Species Human (GRCh38)
Location 8:139696592-139696614
Sequence TCCTCAACTCACTTGCTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 165}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048979658_1048979673 27 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979673 8:139696642-139696664 AAGGAGGGAGGGAAGAAGGGAGG 0: 11
1: 334
2: 2902
3: 14268
4: 29296
1048979658_1048979659 -4 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979659 8:139696611-139696633 AGGACCCACTGAGTACACAGAGG No data
1048979658_1048979667 11 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979667 8:139696626-139696648 CACAGAGGAGGGAGGGAAGGAGG No data
1048979658_1048979662 0 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979662 8:139696615-139696637 CCCACTGAGTACACAGAGGAGGG No data
1048979658_1048979671 23 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979671 8:139696638-139696660 AGGGAAGGAGGGAGGGAAGAAGG No data
1048979658_1048979666 8 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979666 8:139696623-139696645 GTACACAGAGGAGGGAGGGAAGG No data
1048979658_1048979672 24 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979672 8:139696639-139696661 GGGAAGGAGGGAGGGAAGAAGGG 0: 11
1: 388
2: 3651
3: 17814
4: 67817
1048979658_1048979664 3 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979664 8:139696618-139696640 ACTGAGTACACAGAGGAGGGAGG No data
1048979658_1048979660 -1 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979660 8:139696614-139696636 ACCCACTGAGTACACAGAGGAGG No data
1048979658_1048979665 4 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG No data
1048979658_1048979668 12 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979668 8:139696627-139696649 ACAGAGGAGGGAGGGAAGGAGGG No data
1048979658_1048979674 28 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979674 8:139696643-139696665 AGGAGGGAGGGAAGAAGGGAGGG 0: 14
1: 400
2: 3477
3: 17381
4: 68109
1048979658_1048979670 16 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979670 8:139696631-139696653 AGGAGGGAGGGAAGGAGGGAGGG 0: 166
1: 2124
2: 13165
3: 58461
4: 59179
1048979658_1048979669 15 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979669 8:139696630-139696652 GAGGAGGGAGGGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048979658 Original CRISPR TCCTCAACTCACTTGCTTAT TGG (reversed) Intronic
900834988 1:4995942-4995964 TCATTAACTCACTTTCTAATTGG - Intergenic
901319619 1:8331718-8331740 TCCTGAACTCACTCACTCATAGG - Intronic
904025426 1:27500032-27500054 TCCTTAACTCACTTTTTGATGGG - Intergenic
904561202 1:31398374-31398396 TCATGAAATCACTTGCTTACAGG - Intergenic
906900463 1:49830437-49830459 TCCTTCACTCACTTGCTCATGGG + Intronic
906923333 1:50088282-50088304 TCCTGAAATCACTTAATTATAGG + Intronic
907590865 1:55669762-55669784 TACTGAACTCACATGGTTATTGG + Intergenic
909041052 1:70652338-70652360 TCATAAACACACTTGCTCATAGG - Intergenic
911103156 1:94109667-94109689 TCCTCAACTCTCTTCCATCTGGG - Intronic
911552697 1:99303521-99303543 TCCGCATGTCACTTGTTTATTGG - Intronic
911555273 1:99337290-99337312 TCTCCAACCCACTTGCTGATTGG + Intergenic
911676425 1:100663801-100663823 TCTTTCACTCACTTGCTGATGGG + Intergenic
912051876 1:105540229-105540251 TCTTAAACTCACTTGGTAATTGG + Intergenic
912629743 1:111236282-111236304 TCCTGCACTCACTTGCTCCTGGG - Intronic
913389264 1:118292200-118292222 TGATCAAATCACTTGCTTAGGGG + Intergenic
914733739 1:150396164-150396186 TCCTTAACTCACTTTTTGATGGG + Intronic
915494004 1:156268103-156268125 TCTTCCACTCACCTGCTTTTGGG + Exonic
916980232 1:170128211-170128233 TTCTTAACTCATTTGCTTAAAGG + Intergenic
918850815 1:189687356-189687378 TCCTTAACCCACTTTTTTATGGG + Intergenic
921150292 1:212395756-212395778 TCCTTCACTCACTTGTTGATGGG - Intronic
922313823 1:224422920-224422942 TCTTCAACCCAGTTGCTTAAGGG - Intronic
924655407 1:245970622-245970644 TCCTTCACTCACTTTCTGATGGG - Intronic
1064198275 10:13263267-13263289 CCCTCTACTCCCTTGCCTATTGG + Intergenic
1064681137 10:17811914-17811936 TCCTCCAATCACATGCTTCTCGG - Intronic
1065538530 10:26737888-26737910 TTTTCAACTCACTGCCTTATGGG - Intronic
1065782415 10:29182414-29182436 CCCTCAGACCACTTGCTTATTGG + Intergenic
1068027308 10:51662598-51662620 TTCCCAACTCACTTTCTTTTTGG + Intronic
1068374562 10:56162270-56162292 CCCACAACTCACAAGCTTATAGG - Intergenic
1068565368 10:58568768-58568790 CCCTCAACTCAGTGGGTTATTGG + Intronic
1068611087 10:59061110-59061132 TCCTGAAATCACTTGATTTTTGG + Intergenic
1073661780 10:105483613-105483635 CCCTCTACTCACTTTCTAATGGG + Intergenic
1073981092 10:109154608-109154630 TCCTTCACTCACTTGTTGATGGG - Intergenic
1074722759 10:116277074-116277096 TGCTCACTTCACGTGCTTATGGG - Intergenic
1075246052 10:120823057-120823079 TCCTCAATTGACTTTCTGATTGG - Intergenic
1075578320 10:123597021-123597043 TTCTCAAATCACTTGCTCCTAGG + Intergenic
1078647826 11:13158533-13158555 TCCTTAACCCACTTGTTGATGGG + Intergenic
1081633612 11:44705865-44705887 TCCTCACCTCAGTTTCTTAGAGG - Intergenic
1082575904 11:54802953-54802975 TCCTTCACTCACTTGTTGATGGG - Intergenic
1085124583 11:73991164-73991186 TCCTCTCCACACCTGCTTATGGG - Intergenic
1087770865 11:102208293-102208315 TCTGGAACTCACTTGGTTATTGG + Intronic
1089788926 11:120928499-120928521 TCCTCAATCCTCTTGCTTTTTGG - Intronic
1093770890 12:23017243-23017265 TCCTTAACCCACTTTCTGATGGG + Intergenic
1093776765 12:23084527-23084549 TCTTCAACTCACATACTAATAGG + Intergenic
1095445837 12:42281302-42281324 TAATCAGCTCACTTGCATATAGG - Intronic
1095769661 12:45939025-45939047 TCCTCAACAAATTTGCTAATAGG + Intronic
1097562768 12:61228762-61228784 TCATCCATTCACTTGTTTATTGG + Intergenic
1099945227 12:89236225-89236247 TCCTCAATTCACTTGTTCATGGG - Intergenic
1101284494 12:103296683-103296705 TCCTTCACTCACTTGTTGATGGG + Intronic
1106435751 13:29721703-29721725 TCTCCAACACACTTGCTTCTGGG + Intergenic
1107288256 13:38821708-38821730 GCCTCACTTCACGTGCTTATAGG + Intronic
1111252360 13:85619386-85619408 TCCTAAATTCACTTGGTAATTGG + Intergenic
1112759939 13:102683742-102683764 AAATCAACTGACTTGCTTATTGG + Intergenic
1114426476 14:22628113-22628135 TCCTCAGTTCACTTGGTAATTGG - Intergenic
1117156619 14:52948358-52948380 TCCTCTATTTACTTGCTGATAGG + Intronic
1117236003 14:53775762-53775784 TTCTCACCTCATTTGCTTTTTGG - Intergenic
1120546851 14:85822149-85822171 TTCTCATATCTCTTGCTTATAGG + Intergenic
1126874365 15:53023938-53023960 TATTCAAATCTCTTGCTTATAGG - Intergenic
1127528134 15:59814433-59814455 TTCTAAACTCACGTGGTTATTGG + Intergenic
1128350835 15:66887297-66887319 TCCCCACCCCATTTGCTTATAGG + Intergenic
1129019844 15:72506643-72506665 TCCTCAAATGAGCTGCTTATGGG - Intronic
1130790821 15:87154170-87154192 TCCTTAGCTCACTTTCTGATGGG + Intergenic
1132705106 16:1240177-1240199 TCCTCGACTCACTTGGTTGGGGG - Intergenic
1132708232 16:1255539-1255561 TCCTCGACTCACTTGGTTGGGGG - Intergenic
1137445569 16:48529814-48529836 TCCTCACCTCACTTGGGTATGGG - Intergenic
1138244631 16:55458334-55458356 TGGTCAACTCACTTGCCTACAGG + Intronic
1138547521 16:57728739-57728761 TCCTCCTCACACTTGTTTATCGG + Intronic
1139087333 16:63602873-63602895 TCCTAACCTCACTTGCTACTTGG + Intergenic
1149945233 17:60918265-60918287 GCCTCTTCTCATTTGCTTATTGG + Intronic
1150687637 17:67333370-67333392 TCCTTCCTTCACTTGCTTATGGG - Intergenic
1152299435 17:79486457-79486479 TCCTCAACTCCCCTTCTTCTGGG + Intronic
1167687692 19:50966910-50966932 TCCTGAACTTACTTTCTAATGGG - Intronic
926452320 2:13020471-13020493 TTCTCAAGTCATTTGCTGATCGG + Intergenic
927039730 2:19216265-19216287 TCCCAAACCCACTAGCTTATAGG - Intergenic
927614586 2:24579653-24579675 TGCTCAACTTTCCTGCTTATTGG - Intronic
928505315 2:31945837-31945859 TCCTAAATTCACTTGGTAATTGG - Intronic
931385532 2:61794679-61794701 TTTTCAAATCTCTTGCTTATAGG - Intergenic
932934351 2:76084522-76084544 TACTCCAATCACTTCCTTATCGG - Intergenic
935475629 2:103518439-103518461 TCCTTCACCCACTTGCTGATGGG - Intergenic
938914791 2:135926402-135926424 TCTTCAAGGCACTTGCTAATAGG + Intronic
945127652 2:206530451-206530473 TCCTCAAGTTACTTGCCTTTTGG + Intronic
946983277 2:225242901-225242923 ACCTTAACTCACTCTCTTATTGG - Intergenic
1169042254 20:2506114-2506136 TCCTTCACCCACTTGCTGATGGG - Intronic
1170385696 20:15814049-15814071 TCCTCAATTAACTTGGTTAAGGG - Intronic
1172526617 20:35603691-35603713 TTCTCCAGTCACTTGCTCATAGG - Intergenic
1177577580 21:22977884-22977906 TCATAAACTCACTTGCTATTTGG - Intergenic
1177861147 21:26455688-26455710 TCCTTTACTCACTTGTCTATTGG - Intergenic
1183305042 22:37078258-37078280 TCCTCAACGCAGTTGCTTCTAGG - Intronic
1183580610 22:38724006-38724028 CCCTCAAGTCACATGCTTACAGG + Intronic
952758533 3:36893451-36893473 TCATCAACTCAGTAGCTGATAGG - Intronic
953194389 3:40718566-40718588 TCCTCAAAGCACTAGCATATGGG - Intergenic
953288583 3:41638375-41638397 TGCTCAACTCAGTTGTTTACAGG - Intronic
953913929 3:46906176-46906198 TCCTCAGCCCACTTGGCTATGGG + Intergenic
957416535 3:79913213-79913235 TCCACAACTCACCTGCTATTAGG + Intergenic
958149078 3:89667219-89667241 TCCTCTACTCACTACCTTAAAGG + Intergenic
958875623 3:99613527-99613549 TCATCAATTGACTTGCTTTTAGG - Intergenic
958893153 3:99802424-99802446 ACCTCAACTTAATTGCTTAAAGG + Intergenic
959428186 3:106219229-106219251 TCCTTCACTCACTTTCTGATGGG + Intergenic
960730846 3:120725116-120725138 TCCTTCACTCACTTGTTGATGGG - Intronic
962415700 3:135179683-135179705 TCCTCATCTCCCTTCCTTCTGGG - Intronic
962868649 3:139469311-139469333 TCCTCCTCTCACTTCCTTCTAGG + Intronic
963232975 3:142927513-142927535 TCCTAATCTCACTTTCTTACAGG + Intergenic
964039582 3:152243131-152243153 TCCCAAACTCCCTTGCTCATTGG - Intergenic
966460751 3:180173667-180173689 TTCTCAGCTCTCTTACTTATGGG - Intergenic
967295948 3:187965296-187965318 TCCTCAATTGGCTTTCTTATTGG - Intergenic
973868657 4:55141579-55141601 TCCTCTACTCACATACTAATTGG - Intergenic
975473590 4:74796574-74796596 CTCTCAAGTCATTTGCTTATGGG + Intergenic
978058551 4:104306435-104306457 TCCTCAACTCACTTTTTTATGGG + Intergenic
978548095 4:109895121-109895143 TCCTTCACTCACTTGTTGATGGG + Intergenic
981547371 4:145908052-145908074 TTTTCAACTCACTTCCTTTTTGG + Intronic
982628654 4:157802823-157802845 TTCTAAACTGACTTTCTTATGGG - Intergenic
985067869 4:186141166-186141188 TCCTCTGCCCACTTGTTTATGGG + Intronic
987599987 5:20055458-20055480 AACTCATCTCACTTGCCTATTGG - Intronic
991032404 5:62096351-62096373 TCCTTAACCCACTTGTTGATGGG - Intergenic
994416738 5:99481706-99481728 TCCTTAACTCACTTTTTGATGGG - Intergenic
994463232 5:100093451-100093473 TCCTTAACTCACTTTTTGATGGG + Intergenic
994728970 5:103469854-103469876 CCATCAATTCACTTCCTTATAGG - Intergenic
996642725 5:125776691-125776713 TCCTCAACTGACATCCTTTTGGG + Intergenic
1001330829 5:170761232-170761254 CCCTCATCTCACTTCCTCATGGG + Intergenic
1002919144 6:1553989-1554011 TCCCCAACTCCCTTGCATCTAGG + Intergenic
1007228486 6:40331346-40331368 GCCTCATCTCACTTGGTTCTTGG - Intergenic
1009383876 6:63066276-63066298 TCTTCAAGTCACATGCTCATAGG + Intergenic
1009837147 6:69016481-69016503 TCCTAAATTCACTTGGTAATTGG + Intronic
1010127779 6:72453854-72453876 ACATGAACTCACATGCTTATTGG + Intergenic
1010608887 6:77928304-77928326 TCCTTCACTCACTTGTTGATGGG - Intergenic
1010704147 6:79087832-79087854 TCTCCAACTCAATTTCTTATGGG - Intergenic
1011053334 6:83178163-83178185 TCCTAAACTTACTTGGTAATAGG + Intronic
1013068720 6:106708868-106708890 TCCTCAACTGATTTGATTTTTGG + Intergenic
1019697107 7:2452068-2452090 TCCACCACTCACTTGCTGTTGGG + Intergenic
1019740572 7:2671002-2671024 TCCTGAACTCTCTGGCTTCTGGG - Intergenic
1020564497 7:9778506-9778528 TCCTGCACTCATTTGCTCATGGG - Intergenic
1020863291 7:13522330-13522352 TCATAAACTCACCTGCCTATTGG + Intergenic
1023143421 7:37125456-37125478 TCCTTAGCCCACTTGTTTATGGG - Intronic
1024423743 7:49201634-49201656 GACTCAACTTATTTGCTTATAGG - Intergenic
1031315397 7:120251727-120251749 TCCTCAAATCATTTTCTGATGGG - Intergenic
1031534697 7:122918932-122918954 TCCTCATTTCACTTGGTAATTGG + Intergenic
1031544053 7:123031062-123031084 TCCCCACCTCACTTGGTCATTGG - Intergenic
1033109261 7:138560204-138560226 TCCTGAACTCTGTGGCTTATAGG + Intronic
1034208065 7:149335729-149335751 TCCTTAGCCCACTTCCTTATGGG - Intergenic
1036819911 8:11932141-11932163 TCCTCTCCTCCCTTGCATATTGG - Intergenic
1037844634 8:22272368-22272390 TCTTGAACTCAGTGGCTTATGGG - Intergenic
1037858280 8:22387247-22387269 TCATCCACTCTCTTGCTGATGGG + Intronic
1038608914 8:29041260-29041282 TCCCCAACACTCTTGCTTCTTGG + Intronic
1039696754 8:39921015-39921037 TCCTCAAATAACTTGCTTCAAGG - Intronic
1039701554 8:39967223-39967245 TCCTCCACCCATCTGCTTATGGG - Intronic
1040988674 8:53325215-53325237 TCCTCAGCTCACTTTTCTATTGG + Intergenic
1042465230 8:69121997-69122019 TCCTTAACTCACTTTTTGATGGG + Intergenic
1042599975 8:70489705-70489727 TCCTTCACTCACTTGTTGATGGG + Intergenic
1042979658 8:74511140-74511162 TCCTGAAGTCACTTGCTATTAGG - Intergenic
1043928168 8:86061263-86061285 TCCTCTTCTCAGTTGCTTTTGGG + Intronic
1044478997 8:92662977-92662999 TCCTTCACTCACTTGTTGATGGG - Intergenic
1044888500 8:96806232-96806254 TCCTCAACTTATTTATTTATTGG + Intronic
1044906995 8:97014966-97014988 TTCTCATCTCAGTTGCTTGTTGG + Intronic
1048467529 8:134679258-134679280 TCCTTCACTCACTTTCTGATGGG - Intronic
1048979658 8:139696592-139696614 TCCTCAACTCACTTGCTTATTGG - Intronic
1049168560 8:141142626-141142648 TGCTCAATTCACCTGCTCATTGG - Intronic
1051187066 9:14471516-14471538 TCTTCTACTAACTTGGTTATTGG - Intergenic
1053517992 9:38747771-38747793 TCTTCAACTCACATGATCATAGG + Intergenic
1056063961 9:82914465-82914487 TCCTCAACCCACTTGCAAACTGG + Intergenic
1056827912 9:89889803-89889825 TCCTCATCTCCCCTTCTTATAGG - Intergenic
1057461368 9:95265625-95265647 TCCTCAGCTCACTTTCTAACTGG - Intronic
1057665573 9:97042417-97042439 TCTTCCACCCTCTTGCTTATTGG - Intergenic
1059238737 9:112784881-112784903 TCCTCAAGTAAATTCCTTATTGG + Intronic
1061212938 9:129203886-129203908 TCCTCAAACCCCTTGCTTCTGGG - Intergenic
1185549986 X:975299-975321 TCCTCATCTCATCTTCTTATGGG + Intergenic
1185616656 X:1426088-1426110 TCCTCATCTCCTTTTCTTATAGG - Intronic
1188962641 X:36511126-36511148 TCTTCAACTCAGTTGTTTGTTGG - Intergenic
1189286251 X:39854380-39854402 TCCTCATCCCACTTGTTCATGGG + Intergenic
1189313336 X:40035349-40035371 GCCTCATCTCTCTTGATTATGGG + Intergenic
1195783712 X:108492806-108492828 TCATCAATTCATTTGCTCATAGG - Intronic
1197619163 X:128727773-128727795 TCCTCACTTCAATTCCTTATTGG + Intergenic
1198003607 X:132467496-132467518 TCATTAACTCATTTTCTTATTGG + Intronic