ID: 1048979665

View in Genome Browser
Species Human (GRCh38)
Location 8:139696619-139696641
Sequence CTGAGTACACAGAGGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048979656_1048979665 8 Left 1048979656 8:139696588-139696610 CCGTCCAATAAGCAAGTGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG No data
1048979658_1048979665 4 Left 1048979658 8:139696592-139696614 CCAATAAGCAAGTGAGTTGAGGA 0: 1
1: 0
2: 1
3: 4
4: 165
Right 1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048979665 Original CRISPR CTGAGTACACAGAGGAGGGA GGG Intronic
No off target data available for this crispr