ID: 1048980078

View in Genome Browser
Species Human (GRCh38)
Location 8:139698521-139698543
Sequence CCACCCTGCTTAGCACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048980078_1048980086 5 Left 1048980078 8:139698521-139698543 CCTGCATGTGCTAAGCAGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1048980086 8:139698549-139698571 AAGGGGTTGAAGCAGCCACTGGG No data
1048980078_1048980085 4 Left 1048980078 8:139698521-139698543 CCTGCATGTGCTAAGCAGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1048980085 8:139698548-139698570 GAAGGGGTTGAAGCAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048980078 Original CRISPR CCACCCTGCTTAGCACATGC AGG (reversed) Intronic
900112777 1:1015546-1015568 ACCCCCTGCTGGGCACATGCGGG - Intergenic
901171201 1:7258933-7258955 CCACTCTGCTTCCCACACGCCGG + Intronic
901952927 1:12762809-12762831 CGCCCCTGCTTAGCATATCCTGG - Exonic
905873448 1:41417836-41417858 CCACACTGCCTCACACATGCTGG - Intergenic
906196827 1:43934883-43934905 CCACCCTGCTTGGAATCTGCAGG + Intronic
906911748 1:49959602-49959624 CCACACTGCTTTCCACATGTTGG - Intronic
908259854 1:62331568-62331590 CCACCTTGCCTAGCCCATCCAGG + Intergenic
910032707 1:82749769-82749791 CCTCCCTGCTTTGCTCATGCTGG + Intergenic
910850418 1:91645000-91645022 CCATCCTGCTTAGACCCTGCTGG - Intergenic
917626967 1:176856046-176856068 CCACCGTGCCTGGCACAGGCTGG - Intergenic
918746174 1:188203087-188203109 CCAGACTGCTTAGCTCATGTTGG + Intergenic
922749435 1:228063698-228063720 CCACCCTAATTAGCACCTACTGG + Intergenic
923149496 1:231220672-231220694 CCAACCTGCATAGCTCGTGCTGG - Intronic
1063092212 10:2875232-2875254 CCACCCTGCTTGGGACCTGATGG - Intergenic
1064563974 10:16621250-16621272 CCACCCTGCACAGGACATCCTGG + Intronic
1069708917 10:70476847-70476869 CCTCCCTGCCCAGCAGATGCTGG - Intergenic
1071333470 10:84583495-84583517 CCCTCCTGCTTAGCACAGGCAGG + Intergenic
1071684348 10:87738650-87738672 CCACCCAACTTGGCTCATGCTGG + Intronic
1073578508 10:104643417-104643439 CCAGCCTGGGTAGCCCATGCTGG + Intronic
1074101555 10:110358208-110358230 CCACCTTTCTAAGCACGTGCTGG + Intergenic
1074249061 10:111725518-111725540 GCACCCTTCTTAGCACATTGTGG + Intergenic
1074363796 10:112842288-112842310 CCACCCTGCTTCCCCCATCCTGG + Intergenic
1077445090 11:2587113-2587135 GCCCCCTGCTCAGCACCTGCAGG + Intronic
1079398935 11:20090028-20090050 CCACACTGCTTAACACACTCAGG - Intronic
1079966471 11:26986224-26986246 TCATCCTTCTTTGCACATGCTGG + Intergenic
1087171797 11:95057343-95057365 CCACTTTGCTTATCACATGGTGG - Intergenic
1088597637 11:111451903-111451925 CCTCCTTGCACAGCACATGCTGG - Intronic
1088972640 11:114787257-114787279 CCACCCTCCCAAGCTCATGCAGG + Intergenic
1089261918 11:117229526-117229548 CCAGCCTGCTGGGCACAGGCCGG - Exonic
1090136662 11:124206359-124206381 CCAGAGTACTTAGCACATGCTGG + Intergenic
1091366123 11:135022170-135022192 CCACCCTGCTCTGCTCATGCAGG - Intergenic
1096145497 12:49276077-49276099 GCACCCTGCTTGGGAAATGCTGG - Intergenic
1098068161 12:66642309-66642331 CCTCCCTGCCTTTCACATGCTGG - Intronic
1098226343 12:68329077-68329099 CCACCCTGCTGAGCGCCTACAGG - Intronic
1100104417 12:91151582-91151604 CCACCCTGCTTATGGGATGCTGG - Intronic
1101888617 12:108691514-108691536 TCAGCCTGCTTAGCACAGACTGG + Intronic
1104702441 12:130917539-130917561 CCACCCTGTTTACCACCTGCAGG + Intergenic
1111764940 13:92516744-92516766 CCATCCTGCATCGCTCATGCTGG - Intronic
1113664465 13:112131708-112131730 GCACCCTGCTTTGCTCTTGCAGG + Intergenic
1118234844 14:63992917-63992939 CCACCCTGCTTAGCTTCTCCCGG + Intronic
1124338121 15:28872559-28872581 CCAGCCTGCTTAGTCCATGTGGG - Intergenic
1124957345 15:34367771-34367793 CGGCCCTGCCTAGCACAGGCAGG - Intergenic
1125309444 15:38362577-38362599 CCATTGTGCTTAGCAAATGCTGG + Intergenic
1128398168 15:67250462-67250484 CCACCATGCCTGGCACATGGAGG + Intronic
1128773883 15:70304040-70304062 CCACTCTGCTTTGCACTAGCTGG - Intergenic
1129111042 15:73337316-73337338 CCTCCATGCTTAGCACAAGCAGG + Intronic
1132748115 16:1445398-1445420 CCACCCTGCTTAGCCCTCACAGG - Exonic
1132939797 16:2501043-2501065 CAACCCTGCCTACCACATGGGGG - Exonic
1134241602 16:12510867-12510889 CCACGGTGCTTGGCACAGGCTGG - Intronic
1135252010 16:20908177-20908199 CCAGCCTGCTTAGAGCATGCTGG + Intronic
1135701294 16:24634741-24634763 CCACCCTGGAGAGCACATTCTGG - Intergenic
1136514108 16:30757403-30757425 GCACCCTGCTGAGCACCTTCTGG - Exonic
1137269002 16:46890429-46890451 CCACCCTCCTGAGCCCAGGCTGG - Intronic
1138388721 16:56654383-56654405 GCACCCTGCTGGGAACATGCTGG - Intronic
1142349241 16:89572221-89572243 CCACCACACTCAGCACATGCAGG - Intergenic
1142480402 17:215245-215267 CCACCCTGCCCTGCACCTGCTGG - Intronic
1143390170 17:6555612-6555634 CCCCCCTGCTGCGCCCATGCTGG - Intronic
1145299682 17:21624198-21624220 CCACCCTCCTTACCTCTTGCTGG - Intergenic
1147911219 17:43857383-43857405 CCACCCTGCCTGGCACCTGGCGG - Intronic
1148003270 17:44403358-44403380 CCACCATGCTCGGCCCATGCTGG + Intronic
1148195533 17:45710101-45710123 CCTCCCTGCTGAGCTCAGGCTGG + Intergenic
1149832771 17:59886425-59886447 TCAGCCTGCTTAGCAAATGCTGG - Intronic
1150286524 17:63957512-63957534 CCTCCCTGCTTGGCAGCTGCGGG - Exonic
1152240385 17:79157754-79157776 CCACCCAGCTCGGCACATGCTGG + Intronic
1153395166 18:4611479-4611501 GCACTGTGCTTAGCATATGCTGG + Intergenic
1154491301 18:14924454-14924476 CCCCTCTGCCTAGCACAGGCCGG - Intergenic
1155765613 18:29628616-29628638 CCACCCTGCAAAGCACAGGCTGG + Intergenic
1157724018 18:49949151-49949173 CCTCACTGCCCAGCACATGCTGG + Intronic
1159639030 18:70841654-70841676 CCAGCCTGGTTAGCACCAGCTGG + Intergenic
1160883997 19:1336389-1336411 CCCCCCAGCTCAGCACAGGCCGG + Intergenic
1161774961 19:6255929-6255951 CCACCGTGCTTGGCCCAGGCTGG - Intronic
1163555480 19:17989964-17989986 CCACCCAGCTCAGAAGATGCAGG - Intronic
1164683029 19:30148543-30148565 CCACCCTGCCTCACCCATGCTGG + Intergenic
1166828930 19:45626771-45626793 CCACTGTGCTTATCACCTGCGGG - Exonic
1167354998 19:48998257-48998279 CCACCAGGCCTTGCACATGCTGG - Intronic
1168404842 19:56105296-56105318 CCTCCCAGCTTTCCACATGCTGG + Intronic
925621458 2:5797415-5797437 CCACCCTCCTCAGCACAGGTAGG - Intergenic
925688856 2:6499512-6499534 CACCCCTGTTTAGCTCATGCTGG + Intergenic
925726644 2:6879034-6879056 CTACCCTGGTAAGCACTTGCTGG + Intronic
925811063 2:7701363-7701385 ACACCCTGCCGAGCACATGGTGG + Intergenic
932609710 2:73189830-73189852 CCACGGTGCTTAGCACATATTGG - Intergenic
932701083 2:73992050-73992072 CCACCAGCCTTAGCACATTCTGG - Intronic
934555085 2:95282868-95282890 CCACGCTCCTAAGCATATGCTGG + Intronic
941151018 2:161915739-161915761 CCACCCTGCTCAACCCTTGCAGG - Intronic
941470976 2:165886427-165886449 CCACTATGCTTAGCACTCGCTGG + Intronic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
947524959 2:230872116-230872138 CCTGCCTGCTTAGCACTTTCTGG - Intronic
947864486 2:233386815-233386837 TCACCATGATTGGCACATGCTGG + Intronic
947869979 2:233429654-233429676 CCCCCCGGCTCAGCAGATGCTGG - Intronic
947870980 2:233437841-233437863 CATCTCTGCCTAGCACATGCTGG + Intronic
1174017488 20:47500662-47500684 CCAACGTGCTTAGCACACTCTGG - Intergenic
1177496096 21:21894463-21894485 CCACCCTGCTTAGCAGTTCAAGG - Intergenic
1179460060 21:41528559-41528581 CCATCCTGCAGAGCAGATGCAGG - Intronic
1180017046 21:45093870-45093892 CGACCCTGCACAGCACATGGGGG + Intronic
1180918546 22:19506327-19506349 CCACCCTGCCACGCACATGATGG - Intronic
1181084072 22:20431254-20431276 CCAGCCTGCGTGGCACAGGCAGG + Exonic
1181165275 22:20979862-20979884 CCTCCCTGCTTTGCACATCGCGG - Intronic
1182151667 22:28031474-28031496 CCCACCTGCCTAGCACATGAGGG - Intronic
1183182701 22:36271677-36271699 CCACCCTCCTTAGCACTGTCAGG + Intergenic
1183342210 22:37287660-37287682 CCAAACTGCTTGGGACATGCAGG - Intronic
1184287959 22:43482650-43482672 GCACACTGCTTGGCACATGGTGG + Intronic
1184920423 22:47601636-47601658 CCATCGTGCTCAGCACATGGAGG - Intergenic
1185228551 22:49667672-49667694 GCCCCCAGCTCAGCACATGCAGG + Intergenic
1185228584 22:49667770-49667792 GCCCCCAGCTCAGCACATGCAGG + Intergenic
1185228621 22:49667868-49667890 GCCCCCAGCTCAGCACATGCAGG + Intergenic
1185228638 22:49667917-49667939 GCCCCCAGCTCAGCACATGCAGG + Intergenic
1185228707 22:49668113-49668135 GCCCCCAGCTCAGCACATGCAGG + Intergenic
950077049 3:10194719-10194741 CCACCCAGCTCAGACCATGCCGG + Intronic
953217984 3:40939097-40939119 CCTCCCTGTTTTGCACATACTGG + Intergenic
954123064 3:48511710-48511732 CCCCACTGCTTGGCACATGGTGG + Intergenic
954940652 3:54369373-54369395 CCACACCACTGAGCACATGCAGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
959246321 3:103874098-103874120 GCAGCCTGACTAGCACATGCTGG - Intergenic
959246347 3:103874332-103874354 GCAGCCTGACTAGCACATGCTGG - Intergenic
962032332 3:131614233-131614255 ACAGCCTACTGAGCACATGCTGG - Intronic
962883858 3:139604883-139604905 CCACACTGCTTTGCACTTGTTGG - Intronic
962894773 3:139704421-139704443 CAACCCAACTTAGTACATGCAGG - Intergenic
963101115 3:141605169-141605191 CCATCCTGCTTAGTACTTGGTGG + Intronic
967106196 3:186256700-186256722 CCACTCTGCTTTGACCATGCTGG + Intronic
968280448 3:197472961-197472983 CCACCATGCTCAGCCCATCCAGG + Intergenic
969612841 4:8236724-8236746 CCACTCAGCCTGGCACATGCAGG - Intronic
972848504 4:43019368-43019390 GCACCCTGCTTAGCACAAGTAGG + Intronic
973274184 4:48291571-48291593 CCACCCTGCCCAGCAGAGGCAGG + Intergenic
976601931 4:86945777-86945799 CCACCATGCTTGGCCCATGGAGG + Intronic
983450620 4:167906716-167906738 CCACCATGCCCAGCCCATGCTGG + Intergenic
984697935 4:182798201-182798223 TCTCCCTGCGTAGCACAGGCTGG + Intronic
985755060 5:1708905-1708927 CCTCCCTGCTAAGCACTGGCAGG + Intergenic
985840279 5:2300639-2300661 CCACCCTGCTCAGGACCAGCGGG + Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
992403416 5:76432410-76432432 CCACCATGCTCAGCCCAGGCTGG + Intronic
998593914 5:143507606-143507628 CCACCCTACTTGGTACTTGCTGG + Intergenic
998620503 5:143789332-143789354 CCACCCTGCTGAGTTCATTCAGG - Intergenic
999730259 5:154472023-154472045 CCACAGTGCCTAGCACATGGTGG + Intergenic
1000148465 5:158476269-158476291 ACACCATCCTTAGCACATTCTGG + Intergenic
1005488202 6:26321180-26321202 CCAGACTGCTTTCCACATGCAGG - Intergenic
1007175819 6:39896763-39896785 CTGCCCTGCCTAGCCCATGCAGG + Intronic
1007958111 6:45935376-45935398 CCAGCCTGCCTGGCACATGGTGG - Intronic
1008647760 6:53532515-53532537 CTACCCTGCTTAGCTCAGGCAGG + Intronic
1017819819 6:158041186-158041208 CCACCCTGCTGGGCAAATGGGGG + Intronic
1021315633 7:19144694-19144716 CCACTCTGCTCAGCGCATGTGGG + Intergenic
1022557943 7:31318605-31318627 CCACATTGCTTAGGACAAGCTGG + Intergenic
1026494496 7:70890709-70890731 CCACCCTACTTGGCCCATCCTGG - Intergenic
1029237399 7:99132352-99132374 CAACACTGCTTGGCACCTGCTGG - Intronic
1029439684 7:100580117-100580139 ACCCCATGCTTTGCACATGCTGG + Intronic
1030733816 7:113020092-113020114 CCACACTGCTTTTCACATGGCGG + Intergenic
1031349258 7:120708760-120708782 CCAACCTGCTTAAGACATGCTGG + Intronic
1033705781 7:143883895-143883917 CCACCCTGCATTTCCCATGCTGG - Intronic
1036752342 8:11451205-11451227 CCACCATGCTCAGCACATGTGGG + Intronic
1045511204 8:102813248-102813270 CCACCCTGCTCTGCACCTGGAGG - Intergenic
1048980078 8:139698521-139698543 CCACCCTGCTTAGCACATGCAGG - Intronic
1049295190 8:141829414-141829436 CCACCGTGCTTGGCCCATGAGGG - Intergenic
1050237211 9:3594643-3594665 CCACCCTGCGTAGAAGGTGCTGG - Intergenic
1053163087 9:35827092-35827114 CCACCGTGCTTGGCCCCTGCTGG + Intronic
1053430962 9:38041478-38041500 CCATCCAGCCTAGCAAATGCAGG - Intronic
1056629713 9:88283162-88283184 CCACCCTGCTGAGAAGCTGCTGG + Intergenic
1057974129 9:99586028-99586050 CAACCATGCTTGGCACATACTGG + Intergenic
1059480384 9:114584948-114584970 CCTCCCTGCATTGCCCATGCTGG + Intergenic
1060406736 9:123376554-123376576 GCACCCTGCTTAGCTCCTGCCGG + Intronic
1062564873 9:137159843-137159865 TCACCCTGCCTAGGACATGCCGG + Intronic
1190878196 X:54474629-54474651 CTGCCCTGCTCAGCACATCCTGG + Intronic
1191094333 X:56658933-56658955 CCAGCCTCCTTAGCACAGTCAGG + Intergenic
1191841282 X:65515059-65515081 CCACCCCACTTAGCACAGGTGGG + Intronic
1194087315 X:89544847-89544869 TCACGCTGCTTAGTACATGTGGG - Intergenic
1195065236 X:101233738-101233760 CCACCCAGGGTAGCACAGGCAGG + Intronic
1196558905 X:117122999-117123021 CCACCCTCTTTAGCACTGGCAGG - Intergenic
1200439965 Y:3200719-3200741 TCACGCTGCTTAGTACATGTGGG - Intergenic