ID: 1048981101

View in Genome Browser
Species Human (GRCh38)
Location 8:139703726-139703748
Sequence CCGCGCGCCCGGGTGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048981101_1048981114 11 Left 1048981101 8:139703726-139703748 CCAGCGCCCACCCGGGCGCGCGG No data
Right 1048981114 8:139703760-139703782 GGTCCCCGCCGGGCGTCGGCCGG No data
1048981101_1048981110 -10 Left 1048981101 8:139703726-139703748 CCAGCGCCCACCCGGGCGCGCGG No data
Right 1048981110 8:139703739-139703761 GGGCGCGCGGGTGCGCAGCGGGG No data
1048981101_1048981112 1 Left 1048981101 8:139703726-139703748 CCAGCGCCCACCCGGGCGCGCGG No data
Right 1048981112 8:139703750-139703772 TGCGCAGCGGGGTCCCCGCCGGG No data
1048981101_1048981113 7 Left 1048981101 8:139703726-139703748 CCAGCGCCCACCCGGGCGCGCGG No data
Right 1048981113 8:139703756-139703778 GCGGGGTCCCCGCCGGGCGTCGG No data
1048981101_1048981119 29 Left 1048981101 8:139703726-139703748 CCAGCGCCCACCCGGGCGCGCGG No data
Right 1048981119 8:139703778-139703800 GCCGGTGCGCGAAGTTTGCTCGG No data
1048981101_1048981111 0 Left 1048981101 8:139703726-139703748 CCAGCGCCCACCCGGGCGCGCGG No data
Right 1048981111 8:139703749-139703771 GTGCGCAGCGGGGTCCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048981101 Original CRISPR CCGCGCGCCCGGGTGGGCGC TGG (reversed) Intergenic