ID: 1048982090

View in Genome Browser
Species Human (GRCh38)
Location 8:139708029-139708051
Sequence ATGCTGCAGCTGAATGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048982090_1048982098 12 Left 1048982090 8:139708029-139708051 CCAAACTCATTCAGCTGCAGCAT No data
Right 1048982098 8:139708064-139708086 ACTGTGCTTTGGGGAATTGCTGG No data
1048982090_1048982096 3 Left 1048982090 8:139708029-139708051 CCAAACTCATTCAGCTGCAGCAT No data
Right 1048982096 8:139708055-139708077 GTCCTGAGGACTGTGCTTTGGGG No data
1048982090_1048982094 1 Left 1048982090 8:139708029-139708051 CCAAACTCATTCAGCTGCAGCAT No data
Right 1048982094 8:139708053-139708075 GGGTCCTGAGGACTGTGCTTTGG No data
1048982090_1048982095 2 Left 1048982090 8:139708029-139708051 CCAAACTCATTCAGCTGCAGCAT No data
Right 1048982095 8:139708054-139708076 GGTCCTGAGGACTGTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048982090 Original CRISPR ATGCTGCAGCTGAATGAGTT TGG (reversed) Intergenic
No off target data available for this crispr