ID: 1048985435

View in Genome Browser
Species Human (GRCh38)
Location 8:139732375-139732397
Sequence TCTTTGCCAGGTTCCTCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 256}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048985435_1048985447 30 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985447 8:139732428-139732450 GGGTCTGCACCCCAATGGAGGGG No data
1048985435_1048985446 29 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985446 8:139732427-139732449 GGGGTCTGCACCCCAATGGAGGG No data
1048985435_1048985445 28 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985445 8:139732426-139732448 AGGGGTCTGCACCCCAATGGAGG No data
1048985435_1048985443 10 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985443 8:139732408-139732430 GGCTAGAGCTATGACTCAAGGGG No data
1048985435_1048985441 8 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985441 8:139732406-139732428 GTGGCTAGAGCTATGACTCAAGG No data
1048985435_1048985442 9 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985442 8:139732407-139732429 TGGCTAGAGCTATGACTCAAGGG No data
1048985435_1048985444 25 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985444 8:139732423-139732445 TCAAGGGGTCTGCACCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048985435 Original CRISPR TCTTTGCCAGGTTCCTCTTC CGG (reversed) Intronic
900715535 1:4141279-4141301 TCTTTTCTAGGTTTCTCTTTAGG + Intergenic
901209047 1:7514280-7514302 TCTTTGCTTGTTTCCTCTTGGGG - Intronic
901574174 1:10186610-10186632 CATTTGCCACGTTCCTCCTCTGG + Intergenic
901718500 1:11176161-11176183 TGTTCTCCAGGTTTCTCTTCAGG - Intronic
902246848 1:15126468-15126490 TTCTGGCCAGGTTCCTCTCCAGG + Intergenic
902693183 1:18123288-18123310 TCTTTGCCAGGGTTCTCTAGAGG - Intronic
902982797 1:20137949-20137971 GCTTTGCCAGCCTCCTCTTCTGG - Intergenic
903723811 1:25426020-25426042 TCTGTGCCTGTTTCCTCATCTGG + Intronic
904108304 1:28104918-28104940 TTATTGCCAGATTCCTATTCAGG - Intergenic
905979786 1:42213793-42213815 TCTTTGCCTGTTCCCACTTCTGG - Intronic
906685943 1:47763419-47763441 TCTTTCCCAGATCCCTCCTCTGG - Exonic
908636892 1:66176937-66176959 TCCTTGCCAGGTTCCTGTCTAGG + Intronic
908766979 1:67563062-67563084 TCTTTTCCAGGGTCCCATTCAGG - Intergenic
909007047 1:70289376-70289398 TGTTTGCCAGTTGCCTCTTCTGG - Intronic
909412385 1:75370131-75370153 TCTTTGCCAGGTTCCAGGCCTGG - Intronic
911331018 1:96525890-96525912 TCTTTGCCATGCTCCTACTCAGG + Intergenic
912682851 1:111739838-111739860 ACCTTCCCAGGGTCCTCTTCGGG - Intronic
912750986 1:112287382-112287404 ACATTGCCAGGTGCCTCTCCTGG - Intergenic
913132250 1:115851348-115851370 TTTTTGCCAGGTTTGTGTTCAGG + Intergenic
913331552 1:117672072-117672094 TCTGTGTCTGGTTCCTCTCCTGG + Intergenic
915533552 1:156519097-156519119 TCTGTGCCAGGATCCAGTTCAGG + Intergenic
915734034 1:158073338-158073360 TCTTTGTCATGTTCCTATTCAGG + Intronic
917646047 1:177029699-177029721 TCTGTGCCAGAATCCCCTTCAGG + Exonic
918301179 1:183205224-183205246 TCCTTGCGAGGTTCTTCATCTGG - Intronic
919780498 1:201217737-201217759 TTTTTGCCAGATTCTTCTTTGGG - Intronic
919808963 1:201397288-201397310 TCTGTTCCAGGTGCCTCATCAGG + Intronic
924306118 1:242690778-242690800 TCTGTGCCAGGTAACTCTCCGGG - Intergenic
924541174 1:244982120-244982142 TAGGTGCCAGATTCCTCTTCAGG - Intronic
924909765 1:248497678-248497700 TATCTGCCATCTTCCTCTTCTGG + Intergenic
924914337 1:248550382-248550404 TATCTGCCATCTTCCTCTTCTGG - Intergenic
1064465471 10:15575526-15575548 TCTTTGTGGGGCTCCTCTTCTGG + Exonic
1065058186 10:21869108-21869130 TCTTTTCCAGATATCTCTTCTGG + Intronic
1067272474 10:44804286-44804308 TCTCAGCCAGGCTCATCTTCGGG + Intergenic
1068933818 10:62617272-62617294 TTTGTGCCAGGATCCTCTTCTGG - Intronic
1070734833 10:78856280-78856302 TCTTTCCCAGGCTTCTCTCCAGG - Intergenic
1071060741 10:81569422-81569444 TCTTTGGGATGTTACTCTTCTGG + Intergenic
1071221765 10:83475364-83475386 TCTGTTCTAGGATCCTCTTCAGG - Intergenic
1071422626 10:85515836-85515858 TCCTTGCCAGGCCCTTCTTCTGG - Intergenic
1072830601 10:98654082-98654104 TCATTGCCTTGTTCCTCTTTAGG + Intronic
1073451696 10:103613408-103613430 TCTTTGCCTGATCCCTCTTGGGG + Intronic
1073637854 10:105218084-105218106 TGTTTGCCAGGGACCTCTTAAGG - Intronic
1074422079 10:113317883-113317905 CCTTTGCCAAGAGCCTCTTCTGG + Intergenic
1075308357 10:121389200-121389222 TCTGTTCCAGGATCCTATTCAGG - Intergenic
1075980745 10:126737048-126737070 TCCTTCCCAGGCTCCTCTGCTGG + Intergenic
1076016214 10:127029350-127029372 CCTTTGCTAGCCTCCTCTTCAGG - Intronic
1076062645 10:127425864-127425886 TGTTTTCCAGATTCCTTTTCTGG + Exonic
1076241835 10:128914749-128914771 TCTTTGCCAGTGTCATCTCCCGG + Intergenic
1077117671 11:892614-892636 TCGTGGCCAGGTTCCTCCCCTGG - Intronic
1077611502 11:3645711-3645733 TATGTGCCTGGCTCCTCTTCTGG - Intronic
1078477716 11:11646228-11646250 TCTTTTTCATGTTCCTCCTCTGG - Intergenic
1079711608 11:23690332-23690354 TTTCTTCCAGCTTCCTCTTCAGG - Intergenic
1079882300 11:25943706-25943728 TCTCTGCCATCTTCCTCTTCTGG + Intergenic
1080049813 11:27847932-27847954 CCTTTGCCTGTTTCCTTTTCAGG - Intergenic
1080708215 11:34719562-34719584 TCTTTCCCAGGCTCCTTTCCTGG - Intergenic
1081668258 11:44929144-44929166 TCTTTGCCATGTGCCTCTTCCGG + Exonic
1081910333 11:46696144-46696166 TCTCTCCCAGGTTTCTCTTAAGG - Exonic
1083176621 11:60954130-60954152 TCTTTGCTACTTTCCTCTCCTGG - Intergenic
1084637971 11:70405757-70405779 TCTTTGCCTGGTACTTTTTCAGG - Intronic
1086275072 11:85117227-85117249 TCTTTGGAAGTTTCCCCTTCTGG - Intronic
1088692775 11:112342050-112342072 TCTTTCCCAGGTCCATCCTCTGG + Intergenic
1088994135 11:114981833-114981855 GCTATGCCAGTTTCCTCATCTGG + Intergenic
1090764919 11:129868278-129868300 TCTTTGCCACTTTCCTTTTGAGG - Intronic
1091509568 12:1108132-1108154 TCCTTGGTAGGTTCTTCTTCTGG + Intronic
1092050471 12:5466090-5466112 TCCCTTCCAGGTTCCTTTTCTGG - Intronic
1093448698 12:19290573-19290595 TCTTGGCAAGTTTCCTCTTATGG - Intronic
1094544255 12:31389919-31389941 TCTTTGTCAGGTACTTATTCAGG - Intronic
1095913671 12:47454909-47454931 TCTTTTCCTGGTTTCTCTTGTGG + Intergenic
1095935514 12:47676278-47676300 TCTTTTCCTGGTTTCTCTTGTGG - Intronic
1096113993 12:49044450-49044472 TCTTTGCCAGGCTCCACATCAGG + Exonic
1096194963 12:49643885-49643907 TCCTTGCCAGCTTTCTCCTCAGG - Exonic
1097007491 12:55929572-55929594 TTTTTGCCCTGTTCCTCCTCAGG - Intronic
1099768044 12:87015478-87015500 TGTTTGTCAGGTTTCTCTGCTGG + Intergenic
1103796969 12:123509991-123510013 TCTTTCCCACCTTCCTCATCGGG - Intronic
1110006491 13:70277634-70277656 TATTTGCCATCTTGCTCTTCTGG + Intergenic
1110125372 13:71935665-71935687 TCACTGCCAGGTTTCTCATCTGG - Intergenic
1110710857 13:78649279-78649301 TCCTTGTCAGTTTCCTCTGCTGG - Intronic
1112534954 13:100244105-100244127 TATTTGCCAATTTCGTCTTCAGG + Intronic
1113593745 13:111517858-111517880 CCTTTGCCAGCTTCCTCACCTGG + Intergenic
1115270283 14:31544067-31544089 TCTGCTCCAGGATCCTCTTCAGG + Intronic
1116638731 14:47433298-47433320 TCTTGGCTAGGATCGTCTTCTGG + Intronic
1117237380 14:53792607-53792629 TCTTCCCCATGTTCCTCCTCAGG - Intergenic
1119439326 14:74617691-74617713 TTTTTGCCATTTTTCTCTTCAGG + Intergenic
1121744203 14:96275245-96275267 TCTCTGCCAGATCCCTCTGCTGG - Exonic
1122983505 14:105201992-105202014 CCTGAGCCAGGTTCCTCTCCGGG + Intergenic
1124812596 15:32956104-32956126 TCTCTTCCAGGTTCCTGTTCTGG + Intronic
1127220946 15:56880377-56880399 TCTTTGCCTTGTTCCTATTGTGG - Intronic
1127348191 15:58122573-58122595 TCTTTGTGAAGTGCCTCTTCAGG + Intronic
1127394579 15:58534196-58534218 TCTTTGCCTGGGTACTCTTTGGG - Intronic
1128838778 15:70832620-70832642 TCTTTGGCAGGTTTCTTTTTGGG + Exonic
1131064282 15:89423619-89423641 TCTGAGCCTGGTTCCTCATCTGG - Intergenic
1131084771 15:89566920-89566942 TCTTTGTCACAGTCCTCTTCAGG + Intergenic
1131291317 15:91109592-91109614 TCATGGGCAGGTTCCTTTTCAGG + Intronic
1131574948 15:93579289-93579311 TGTTTGTCAGGTTTTTCTTCTGG - Intergenic
1132351651 15:101143003-101143025 CCTTTGCCAGGTTCCCCTGCAGG - Intergenic
1132875346 16:2134730-2134752 TCTGTGCCAGGCTCCTGTTGGGG - Intronic
1134022865 16:10933525-10933547 TCTGGGCCAGTTTCCTCATCTGG + Intronic
1134519636 16:14912630-14912652 TCTGTGCCAGGCTCCTGTTGGGG + Intronic
1134554295 16:15153605-15153627 TCTGTGCCAGGCTCCTGTTGGGG - Intergenic
1134707308 16:16311286-16311308 TCTGTGCCAGGCTCCTGTTGGGG + Intergenic
1134772284 16:16819944-16819966 TCTTTGTGAGGTGCCTGTTCAGG + Intergenic
1134862032 16:17568752-17568774 TCTTTGCCAGGTGCCCCCTCTGG + Intergenic
1134960233 16:18400839-18400861 TCTGTGCCAGGCTCCTGTTGGGG - Intergenic
1135473857 16:22756191-22756213 TCTTTCCCAGTTTCTTCTTCTGG - Intergenic
1136092586 16:27931100-27931122 ACTTTGCCAGGTATCTCTCCAGG + Intronic
1136776700 16:32875655-32875677 TCTAAGCCAGGTCCCTCTCCTGG + Intergenic
1136893917 16:33985858-33985880 TCTAAGCCAGGTCCCTCTCCTGG - Intergenic
1136934642 16:34448886-34448908 TCTTTGACAAGTTCCTCTAAAGG + Intergenic
1136969930 16:34962928-34962950 TCTTTGACAAGTTCCTCTAAAGG - Intergenic
1137736556 16:50728751-50728773 TGTTTCCCAGGTTGCTCTTTTGG - Intronic
1138088333 16:54154267-54154289 ACTTTGCACGGTTCCTCTTCAGG + Intergenic
1138281397 16:55774491-55774513 TCCTTGCCAGGGTCCTGTGCAGG - Intergenic
1139839625 16:69868020-69868042 TCTTTGGCAGTTTCCTCTCTTGG - Intronic
1141457329 16:84152029-84152051 CCTTTCCCAGCTTCCTCCTCAGG - Intronic
1203079115 16_KI270728v1_random:1137764-1137786 TCTAAGCCAGGTCCCTCTCCTGG + Intergenic
1144075881 17:11719105-11719127 TCCCTGACAGGTTCTTCTTCTGG - Intronic
1144278627 17:13701675-13701697 TCTGTGCCAGTTTCCTCATCTGG - Intergenic
1144420336 17:15091993-15092015 TGTTTGCCAGCTCCATCTTCTGG + Intergenic
1145272425 17:21411920-21411942 TCTATGCCAGGGTCCCCTTCTGG + Intronic
1145310633 17:21699385-21699407 TCTATGCCAGGGTCCCCTTCTGG + Intronic
1145834730 17:27945625-27945647 TCATTGCCAGTCTCCTCTTGAGG - Intergenic
1151049550 17:70961612-70961634 TCTATACCAGAATCCTCTTCCGG - Intergenic
1151745894 17:76011650-76011672 CCTTTGCAAGGTTCTTCTCCTGG + Exonic
1151845546 17:76652038-76652060 TCTTTGCATTGTTCCTCGTCTGG - Intergenic
1154983713 18:21527542-21527564 TCTTTGCCATGATCTTTTTCTGG + Intergenic
1155845062 18:30695466-30695488 TCTGTGCCAGTTTTCTCTGCAGG - Intergenic
1156308929 18:35905001-35905023 TCTTTTACAGCTTCCTCATCGGG - Intergenic
1156425561 18:37008152-37008174 CCTTTTCCTGGTTCCTCTTGTGG - Intronic
1157229225 18:45898624-45898646 TCCTTCCCACGTTCATCTTCAGG + Intronic
1158401091 18:57122147-57122169 TCTTTGCTGGGTTGCGCTTCCGG - Intergenic
1161169771 19:2807003-2807025 TCTTGGCCATGTTCATCTCCAGG - Exonic
1161770176 19:6226752-6226774 TCTTTGCCCTGTTCATCTTGAGG - Intronic
1162498397 19:11036192-11036214 TCTTTTCAGGGTTTCTCTTCTGG - Intronic
1162579786 19:11522080-11522102 TCGTTGCCAAGTCCCACTTCTGG + Intronic
1164401564 19:27905578-27905600 TCTGTTCCAGGTGCCTCATCAGG + Intergenic
1164557349 19:29263725-29263747 TCTTTGTCTGTTTCCTCATCTGG - Intergenic
1164670125 19:30067723-30067745 GCTTGGCCAGATTCCTTTTCTGG - Intergenic
1164890111 19:31816223-31816245 TGTTTGTTAGGTTCCTCCTCAGG + Intergenic
1164906518 19:31972761-31972783 TCTATGCCATGTTCCCCTGCAGG - Intergenic
1165901226 19:39170184-39170206 TCTGTGTCAGGTGCCTCCTCCGG - Intronic
1167605223 19:50478358-50478380 TCTGAGCCCGTTTCCTCTTCTGG - Intronic
1167866307 19:52331461-52331483 TCTCTGCCAGGATCCTGTCCAGG - Intergenic
925845451 2:8029195-8029217 CCTTTTCCAGCCTCCTCTTCAGG - Intergenic
925955100 2:8955459-8955481 TGTTTGCCAGCATTCTCTTCAGG + Intronic
926356575 2:12046330-12046352 TCTTTGCCAGCTTCCAGATCAGG - Intergenic
927063557 2:19446827-19446849 TCTTTTCCAGGTGACTCTCCTGG - Intergenic
927106998 2:19836343-19836365 CCTTTGCCAGCTTCCTCTTGAGG - Intergenic
928450968 2:31378364-31378386 TCTGTGTCAGGTTCCTTTTGAGG + Intronic
928479456 2:31667302-31667324 TCTGTGTCAGGTTCCTTTTGGGG - Intergenic
929668145 2:43849743-43849765 TCTCTCCCAGGTTTCTCTCCTGG + Intronic
930022045 2:47007549-47007571 TCTGTGCCACGTTCCATTTCTGG + Intronic
932031772 2:68194988-68195010 TCTTTTCCAGGATTCTCTCCTGG - Intronic
932320002 2:70815027-70815049 GCTTTGCCCGGTTCCTGGTCTGG - Intronic
933492107 2:82998599-82998621 TCTGTTCCAGGATCCTTTTCAGG + Intergenic
934903861 2:98182151-98182173 TCTTTCCCAGGTGTCTCCTCTGG - Intronic
935725171 2:106017767-106017789 GCTTTCCCAAGTTCCTCTCCTGG - Intergenic
936461615 2:112718455-112718477 CCTTCTCCAGGTACCTCTTCTGG - Intergenic
938990101 2:136619148-136619170 TCTTTTCCAAGTTCTTTTTCTGG + Intergenic
940355014 2:152731185-152731207 GCTTTGCCACATCCCTCTTCTGG + Intronic
943525716 2:189014626-189014648 GCTTTGCCAGGTTGCTTTTAGGG + Intergenic
946579902 2:221117134-221117156 TCTTTGCCAGATTCTTCTCCTGG + Intergenic
947602476 2:231462970-231462992 TCTTTTACATGTTCCTCTGCAGG - Intronic
948633715 2:239319580-239319602 TCTTTGCCAGGTTCCTGCCTGGG - Intronic
948891784 2:240910314-240910336 TCTGTGCTGGGTTCCTCGTCCGG - Intergenic
1169048833 20:2559234-2559256 TCTGGGCCAGTTTCCTCTGCTGG + Intronic
1169155654 20:3327499-3327521 TCCTTGCCAGATGCCTCTCCTGG - Intronic
1170967757 20:21090943-21090965 TCTTTGCCCGGGTCTTCTCCTGG + Intergenic
1171393375 20:24815619-24815641 ACTTTGCCGGGTTCCTCTGGTGG - Intergenic
1171946295 20:31380906-31380928 TCTTTTGCAGATTTCTCTTCAGG + Intronic
1172969586 20:38863539-38863561 CCCTTTCCAGGTTCCTGTTCTGG + Intronic
1174398783 20:50264662-50264684 GGGTTCCCAGGTTCCTCTTCTGG + Intergenic
1175088489 20:56481940-56481962 TTTCTGCTAAGTTCCTCTTCTGG - Intronic
1175474216 20:59258296-59258318 CTTCTGCAAGGTTCCTCTTCCGG - Exonic
1176939621 21:14909075-14909097 TTTTTGACAGGTTCATCTTTTGG + Intergenic
1177400505 21:20597477-20597499 TCTTTGCCAGATTCCTATTTTGG - Intergenic
1178104826 21:29306269-29306291 TCCTTGGCAAGTTCCTCTTATGG + Intronic
1179915950 21:44478397-44478419 TCTTTCCAAGGTTGCTCTTCTGG - Intergenic
1181113807 22:20618534-20618556 TCCTTGCCAGGTGTCTCATCAGG - Intergenic
1181840192 22:25651017-25651039 TTTTTGCCAACTTCCTCTTTTGG - Intronic
1182644014 22:31792672-31792694 GTTTTGTCAGCTTCCTCTTCTGG - Intronic
1184117881 22:42432512-42432534 TCAGTGCCAGGTTCCTCATCTGG - Intergenic
950004823 3:9684943-9684965 CCTATGACTGGTTCCTCTTCGGG + Exonic
950158348 3:10740646-10740668 TCTTTCCCAGGGTCTTCTCCTGG + Intergenic
950201282 3:11046179-11046201 TCTGGGCCAGGTTCCATTTCCGG - Intergenic
950829798 3:15861659-15861681 TCTTTGCCATGTTCCTAATCAGG - Intergenic
951649457 3:24934183-24934205 TCTTTGCCGGTTCCCTCCTCTGG - Intergenic
952605618 3:35144212-35144234 ACTTTGGCAAGTGCCTCTTCTGG + Intergenic
955204322 3:56881781-56881803 TCCTTACCAGTTTCCTCATCTGG - Intronic
956024666 3:64970173-64970195 TCTCTGCCAGGTCCATCTTATGG - Intergenic
956033752 3:65067870-65067892 TCTGTTCCAGGATCCTCTTCAGG + Intergenic
956340438 3:68217105-68217127 TCTTTGCCAGGTTTCTCTATTGG - Intronic
956368895 3:68536760-68536782 TCATTGCCAGCTTCCTATTGTGG + Intronic
956497765 3:69847037-69847059 TCTTTGACTGTTTCCTCTTGAGG + Intronic
958884573 3:99711496-99711518 TCAGTTCCAGGTTCCTATTCTGG + Intronic
961317573 3:126050969-126050991 TCATCTCCAGGTTCCCCTTCAGG + Exonic
963927438 3:150965995-150966017 GTTCTGCCAAGTTCCTCTTCTGG + Intronic
965053363 3:163681058-163681080 TGTTTATCAGGTTCCTCTACTGG - Intergenic
965646980 3:170894329-170894351 TCTTTGCCTAGTTCACCTTCTGG + Exonic
969096036 4:4733699-4733721 TCTGTCCCAGGTTCTGCTTCTGG - Intergenic
970798505 4:19944485-19944507 TCTAAGCCAGATTCCTGTTCAGG + Intergenic
973118046 4:46485971-46485993 TCTTTGCCTGGTACCACTCCTGG - Intergenic
973546905 4:51991327-51991349 TCTTTCTCAGGCTCCTTTTCTGG - Intergenic
975643478 4:76524063-76524085 TCTTTGCCTTGTTTCTCCTCTGG - Intronic
977911462 4:102541911-102541933 GCGTTTCCAGGTTCCTCTCCAGG - Intronic
981141887 4:141278481-141278503 TCTTCAGCTGGTTCCTCTTCTGG + Intergenic
982426591 4:155269792-155269814 TTTTTTCCACGTTCCTCTTCAGG + Intergenic
985519088 5:362766-362788 TCTTGGCCAGATTCATCTTTTGG - Intronic
985614399 5:910847-910869 TCTGTGCCTTGTTCCTCTGCCGG + Intronic
985804207 5:2029100-2029122 TGTTTGCCAGGTTCAACATCTGG + Intergenic
986605691 5:9520893-9520915 TCTGTGCCAGGATCCTGTGCAGG - Intronic
987829556 5:23077633-23077655 TCTATACCAGTTTCCTCTTCTGG - Intergenic
988374657 5:30420318-30420340 TCTGTTCCAGGATCCTATTCAGG + Intergenic
989643255 5:43603394-43603416 TCTTTGACAGGTCTCTCTCCCGG - Intronic
990979800 5:61592449-61592471 TCTTAGCCAGGTCCCTCTCCTGG + Intergenic
992901064 5:81296774-81296796 TCTTTACCAGATTCCTCTGGGGG + Intergenic
993128066 5:83859829-83859851 TCTTTTCCAGGTTGCTCTCCGGG + Intergenic
995182019 5:109238314-109238336 TCCCTCCTAGGTTCCTCTTCCGG + Intergenic
995434420 5:112119813-112119835 TCTTTTCCCAGTTCCTTTTCTGG - Intergenic
996021644 5:118597257-118597279 TATTTCCAATGTTCCTCTTCTGG - Intergenic
996325246 5:122265972-122265994 TCTTTGTGAGGTGCCTCTTCAGG + Intergenic
996343700 5:122467131-122467153 TCTTTGCCAGGTTTCTTTCAAGG - Intergenic
997863696 5:137442795-137442817 TTGTTGCTAGGTTCCTTTTCTGG + Intronic
1000401348 5:160831351-160831373 ACTTTCCTAGTTTCCTCTTCTGG + Intronic
1001206873 5:169771975-169771997 TCTTTCCCAGCTTCATCTGCTGG + Intronic
1007219451 6:40266932-40266954 TCTAGGCCAGTTTTCTCTTCTGG - Intergenic
1007280571 6:40709384-40709406 TCCTCCCCAGGTTCCTCATCAGG - Intergenic
1009578689 6:65502618-65502640 TCTTTTCTAGGATCCTATTCAGG + Intronic
1012998292 6:105994705-105994727 TCTTTGCCCGGATCCTCCTGCGG + Intergenic
1014251168 6:119116897-119116919 TCCTCCCCAGGGTCCTCTTCTGG - Intronic
1015019756 6:128459112-128459134 TCTTTGGCAGGCTCCTCATTTGG + Intronic
1016516298 6:144896099-144896121 GCTCTGCCAGGTTTCTCTCCAGG - Intergenic
1017138318 6:151167643-151167665 TCTTTTGCTGGTTCCTCCTCTGG - Intergenic
1018053458 6:160031583-160031605 TCTGTGCCTGGTTTCTCTTACGG + Intronic
1018320065 6:162599078-162599100 TCTTTTCCAGTTTCCATTTCTGG + Intronic
1018799899 6:167213893-167213915 TCTGTGCCAGGATCCTGTCCTGG - Intergenic
1018813106 6:167311994-167312016 TCTGTGCCAGGATCCTGTCCTGG + Intronic
1018840071 6:167510094-167510116 TCTTTGCCAGGCTCATGTTGGGG - Intergenic
1019367993 7:645064-645086 TCCCTGCCAGATTTCTCTTCCGG - Intronic
1022208322 7:28183946-28183968 TGTTTTCCAGGTCCCTCTTGAGG + Intergenic
1027978415 7:85186704-85186726 TCTTTTCCTGGTGCCTTTTCAGG + Intronic
1028461076 7:91093430-91093452 TCTTTGCCAATCTCCCCTTCAGG - Intronic
1028483892 7:91337410-91337432 ACTTTTCAAGCTTCCTCTTCTGG - Intergenic
1030121809 7:106117549-106117571 TGGTTGTGAGGTTCCTCTTCAGG - Intergenic
1030986707 7:116250229-116250251 GCTTTGCCAGCTGCTTCTTCCGG - Exonic
1031469047 7:122147231-122147253 CCTTAGGTAGGTTCCTCTTCAGG - Intergenic
1033543780 7:142381413-142381435 TCTGTGCCAGGTGCCTCTGCAGG + Intergenic
1033551437 7:142451608-142451630 TCTGTGCCAGGTGCCTCTGCAGG + Intergenic
1033555904 7:142488457-142488479 TCTGTGCCACGTGCCTCTGCAGG + Intergenic
1033558285 7:142507970-142507992 TCTGTGCCAGGTGCCTCTGTAGG + Intergenic
1034279445 7:149842594-149842616 TCCTAGCCATGTTCCTCCTCAGG + Intronic
1034912587 7:155009529-155009551 TATTTCCCAGGTTCCTCATCAGG + Intergenic
1035146280 7:156820915-156820937 CCTTTGGCAGGTTCCTCTCAAGG + Intronic
1038622752 8:29159586-29159608 ACTTTGCCAGGTTCCTGTGAGGG - Intronic
1040071618 8:43193148-43193170 TCTCAGACAGGTGCCTCTTCTGG - Intronic
1040448995 8:47525329-47525351 TGTTTTCCAGGCTCCTATTCTGG - Intronic
1041148684 8:54908409-54908431 TCTTTGAGAGGTGCCTTTTCTGG - Intergenic
1041795308 8:61741339-61741361 TCTGTTCCAGGATCCTATTCAGG + Intergenic
1042697419 8:71570916-71570938 TCTTTCCCAGGCTCCTATACTGG - Intronic
1044475977 8:92627050-92627072 TCTTTAGCAGTTTCCTCTTTAGG + Intergenic
1044841235 8:96338801-96338823 TCTGTGCCAGGCTCCTCCCCTGG + Intergenic
1045836878 8:106533025-106533047 TCTTTTCCAGGATCCTATCCAGG + Intronic
1046729937 8:117713819-117713841 CCTTGTCCAGGTTCCTCTCCAGG - Intergenic
1047808168 8:128380379-128380401 TTTTTGTCTGGTTCCTTTTCAGG + Intergenic
1048218645 8:132520343-132520365 TCTTTTCCATTTTTCTCTTCGGG - Intergenic
1048497972 8:134951018-134951040 TCTTTGCCAGCCTTCTCTGCTGG + Intergenic
1048619777 8:136119000-136119022 TCTTTGCCTGGTCCATTTTCTGG + Intergenic
1048754828 8:137727239-137727261 TCTTTGCCCTCTTCCCCTTCCGG - Intergenic
1048985435 8:139732375-139732397 TCTTTGCCAGGTTCCTCTTCCGG - Intronic
1050598145 9:7224696-7224718 TGTTTCCCAGGTTCCTTTCCTGG + Intergenic
1051572033 9:18569646-18569668 TTTTTGCCAGGTTCTTGTTAGGG + Intronic
1051725252 9:20082334-20082356 TCTTTGGCTAATTCCTCTTCAGG + Intergenic
1052505207 9:29344652-29344674 TCTGTTCCAGGATCCTCTCCAGG + Intergenic
1053326044 9:37152454-37152476 TCTTTTCTAGGATCCTGTTCAGG + Intronic
1054893325 9:70277451-70277473 TCTTTGCCAGTTTCTCCCTCAGG + Exonic
1057985658 9:99711236-99711258 TCTTTTTCAGTTTCCTCTGCTGG + Intergenic
1059922750 9:119177005-119177027 TCTTTGTCAGTTTCCCCTCCAGG + Intronic
1060513189 9:124249034-124249056 GTTTTGCCAGGTTTCTCCTCTGG + Intergenic
1061917556 9:133763171-133763193 TCCCTGCCAGGTCCCTCTCCAGG - Exonic
1188215388 X:27470382-27470404 TCCTACCCAGGTTCCTATTCAGG + Intergenic
1189149403 X:38688970-38688992 TCTTTTCCATCTTGCTCTTCAGG + Intergenic
1189668253 X:43380687-43380709 TCTTTTCCCAGTTCCTCTTGTGG - Intergenic
1190438272 X:50449295-50449317 TCTTTCCCAGGTTCCACTTAAGG - Intronic
1190625419 X:52332901-52332923 TCTTTGTGAGGTGTCTCTTCAGG + Intergenic
1192165249 X:68823877-68823899 TCTTTGCCAGGTCCTCCTCCTGG - Intergenic
1192313710 X:70036119-70036141 TCCTTGGCAGGTTTCTCTTATGG - Exonic
1192333854 X:70201447-70201469 CCTTTGGCAGGTTACTCTTAGGG + Intronic
1194422895 X:93698404-93698426 TTCTTTCCAGGTTCCTTTTCAGG - Intronic
1195339328 X:103890371-103890393 TCCTTCCCAGGTTCCCTTTCAGG - Intergenic
1195432395 X:104804024-104804046 TCATTGCCAAGTCCCGCTTCTGG + Intronic
1196406887 X:115372666-115372688 TCTTAGCCAGGTTGCTTTTTGGG + Intergenic