ID: 1048985435

View in Genome Browser
Species Human (GRCh38)
Location 8:139732375-139732397
Sequence TCTTTGCCAGGTTCCTCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 256}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048985435_1048985446 29 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985446 8:139732427-139732449 GGGGTCTGCACCCCAATGGAGGG No data
1048985435_1048985442 9 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985442 8:139732407-139732429 TGGCTAGAGCTATGACTCAAGGG No data
1048985435_1048985444 25 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985444 8:139732423-139732445 TCAAGGGGTCTGCACCCCAATGG No data
1048985435_1048985441 8 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985441 8:139732406-139732428 GTGGCTAGAGCTATGACTCAAGG No data
1048985435_1048985447 30 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985447 8:139732428-139732450 GGGTCTGCACCCCAATGGAGGGG No data
1048985435_1048985443 10 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985443 8:139732408-139732430 GGCTAGAGCTATGACTCAAGGGG No data
1048985435_1048985445 28 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985445 8:139732426-139732448 AGGGGTCTGCACCCCAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048985435 Original CRISPR TCTTTGCCAGGTTCCTCTTC CGG (reversed) Intronic