ID: 1048985439

View in Genome Browser
Species Human (GRCh38)
Location 8:139732387-139732409
Sequence CCACCACACCCGTCTTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 263}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048985439_1048985446 17 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985446 8:139732427-139732449 GGGGTCTGCACCCCAATGGAGGG No data
1048985439_1048985445 16 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985445 8:139732426-139732448 AGGGGTCTGCACCCCAATGGAGG No data
1048985439_1048985441 -4 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985441 8:139732406-139732428 GTGGCTAGAGCTATGACTCAAGG No data
1048985439_1048985453 29 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985453 8:139732439-139732461 CCAATGGAGGGGCCTCTGGGAGG No data
1048985439_1048985448 25 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985448 8:139732435-139732457 CACCCCAATGGAGGGGCCTCTGG No data
1048985439_1048985454 30 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985454 8:139732440-139732462 CAATGGAGGGGCCTCTGGGAGGG No data
1048985439_1048985447 18 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985447 8:139732428-139732450 GGGTCTGCACCCCAATGGAGGGG No data
1048985439_1048985442 -3 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985442 8:139732407-139732429 TGGCTAGAGCTATGACTCAAGGG No data
1048985439_1048985444 13 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985444 8:139732423-139732445 TCAAGGGGTCTGCACCCCAATGG No data
1048985439_1048985443 -2 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985443 8:139732408-139732430 GGCTAGAGCTATGACTCAAGGGG No data
1048985439_1048985449 26 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985449 8:139732436-139732458 ACCCCAATGGAGGGGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048985439 Original CRISPR CCACCACACCCGTCTTTGCC AGG (reversed) Intronic
900338502 1:2176657-2176679 CCACCCCACCCAACTTTTCCAGG + Intronic
903140294 1:21335168-21335190 CCCCCGCCCCCGTCTTTGCCCGG + Intronic
904051242 1:27640391-27640413 CCACCACACCCAGCTTTAGCTGG - Intergenic
905227383 1:36488118-36488140 CCACCACCACCGTCATTCCCAGG - Intergenic
905376464 1:37524516-37524538 CTACCACGCCCGGCCTTGCCCGG + Intergenic
905669338 1:39780984-39781006 CCCTCACACCCATGTTTGCCAGG + Intronic
906782368 1:48584136-48584158 CCACCACTCTGGTCTTGGCCTGG + Intronic
909502780 1:76353948-76353970 ACAGCACACCCTTCTTTCCCTGG + Intronic
914826924 1:151143636-151143658 CCACCATATCCATCTTTTCCTGG - Intronic
915533837 1:156521948-156521970 CCACCACACCTGGCCTTCCCAGG + Intergenic
915730656 1:158051801-158051823 TCACCACACCCTTCTTCTCCAGG + Intronic
915788076 1:158637826-158637848 CCTCCACACCTGTCTTTCTCTGG + Intronic
916232359 1:162553053-162553075 CCACCACACCCGGCCTTGGCTGG - Intergenic
916749853 1:167714215-167714237 CCACCACCCCTTTCTTAGCCAGG + Intergenic
919879356 1:201891817-201891839 CCACCACAGCCCTCTTACCCGGG + Exonic
919992270 1:202716410-202716432 CCACTACTGCTGTCTTTGCCTGG - Intergenic
920047342 1:203141868-203141890 CCACCACACCCGGCCTAACCTGG + Intronic
920091314 1:203455189-203455211 TCACCACACCCCTGCTTGCCTGG + Intergenic
921091130 1:211844574-211844596 CCACCACACCCGGCCTTGATGGG - Intergenic
921862562 1:220054894-220054916 ACACCACGCCCGGCTTAGCCAGG + Intergenic
921882030 1:220266420-220266442 CCACCCCATCAGTCTGTGCCAGG - Intronic
921936407 1:220800899-220800921 CCCCCACTCCCCTCTCTGCCCGG + Intronic
923623953 1:235599012-235599034 CCACCACACCCGGCCTTCCCAGG + Intronic
1063386282 10:5618211-5618233 CAACCACACCACTCTTTGCAAGG + Intergenic
1064001063 10:11664229-11664251 CCACCGCAGCCTTCTCTGCCTGG - Intergenic
1064060988 10:12137051-12137073 CCACCACACCCTTTTTTATCTGG + Intronic
1068119489 10:52771475-52771497 CCATCACGCCCATCTTTGCCTGG + Exonic
1069944225 10:71974846-71974868 CCACCACTCCCTTCCCTGCCTGG + Intronic
1070048759 10:72866062-72866084 CCACCACGCCCGGCCTTCCCTGG + Intronic
1072908836 10:99481971-99481993 CCACCGCACCCGGCTACGCCTGG - Intergenic
1073132375 10:101197907-101197929 CCACCACACCCGGCTTTAAAAGG + Intergenic
1073140821 10:101246456-101246478 CCACCACACCCGGCCTCTCCTGG - Intergenic
1073246515 10:102094334-102094356 CCACCACGCCCGGCCATGCCCGG + Intergenic
1073615227 10:104988201-104988223 CCACCACACCCCACTCTTCCTGG + Intronic
1074189592 10:111124292-111124314 CCACCAGACCCATCTTGGCTTGG - Intergenic
1075893300 10:125972949-125972971 GCACCACACCCACCTTTTCCGGG + Intronic
1076175568 10:128365253-128365275 CCACCACAGCGCTCTTTGCTGGG + Intergenic
1076287998 10:129320184-129320206 ACACCACATCAGTCTTTCCCAGG + Intergenic
1076778653 10:132711720-132711742 CACCCACACCTGTCTTAGCCTGG + Intronic
1079491050 11:20989703-20989725 CCACCACACCCGGCCTAGACTGG - Intronic
1083263630 11:61536200-61536222 CCCCCACACCCGCCTTTCCCAGG + Intronic
1084018582 11:66402913-66402935 CCACCGCACCCGGCCATGCCTGG + Intergenic
1084403537 11:68958442-68958464 CTGCCACCCCCATCTTTGCCCGG + Intergenic
1084487636 11:69459665-69459687 CCACCACACACGTCTCAGGCTGG - Intergenic
1084488433 11:69464427-69464449 CCACCACACCTGGGGTTGCCAGG + Intergenic
1084849089 11:71924224-71924246 CCACCACACCCAGCTTAGCAAGG - Intronic
1085706283 11:78789216-78789238 TCACCACACCCCACTTAGCCTGG + Intronic
1087079015 11:94152030-94152052 CCTCGACACTCATCTTTGCCTGG - Intronic
1088488241 11:110361949-110361971 CCACCACACCTGGCCTTACCAGG + Intergenic
1089165891 11:116476184-116476206 GCATCACACCCGTCCTTACCTGG - Intergenic
1089472730 11:118733820-118733842 CCACCACACCCGAACTTCCCAGG - Intergenic
1090088487 11:123672514-123672536 CCACCACACCCGGCCTAGCGTGG + Intergenic
1091649423 12:2298840-2298862 CCAGCCCACCCTTCTGTGCCTGG + Intronic
1092188718 12:6501473-6501495 CCACCACACCCGGCCTTACAAGG + Intronic
1096822529 12:54248128-54248150 CCATCACACCCGGCTACGCCTGG + Intronic
1099517413 12:83614742-83614764 CCACCACACCCGTCCTAGAAGGG - Intergenic
1100254247 12:92866037-92866059 CCACCACACCCGGCTGGGCATGG - Intronic
1100837945 12:98584991-98585013 CCACCACGTCCAGCTTTGCCTGG + Intergenic
1100845789 12:98656068-98656090 CCACCGCGCCCGGCCTTGCCTGG + Intronic
1101058786 12:100948999-100949021 CCACCCCACCTTTCTTTGCTAGG - Intronic
1102234608 12:111286446-111286468 CCACCACACCTGGCCTTCCCAGG - Intronic
1104028051 12:125043568-125043590 CCACCACACCCGGCCATGCTTGG - Intergenic
1104433427 12:128735827-128735849 CCACCACGCCCGACCATGCCAGG - Intergenic
1105909509 13:24849035-24849057 CCACCACACTCAGCTTCGCCTGG - Intronic
1106186088 13:27411103-27411125 CCACCACACCTGGCCTTTCCTGG - Intergenic
1106571152 13:30929249-30929271 CCAGCACACCCATCTTCTCCAGG + Intergenic
1108413882 13:50177951-50177973 CCACCACCCCCGGCCTTGTCTGG - Intronic
1108472513 13:50781680-50781702 AGACCACGCCTGTCTTTGCCGGG + Intronic
1112643614 13:101305040-101305062 CCACCGCACCCGGCCTGGCCTGG + Intronic
1113361933 13:109639868-109639890 CCACCACACCCCACTGGGCCTGG + Intergenic
1113748486 13:112762577-112762599 CCAACACACCCGTCTGTAGCTGG - Intronic
1113979468 13:114261509-114261531 ACACCACACCCATCTCTCCCTGG - Intronic
1114624657 14:24121052-24121074 CCCCCTCAGCCCTCTTTGCCAGG + Intronic
1115594759 14:34898703-34898725 CCACCACACCCGACCTAGCTGGG - Intergenic
1115652197 14:35410695-35410717 CCACCACACCCGGCTGTGCCTGG + Intergenic
1116149825 14:41126717-41126739 CCACCACACCCGGACTTGACTGG + Intergenic
1117366710 14:55036629-55036651 CCACCACACCCGGCCATTCCTGG + Intronic
1118851228 14:69585263-69585285 CCACCACGCCCGTCTCACCCAGG - Intergenic
1119386820 14:74262400-74262422 CCACCCCACCCACCTTTGCAGGG + Exonic
1121489148 14:94345622-94345644 CCTCCACACCCCACTTTGCTTGG - Intergenic
1122951656 14:105048236-105048258 CCACCTCACCCGGCTATGCCTGG + Intergenic
1123735506 15:23179433-23179455 CCACTGCACCCGGCTTTTCCTGG + Intergenic
1124286222 15:28402417-28402439 CCACTGCACCCGGCTTTTCCTGG + Intergenic
1124296482 15:28509219-28509241 CCACTGCACCCGGCTTTTCCTGG - Intergenic
1128060063 15:64729787-64729809 CCACCACACCCGGCCATGCCTGG - Intergenic
1128135692 15:65261743-65261765 CCACCACACCCGGCCTTAACAGG + Intronic
1128346593 15:66856953-66856975 CCACCACACCTGGCTTTTCATGG + Intergenic
1129334749 15:74845217-74845239 TCACCCCACCCCTCTTCGCCAGG - Exonic
1129371203 15:75096768-75096790 CCACCGCTCCCGTCCTTGACTGG + Intronic
1130384110 15:83396352-83396374 CCACCTCCCCCTTCTTTGGCAGG - Intergenic
1131211317 15:90499101-90499123 CCACCACACCCGGCCTTGTGGGG + Intronic
1132824852 16:1899198-1899220 CCACCACGCCTGGCCTTGCCTGG - Intergenic
1132940630 16:2506066-2506088 CCACCACACCCGGCCTTGACAGG - Intronic
1134421229 16:14091705-14091727 CCACCACGCCCGGCTTTGGGAGG - Intronic
1135857221 16:26022887-26022909 CCACCACACCCAGCTAAGCCTGG - Intronic
1136534013 16:30888620-30888642 CCACCACGCCCAGCTTTGTCAGG + Intronic
1137959009 16:52862688-52862710 CCACCACACCTGGCCTTGCTGGG + Intergenic
1139912253 16:70405252-70405274 CCACCGCACCAGGCTGTGCCTGG - Intronic
1139965923 16:70745361-70745383 GCACAGCACCCATCTTTGCCTGG + Intronic
1140043251 16:71423537-71423559 CCACTGCGCCCGTCTTTGGCTGG - Intergenic
1141349361 16:83278650-83278672 CCACCTCAACCGGCATTGCCAGG - Intronic
1142195949 16:88739379-88739401 CCACCACACCTGGCTTTCCCTGG - Intronic
1142206613 16:88785773-88785795 CCACCGCGCGCGGCTTTGCCCGG + Intergenic
1142210179 16:88804927-88804949 CCACCAACCCGGCCTTTGCCGGG - Intronic
1142863833 17:2778603-2778625 CCACCACCCCCATCCATGCCAGG - Intronic
1145082763 17:19908790-19908812 CCACCACACCCGGCTAAGACAGG + Intronic
1146166494 17:30593757-30593779 CCACCACACCCGGCCACGCCTGG - Intergenic
1148038468 17:44687153-44687175 CCACCACACCCAGCCATGCCTGG - Intronic
1148560075 17:48601130-48601152 CCACCACCCCCAACTTTGGCTGG + Intronic
1150151106 17:62809297-62809319 CCACCTTGCCCGGCTTTGCCGGG + Intergenic
1150674370 17:67232294-67232316 CCACCATAACCGGCTATGCCCGG + Intronic
1151805601 17:76403018-76403040 CCTCCACAGCCTACTTTGCCAGG - Intronic
1152348867 17:79772036-79772058 CCACCACACCCAGCCATGCCAGG - Intergenic
1152753605 17:82077806-82077828 CCACCCCACCCCTCGATGCCGGG + Intergenic
1153543450 18:6181615-6181637 CCACCACACCCGGCCATGCTGGG + Intronic
1154251251 18:12747002-12747024 CCACCACACACGTGAATGCCGGG - Intergenic
1155004785 18:21718911-21718933 CCACCACACCCAGCCATGCCTGG - Intronic
1156080828 18:33332903-33332925 CCACCACACCCAGCCTTACCTGG + Intronic
1157262168 18:46185697-46185719 CCACCACGCCCGGCCTTACCTGG - Intronic
1157527883 18:48398726-48398748 CCCCCACCCCCACCTTTGCCTGG + Intronic
1157748649 18:50159415-50159437 CCCTCACACCCATCTTTCCCAGG + Intronic
1158898228 18:61935858-61935880 CCACCATGCCCGGCTTTGCATGG - Intergenic
1159590988 18:70334810-70334832 ACACCACACCCATCATCGCCAGG - Intergenic
1160425925 18:78779110-78779132 CCATCACACCCGGCTCAGCCTGG + Intergenic
1161110740 19:2468416-2468438 CCACCACACCCCGCTATGCAGGG - Intergenic
1162367989 19:10260984-10261006 CCACCACTCCCGGCTTGGCCAGG - Intergenic
1162513556 19:11134631-11134653 CCACCACACCTGGCCTAGCCTGG + Intronic
1162612325 19:11766522-11766544 CCACCACGCCCGGCTTTGTTGGG + Intergenic
1162773779 19:12966367-12966389 CCACCACGCCCAGCCTTGCCCGG + Intronic
1163772824 19:19201084-19201106 CCACCACACCCGGCTGCACCTGG + Intronic
1165039150 19:33056743-33056765 CCACCGCACCCAGCTTTCCCTGG - Intronic
1165446489 19:35859647-35859669 GCCCCACACCCCTCTTTCCCAGG - Intronic
1165584560 19:36902557-36902579 CCACCACACCCGCCTCTCCCAGG - Intronic
1166882640 19:45938761-45938783 CCTCCACACCCTTCTTTGGTGGG - Exonic
1167050962 19:47078329-47078351 CCACCATGCCCGTCCGTGCCTGG - Intronic
1167060869 19:47145286-47145308 CCACCGCACCCGGCCATGCCTGG + Intronic
1167067376 19:47196647-47196669 CCACCGCACCCGGCTCTTCCAGG + Intronic
1167440792 19:49507684-49507706 CCACCGCGCCCGGCCTTGCCAGG + Intronic
1167446089 19:49538452-49538474 CCACCACGCCCGGCCATGCCTGG + Intronic
1167683170 19:50938344-50938366 CCACCCCACCAGTCTGTGACTGG + Intergenic
1168624310 19:57904761-57904783 CCACCACTCCCGGCGATGCCTGG - Intronic
1168697481 19:58412494-58412516 CCACCACGCCCGGCCTGGCCAGG + Intronic
925639182 2:5971202-5971224 CATCCACACCCTTCTTTACCTGG + Intergenic
926237193 2:11054816-11054838 CCACCACTTCCTTCTTTGCCTGG + Intergenic
926862082 2:17320499-17320521 CCCCCACAGCCGTCTTTTCAGGG - Intergenic
927142541 2:20140064-20140086 CCACAGCACCCGGCTTTGCAGGG + Intergenic
927553348 2:24017061-24017083 CCTCCCCACCCGCCTGTGCCTGG + Intronic
928225806 2:29447118-29447140 CCTCCACCCACGTGTTTGCCAGG - Intronic
929781388 2:44959465-44959487 CCACCGCACCCGGCACTGCCTGG - Intergenic
929977100 2:46645647-46645669 CCAACAAACTCATCTTTGCCTGG + Intergenic
930071043 2:47366572-47366594 CCACCACACCCGGCTGATCCAGG - Intronic
934133632 2:88972851-88972873 CCCCCACAGCAGTCTCTGCCTGG + Intergenic
934138666 2:89022933-89022955 CCCCCACACCTGCCTCTGCCTGG + Intergenic
934144755 2:89080994-89081016 CCCCCACACCAGCCTCTGCCTGG + Intergenic
934224502 2:90119557-90119579 CCCCCACACCAGCCTCTGCCTGG - Intergenic
935128010 2:100240932-100240954 ACACCACACCCGTGTTTTGCTGG + Intergenic
935259729 2:101344006-101344028 CCATCACACCTGTCTCTACCTGG + Intergenic
938092133 2:128440983-128441005 CCACCCCAGCCTTCCTTGCCCGG + Intergenic
938457715 2:131477320-131477342 CCACCACACCCAGCTTGGCAGGG + Intronic
939855134 2:147349742-147349764 CCACCACACCCGGCCCTTCCTGG - Intergenic
942401738 2:175610129-175610151 GCACCACACCCTGCTTTGACTGG + Intergenic
942694869 2:178630289-178630311 CCACCCCACCCGTCTGGTCCAGG + Exonic
943507822 2:188783791-188783813 CCACCGCACCCGGCCTTGCTGGG + Intronic
946732482 2:222722887-222722909 CCACCACACCCGGCCCAGCCTGG - Intergenic
947751532 2:232535247-232535269 CCACCACCCCAGCCTTTTCCTGG + Exonic
948289740 2:236816315-236816337 CGCCCACACCTGTGTTTGCCGGG - Intergenic
948804372 2:240447112-240447134 CCCCCAGCCCCGTCTCTGCCTGG - Intronic
1169900611 20:10548524-10548546 CCACCACACCCGGCCTCTCCAGG + Intronic
1173019807 20:39257690-39257712 CCACCACACCCGGCTGTGTATGG + Intergenic
1173521263 20:43701972-43701994 CCACCACACCCATATTGGCCAGG - Intronic
1175225036 20:57439696-57439718 CCAACTCACCCAGCTTTGCCCGG - Intergenic
1175641618 20:60635097-60635119 ACACCACTCCCGTCTTTCCTGGG + Intergenic
1175751938 20:61504585-61504607 CCACCACACGTGTCTGCGCCTGG - Intronic
1175973570 20:62699200-62699222 CCACCTCTCACATCTTTGCCTGG - Intergenic
1176043775 20:63082063-63082085 CCACCACTCCAGCCTCTGCCTGG + Intergenic
1179076479 21:38127020-38127042 CCCACACACCTGTCTTTGCTAGG + Intronic
1179533044 21:42033084-42033106 CCACCATCCCAGTGTTTGCCGGG + Intergenic
1180655992 22:17421326-17421348 CCACCGCGCCCGGCCTTGCCTGG - Intronic
1181724532 22:24802825-24802847 CCACCACGCCTGTGTTGGCCAGG + Intergenic
1183016489 22:34992444-34992466 CCACCACCCCCGTCTTTTCATGG + Intergenic
1183488370 22:38102750-38102772 CCACCGCACCCGGCCGTGCCTGG - Intronic
1183730876 22:39617767-39617789 CCACCGCACCCCTCCTTTCCCGG + Intronic
1184324935 22:43775729-43775751 CCACCGCACCCGGCCATGCCTGG + Intronic
949820348 3:8109577-8109599 CCACCACACCCGGCTGACCCCGG + Intergenic
951193413 3:19797086-19797108 CCACCTCACCCAGCCTTGCCTGG - Intergenic
954026415 3:47786716-47786738 CCACCGCACCCGGCCATGCCTGG - Intergenic
954300160 3:49696931-49696953 CCACCACACCCGGCCTGGACTGG + Intronic
955928369 3:64030495-64030517 CCACCACACCCGGCTTTTTTGGG + Intergenic
962290982 3:134136153-134136175 CCAGAACACCAGTTTTTGCCAGG - Intronic
962696297 3:137950725-137950747 TCACCACACCCTTCCATGCCTGG + Intergenic
962806584 3:138931698-138931720 CCACCAGCCCCTTCTTTTCCAGG - Intergenic
968178126 3:196568830-196568852 CCACCACTCCCGCCCCTGCCCGG - Exonic
968504136 4:964210-964232 CCCCTACACCCGGCCTTGCCTGG - Intronic
969318534 4:6396347-6396369 CCACCACACCCCTCTCAGCTGGG + Intronic
969444575 4:7236983-7237005 CCACCCGACCAGTCTTTCCCAGG - Intronic
970990739 4:22210124-22210146 TCACCATACCCGTCTTTATCAGG - Intergenic
973271783 4:48269682-48269704 CCTCCCCACCCGTCCTCGCCCGG + Intronic
975679576 4:76862655-76862677 CCACCACACCCGGCCTTATCTGG + Intergenic
976094588 4:81494849-81494871 CCACCACACCCGGCTACACCCGG + Intronic
976181843 4:82406737-82406759 CCACCACACCCGGCTGTCTCTGG - Intergenic
980044163 4:127970168-127970190 CCACCACACCCAGCCTAGCCAGG + Intronic
980970112 4:139559630-139559652 CTACCACCCCTGTCTTTCCCTGG + Intronic
981251203 4:142603220-142603242 CCCCCACACCCCTCTCTGACAGG - Intronic
981790913 4:148535751-148535773 CCCCCACTCCCCTCTGTGCCAGG + Intergenic
986597640 5:9440076-9440098 CCAACACACCCATGTGTGCCTGG + Intronic
988468692 5:31515646-31515668 CCTCCACATCTGTCTTTGCCAGG + Intronic
989191316 5:38672347-38672369 TCCCCACAGCCGTCTTTTCCTGG + Intergenic
995275338 5:110271853-110271875 CCACCACACCCATCTTTATTAGG - Intergenic
996974563 5:129414993-129415015 CCACCACACCCGACCTTGTTTGG - Intergenic
998156356 5:139788980-139789002 CCACCACTCCCATGTTAGCCAGG - Intergenic
998359617 5:141573763-141573785 CCACCACCACCTCCTTTGCCTGG - Exonic
999186700 5:149715998-149716020 CCACCACACCCGGCCACGCCTGG + Intergenic
1000211434 5:159109677-159109699 CCACTCCACACGTCTGTGCCAGG - Intergenic
1000984957 5:167856196-167856218 CCACCATTCCCGTCTCTGCTTGG + Intronic
1002322007 5:178381921-178381943 CCATCACACCCAGCATTGCCTGG + Intronic
1002995731 6:2282801-2282823 CCACCACGCCCGGCCATGCCTGG - Intergenic
1003540359 6:7013062-7013084 CCACCACTCTGGTCATTGCCAGG - Intergenic
1004256099 6:14066021-14066043 CCACCGCACCCGGCCTTGTCTGG - Intergenic
1006797277 6:36739794-36739816 CCACCACCCCCATCCTTGCAGGG - Intergenic
1010392716 6:75355688-75355710 CCACCGCACCTGTCCTGGCCAGG + Intronic
1013725714 6:113092994-113093016 CCACCTCATCTGTCTCTGCCTGG + Intergenic
1014530785 6:122556924-122556946 CCACCACGCCCGGCTGAGCCTGG - Intronic
1014635017 6:123834440-123834462 CCACCACACCTGGCTGTTCCAGG + Intronic
1017434644 6:154404542-154404564 CCACCACACCCGGCTCAGTCTGG - Exonic
1018086650 6:160306821-160306843 CCACCAGGCCAGTATTTGCCAGG + Intergenic
1018932423 6:168250069-168250091 CCCCCACACCCGTCCCTCCCTGG - Intergenic
1019179203 6:170176414-170176436 CCACCCCTCCCGTCCTTCCCAGG - Intergenic
1019942595 7:4303034-4303056 CCACCACACCCAGCCCTGCCTGG + Intergenic
1020062275 7:5161253-5161275 CCACCGCGCCCGGCTGTGCCCGG - Intergenic
1020165870 7:5807424-5807446 CCACCGCGCCCGGCTGTGCCCGG + Intergenic
1020250870 7:6467471-6467493 CCACCACACCCAGCCATGCCTGG - Intronic
1020368027 7:7401192-7401214 CCATCTCAGCCTTCTTTGCCAGG + Intronic
1020867680 7:13587973-13587995 CCACCACACCCGACTTTGAGTGG + Intergenic
1022929207 7:35093187-35093209 CCATCACCCCTGTCTTTGACTGG - Intergenic
1023716781 7:43052886-43052908 CCACCACACCTGGCCATGCCTGG - Intergenic
1029548007 7:101221503-101221525 CCACCACACCCGGCCTCACCAGG + Intronic
1030035884 7:105408064-105408086 CCACCACGCCCAGCCTTGCCTGG - Intergenic
1031925006 7:127630729-127630751 CCACCATGCCCGGCTATGCCCGG + Intergenic
1031925148 7:127631885-127631907 CCACCATGCCCGGCTATGCCCGG + Intergenic
1032066433 7:128774991-128775013 CCATCCCACCCTTCTTTGGCTGG - Exonic
1035034770 7:155887419-155887441 CCACCACTGCCGCCTCTGCCCGG - Intergenic
1035051297 7:156000435-156000457 CCACCAGACCCATCCATGCCTGG + Intergenic
1036780492 8:11643709-11643731 CCACCAAACCCACCTTTCCCAGG - Intergenic
1036812650 8:11878158-11878180 CCAGCACTTCCTTCTTTGCCTGG - Intergenic
1041322962 8:56633720-56633742 CCACCACACCCAGCCATGCCTGG + Intergenic
1042997285 8:74715012-74715034 CTACCAAACACATCTTTGCCAGG + Intronic
1047729920 8:127719196-127719218 CCACCACACCTGGCCTTTCCTGG - Intergenic
1048985439 8:139732387-139732409 CCACCACACCCGTCTTTGCCAGG - Intronic
1049429327 8:142551885-142551907 CCACCTCACCTCTCCTTGCCAGG - Intergenic
1049849031 8:144820939-144820961 CCACCGCACCCGTCCTTCCCGGG - Intergenic
1051342434 9:16124086-16124108 CCACTACACCAGTCTTTGAGAGG - Intergenic
1051390745 9:16560572-16560594 CTACCACACTTGTCCTTGCCTGG - Intronic
1052907152 9:33845533-33845555 CCACCGCACCCAGCTTGGCCTGG + Intronic
1055023073 9:71691053-71691075 CCACTACACCTGTCCATGCCTGG + Intronic
1056450546 9:86712543-86712565 CCACCACACCTGGCTTTCCCTGG + Intergenic
1056551701 9:87658334-87658356 TCACCACACCCTGCTCTGCCAGG + Intronic
1056571995 9:87824689-87824711 CCACCACGCCCGCCTCCGCCGGG - Intergenic
1056873195 9:90304210-90304232 CCACCCCACCACTCTGTGCCAGG + Intergenic
1057802732 9:98199882-98199904 CCACCACTATCTTCTTTGCCTGG - Intronic
1060177446 9:121507507-121507529 CCACCGCACCCGGCTCTCCCGGG + Intergenic
1060206676 9:121686484-121686506 CCACCACCCCAGTCCCTGCCAGG + Intronic
1060280857 9:122214436-122214458 CCCCCACCCCCGTCCTTTCCAGG - Intronic
1060485650 9:124044912-124044934 CACCCACATCCATCTTTGCCTGG - Intergenic
1061072359 9:128319037-128319059 CCACCACGCCCGGCCATGCCTGG - Intronic
1061917620 9:133763422-133763444 CCCCCACTCCCCTCCTTGCCAGG - Exonic
1062054657 9:134464528-134464550 GCACCACACGCGCCTCTGCCCGG + Intergenic
1062054705 9:134464699-134464721 GCACCACACGCGCCTCTGCCCGG + Intergenic
1062054779 9:134464984-134465006 GCACCACACGCGCCTCTGCCCGG + Intergenic
1062054811 9:134465098-134465120 GCACCACACGCGCCTCTGCCCGG + Intergenic
1062054859 9:134465269-134465291 GCACCACACGCGCCTCTGCCCGG + Intergenic
1062054907 9:134465440-134465462 GCACCACACGCGCCTCTGCCCGG + Intergenic
1062054939 9:134465554-134465576 GCACCACACGCGCCTCTGCCCGG + Intergenic
1062054987 9:134465725-134465747 GCACCACACGCGCCTCTGCCCGG + Intergenic
1062055093 9:134466124-134466146 GCACCACACGCGCCTCTGCCCGG + Intergenic
1062055109 9:134466181-134466203 GCACCACACGCGCCTCTGCCCGG + Intergenic
1062055141 9:134466295-134466317 GCACCACACGCGCCTCTGCCCGG + Intergenic
1062093022 9:134688521-134688543 CCACCAAAGCCTTCTTTGCTGGG + Intronic
1062180119 9:135186777-135186799 TTTCCACACCCGTCTTTGGCGGG + Intergenic
1189152021 X:38719078-38719100 CCACCACACCCAGCCTTACCTGG - Intergenic
1190749821 X:53352221-53352243 CCACCACACCCCTATTAGCATGG + Intergenic
1192072538 X:67956508-67956530 CCATCACTTCCTTCTTTGCCTGG + Intergenic
1198171900 X:134115130-134115152 CCACCACACCCGGCCTTCTCTGG + Intergenic
1200043627 X:153388090-153388112 CCCCCACACCCTGCTTTGCCAGG + Intergenic
1200244272 X:154514689-154514711 CCACCGCACCCGGCCATGCCTGG + Intronic