ID: 1048985447

View in Genome Browser
Species Human (GRCh38)
Location 8:139732428-139732450
Sequence GGGTCTGCACCCCAATGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048985435_1048985447 30 Left 1048985435 8:139732375-139732397 CCGGAAGAGGAACCTGGCAAAGA 0: 1
1: 0
2: 1
3: 31
4: 256
Right 1048985447 8:139732428-139732450 GGGTCTGCACCCCAATGGAGGGG No data
1048985439_1048985447 18 Left 1048985439 8:139732387-139732409 CCTGGCAAAGACGGGTGTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1048985447 8:139732428-139732450 GGGTCTGCACCCCAATGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048985447 Original CRISPR GGGTCTGCACCCCAATGGAG GGG Intronic
No off target data available for this crispr