ID: 1048986628

View in Genome Browser
Species Human (GRCh38)
Location 8:139738342-139738364
Sequence CTGGGACATGGGCAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 367}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048986628_1048986641 14 Left 1048986628 8:139738342-139738364 CCCTCCACTTGCCCATGTCCCAG 0: 1
1: 0
2: 3
3: 25
4: 367
Right 1048986641 8:139738379-139738401 ATGTCCTCTCCCATGGCAGAAGG No data
1048986628_1048986639 7 Left 1048986628 8:139738342-139738364 CCCTCCACTTGCCCATGTCCCAG 0: 1
1: 0
2: 3
3: 25
4: 367
Right 1048986639 8:139738372-139738394 AGCCTGTATGTCCTCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048986628 Original CRISPR CTGGGACATGGGCAAGTGGA GGG (reversed) Intronic
900367713 1:2318045-2318067 CCGGGACGGGGTCAAGTGGAAGG - Intergenic
900675267 1:3881352-3881374 CCGGGGCTTGGGCAAGAGGAAGG - Intronic
900958956 1:5907208-5907230 CTGGGAAATTGACAACTGGAAGG + Exonic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902372685 1:16015987-16016009 CAGGGACATGGGGAAGAGGTGGG + Intronic
902403566 1:16171360-16171382 CTGAGGCATGGGGAAGTGAAGGG + Intergenic
902567408 1:17321246-17321268 CCGGGAGATGGGAAAGTGGGGGG + Intronic
903314718 1:22493641-22493663 CCAGGGCATGGGTAAGTGGAAGG - Intronic
903463380 1:23534840-23534862 CTGGGAGATGGGAAAGTGTAGGG - Intergenic
903951189 1:26996865-26996887 GTGGGACATCTGGAAGTGGAGGG - Intronic
904585564 1:31577896-31577918 ATTGGACAGGGGCAAGTGCATGG - Intronic
904881138 1:33697976-33697998 GTGGGACATGGGGAAGGGGGTGG + Intronic
905015223 1:34773499-34773521 CTGGGTCGGGGGCAAGGGGAGGG + Intronic
905274383 1:36807544-36807566 CTGGGGCATGGGCAGGGGGATGG + Intronic
905327004 1:37160302-37160324 CTGGGAAATAGTCATGTGGAAGG + Intergenic
905359895 1:37412008-37412030 CTGGGACATAGGAAAGGGGAGGG - Intergenic
905901036 1:41582106-41582128 CTGGGAGCTGGGCAAGTGTCTGG + Exonic
906013823 1:42554984-42555006 TTGGGAAATGGACAAGTGGATGG - Intronic
906129545 1:43447988-43448010 CTGGGAAATGGGCATGTTCAAGG - Intronic
906662174 1:47590719-47590741 CTGGTACATGGGAAGGTGGGAGG + Intergenic
907268178 1:53275354-53275376 CTGGGACCTGGACAAGTGGTGGG + Intronic
907326910 1:53644208-53644230 CTGGGGCAGAGCCAAGTGGAGGG - Intronic
907740700 1:57163086-57163108 CTGGGACTTGGGCCAGTGCTTGG - Intronic
908077436 1:60535819-60535841 CTGGAATAGGGGCATGTGGATGG + Intergenic
909344608 1:74571358-74571380 CTAGGACAGGAGCAAGAGGAAGG - Exonic
912943003 1:114061421-114061443 GAGGTACATGGACAAGTGGATGG - Intergenic
914676915 1:149912969-149912991 CTGGGGCTTGGGCCAGTGGTTGG - Intronic
915195688 1:154187956-154187978 CTGGGCTTTGGGCAAGTGGATGG - Intronic
915498049 1:156295017-156295039 CTGGAACATGGAGTAGTGGAGGG + Intronic
917263568 1:173195828-173195850 GTGGGACGTGGGCTAGTAGAGGG + Intronic
917685117 1:177407956-177407978 CTGAGACAGTGGCAAGTGAAAGG - Intergenic
919705219 1:200669631-200669653 CTGGGACACGGGGAACTGTAAGG + Intronic
921177171 1:212605743-212605765 CTGGGACATGTGCAAAAGGAAGG - Intronic
921266479 1:213424913-213424935 CTGGGACAGAGGCAAGCTGAGGG - Intergenic
921734572 1:218612365-218612387 CTGGGACATGGGTGAGTGGATGG + Intergenic
922895809 1:229099211-229099233 CTGGGACCTGGTGAGGTGGAAGG - Intergenic
923086070 1:230704313-230704335 TTGGGGCATGGTCAGGTGGATGG + Exonic
923639202 1:235736383-235736405 CTGGGTCATGGCCAAATGAATGG + Intronic
923712141 1:236395910-236395932 CTGCGGCATGGGCAGGGGGAAGG - Intronic
1062935065 10:1379402-1379424 AAGGGACATGGGCAAGATGAAGG - Intronic
1063381602 10:5589345-5589367 CTGGGAATTGGGCAATGGGAGGG - Intergenic
1063418315 10:5890513-5890535 CCGGGCCGTGGGCAGGTGGAGGG + Intronic
1064318516 10:14280014-14280036 CTGTAACATGGCAAAGTGGAAGG - Intronic
1067982108 10:51098364-51098386 CTGGGACACGGGAAAGGTGAAGG - Intronic
1069583171 10:69578744-69578766 CTGGGACAGGGGCCGCTGGACGG + Intergenic
1070156166 10:73836862-73836884 ATGGGACTGGGGCAAGAGGAGGG - Intronic
1070596283 10:77835112-77835134 CAGGGACGTGGGCAAGTCGTGGG - Intronic
1070724294 10:78777832-78777854 CTGGGACGAGGGGAGGTGGATGG - Intergenic
1071388817 10:85149390-85149412 ATGGGAAATTGGCAAGGGGATGG - Intergenic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1071979344 10:90987930-90987952 CTGGGACAATAGCAAATGGATGG - Intergenic
1072642559 10:97223135-97223157 TTGGGAAATGGGCTAGTGGAGGG - Exonic
1072754349 10:98008637-98008659 CTGGGACCTGGACATCTGGAAGG - Intronic
1073138357 10:101231828-101231850 CTGGGAGATGGGCAACAGCAGGG - Intergenic
1073219641 10:101859887-101859909 CTGGTCCATGGGCAGATGGAGGG + Intronic
1073431347 10:103489502-103489524 CTGGGACTTGGGGAATGGGAGGG + Intergenic
1073735497 10:106341237-106341259 ATGCTACATGGGCAAGGGGAAGG - Intergenic
1076059849 10:127405274-127405296 CTGGGAAATGGGCACCTGGCAGG - Intronic
1076855502 10:133113832-133113854 CAGGGACATGGGGAAGGGGCGGG - Intronic
1077059852 11:613317-613339 CCGGCGCATGGGCAAGTGCAAGG - Exonic
1077390208 11:2297281-2297303 GTGGGACAGGGGCAAGAGGCCGG - Exonic
1078507355 11:11962201-11962223 CTGGGCCATGGGCAGAGGGAGGG - Intergenic
1080673971 11:34407435-34407457 CTGGCACATGGGGGAGTTGATGG - Intergenic
1080804066 11:35635848-35635870 GTGGGTCATGAGCAAGTGGCAGG - Intergenic
1080966952 11:37224413-37224435 GTGGTACCTGAGCAAGTGGAGGG + Intergenic
1081745935 11:45472422-45472444 CTGGGAGAGGGGAAAATGGAGGG + Intergenic
1082705176 11:56486011-56486033 CTGGGACAGAGGCAAGGGAAGGG - Intergenic
1082778957 11:57271318-57271340 CTGGGATGTGGGCAGGTGAATGG - Intergenic
1082811048 11:57479184-57479206 CTGGGGCCTGGGCAGGGGGAGGG + Intergenic
1082896640 11:58198512-58198534 GAGGGACATATGCAAGTGGAAGG + Intergenic
1083318887 11:61833201-61833223 CCGGGACATGGGGAAGAGAAAGG - Intronic
1084594233 11:70107518-70107540 CTGGGCCAGGGGGAACTGGAAGG + Intronic
1084675890 11:70634139-70634161 TTGGGACATGTGCTAATGGAGGG + Intronic
1084689709 11:70718014-70718036 CTGGTACAGTGGGAAGTGGAAGG - Intronic
1084736419 11:71108468-71108490 TTGGGACAAGGGCATGTGGTGGG - Intronic
1084785689 11:71440498-71440520 TGGGGAGATGGGCAGGTGGATGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085174121 11:74471853-74471875 CTGAGACATAGGAAAGTGAAAGG - Intergenic
1085794894 11:79530209-79530231 CCATGACATGGACAAGTGGAGGG - Intergenic
1087019874 11:93591268-93591290 CTGGGAAATGGGCAAAGGGCTGG + Intergenic
1087713655 11:101583163-101583185 CTGGGACCTGAGTGAGTGGAGGG - Intronic
1088429598 11:109744635-109744657 CTGGGAGAGGGGCAAGTACAGGG + Intergenic
1088806504 11:113358134-113358156 CTAGCACAAGGGCAAGGGGAAGG + Intronic
1090049220 11:123362744-123362766 CTGGGACTTGGGGAAGGGGTAGG + Intergenic
1091600619 12:1915699-1915721 CTGGGGCATGGGCGAGAGGTCGG - Intronic
1091786944 12:3248888-3248910 CTGGGAGCTGGGCAGGTGGTGGG - Intronic
1092089364 12:5791495-5791517 CTGGGAGATGGGTAATTGAAGGG + Intronic
1092165205 12:6338155-6338177 CAGGGAAATGGTCATGTGGAAGG - Intronic
1092765421 12:11848715-11848737 CAGGGACCTGCGCAAGTGAAGGG + Intronic
1093175378 12:15907514-15907536 ATAGAACATGGTCAAGTGGAAGG + Intergenic
1094121990 12:26984849-26984871 CTAGGACAGGAGCAAGTTGAAGG + Intronic
1094738624 12:33262862-33262884 CTGGGACAGGCACAACTGGAGGG + Intergenic
1095946669 12:47757836-47757858 CTGGCACCTGGGCAGGTGAAAGG + Intronic
1096977754 12:55708907-55708929 CTGGGACAGAGGCAAGGGGGTGG + Intronic
1097684276 12:62677227-62677249 GAGGTACATGGGCAACTGGAGGG - Intronic
1097731861 12:63137717-63137739 CTGGGGCATGGACAAATGCAAGG + Intergenic
1097830850 12:64222661-64222683 CTGGGAGATGGGGAAGTGCCTGG + Intergenic
1100819869 12:98420860-98420882 CTGGGAGATGGGCAGGTGACAGG + Intergenic
1101541863 12:105672613-105672635 CTGGGACATGGAAAAGGGGTGGG + Intergenic
1102476608 12:113192702-113192724 CTAGGACTTTGCCAAGTGGAGGG + Intergenic
1103150926 12:118637846-118637868 CTGGAAAATGGGCCTGTGGATGG - Intergenic
1105213641 13:18272282-18272304 CTGGGACAGGGTGGAGTGGAGGG - Intergenic
1108323511 13:49308272-49308294 CTGGGACATTTCCAAGGGGAGGG + Intergenic
1111002726 13:82206015-82206037 GAGGTACATGGACAAGTGGAGGG - Intergenic
1112300123 13:98222597-98222619 CTGTGACAGGTGCCAGTGGAGGG + Intronic
1112532616 13:100219529-100219551 CTGGGACATGGGAAATGTGACGG + Intronic
1115396485 14:32914835-32914857 ATGTGACTTGGGCAAATGGAAGG - Intergenic
1116885228 14:50214203-50214225 TTGGGGAATGGGGAAGTGGAAGG + Intronic
1118734718 14:68692990-68693012 CTGGCACATAGGAATGTGGAGGG + Intronic
1119466617 14:74863453-74863475 CTGGGACCAGGGCAACAGGAAGG - Exonic
1120396372 14:83971858-83971880 GAGGGAAATGGACAAGTGGAGGG + Intergenic
1121030509 14:90654674-90654696 GTGGGACAGGGGCAGGTGCAAGG + Intronic
1121390642 14:93570538-93570560 CTGGGCCATGTGCAGGAGGAAGG + Intronic
1121642382 14:95494440-95494462 CTGGGAGATGGGGAAGTGCAAGG + Intergenic
1121712244 14:96047336-96047358 CTGGGACATCTGCAGGTGGATGG + Intronic
1122271633 14:100570936-100570958 CTGGGTCTTGGGCCAGTGGGTGG + Intronic
1122864777 14:104598727-104598749 CCGGGACTGGGGCCAGTGGACGG - Intronic
1124990957 15:34673182-34673204 CTGGGAAATGGCCAAGTAGAGGG - Intergenic
1126050385 15:44679903-44679925 CTGGGACTGGGACAAGAGGATGG + Intronic
1126683269 15:51224816-51224838 CAGGGACGTGGCCAAGGGGAGGG - Intronic
1127867158 15:63042398-63042420 CTGGGAGAAGGGCACGCGGAGGG + Intergenic
1128079654 15:64848776-64848798 CTGGGACAGGGGCAAAGTGAGGG + Intronic
1129193547 15:73951592-73951614 CTGGGACTAGGGCATGGGGAGGG + Intronic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG + Intronic
1131777925 15:95822751-95822773 CTGGGACATGGTCAGGTCTAGGG - Intergenic
1132840270 16:1975449-1975471 CCGGGACATGGGCAGGCGGTAGG + Intronic
1133019657 16:2961746-2961768 GGGGGACCTGGGCAAGAGGAGGG - Intergenic
1133733405 16:8595466-8595488 CTGGGAACTGGGAAAGGGGAAGG - Intergenic
1134100733 16:11449732-11449754 CTAGGAAATGGGGAAGTTGATGG - Intronic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1135666250 16:24337896-24337918 CATGGACATGGGCAACTGAAGGG + Intronic
1136630316 16:31486056-31486078 CTGGGACCTGGAAAAATGGAGGG + Intronic
1137610338 16:49813486-49813508 CTGGGCCATGGCCCAGGGGAGGG - Intronic
1137750926 16:50860537-50860559 AAGGGACATGGGCAGATGGATGG - Intergenic
1138916194 16:61467580-61467602 CTGGGACATGGAGTAGTGAAAGG + Intergenic
1139342093 16:66274185-66274207 CTGGGACCTTGGCCACTGGAGGG - Intergenic
1139477929 16:67212185-67212207 CTGCAACATGGGCAAGAGGTAGG - Intronic
1139760780 16:69183297-69183319 CAGGGACAGGGGCAAGCAGAGGG - Intronic
1140048964 16:71462457-71462479 CTTGGAAATGGACCAGTGGATGG + Intronic
1140639629 16:76957097-76957119 CTGGGAAATGTGCACATGGAGGG + Intergenic
1140833231 16:78770485-78770507 CTGGGCCATGGCCCATTGGATGG + Intronic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1141202557 16:81909061-81909083 CTGAGACATGGATAAGTGGGTGG - Intronic
1141356849 16:83354754-83354776 CAGGGAGATGGGCAAGGGCAAGG + Intronic
1141730562 16:85820230-85820252 CTGGCACAGGGGTAAGTGCAGGG + Intergenic
1142262222 16:89048384-89048406 CTGGGACCTGGGGAGGCGGAGGG + Intergenic
1142986554 17:3698524-3698546 CTGGGACTGGGGCTAGTGGTAGG - Intergenic
1143481004 17:7227375-7227397 CTGGGTCCTGGGCAGGTGGCTGG - Intronic
1143622189 17:8087045-8087067 CTGGGACATGGGCGAGGGGCTGG + Intronic
1143807318 17:9440099-9440121 CTGGGAAAAGGGCAAAAGGAAGG + Intronic
1144462249 17:15467596-15467618 TTGGGGCAGGGGCAAGAGGATGG - Exonic
1144657015 17:17043086-17043108 CTGGGGCATGGGGACGGGGACGG + Intronic
1144945652 17:18968312-18968334 CTGGGACATGGGCTAGTAACAGG - Intronic
1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG + Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1147608907 17:41789974-41789996 CTGAGCCCTGGGCAAGAGGAAGG - Intergenic
1148027698 17:44600001-44600023 CTGGGCCATTGGCAAGTGCGAGG - Intergenic
1148324953 17:46777900-46777922 GTGGGACCTGGGCAACAGGAAGG - Intronic
1148622467 17:49044725-49044747 CTGGGAGATTGGTAGGTGGAGGG + Intronic
1152069321 17:78127180-78127202 CTGGGAAATGGGGAAGAGGTAGG + Intronic
1152704627 17:81836545-81836567 ACAGGACATGAGCAAGTGGATGG + Intergenic
1153045079 18:848441-848463 CTGGGGCCTGGGCCAGTGGAAGG + Intergenic
1155266947 18:24103712-24103734 CTGGGACTGGGGCAGGAGGAGGG - Intronic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1156377901 18:36531278-36531300 CTGGGCCATGGTCATGTGGCAGG - Intronic
1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG + Intronic
1157404906 18:47414548-47414570 ATGGGACATGGGCAAGTGGTTGG + Intergenic
1157620028 18:49011596-49011618 CTGGAAAATGCGCCAGTGGAGGG + Intergenic
1158547472 18:58408363-58408385 TTGGGACGTGGGCAGGGGGATGG + Intergenic
1158923934 18:62230326-62230348 TTCTGACTTGGGCAAGTGGAAGG + Intronic
1159292467 18:66440179-66440201 GAGGTACATGGACAAGTGGAAGG - Intergenic
1160555045 18:79719309-79719331 CTGGGATGTGGGCAGGTGCAGGG + Intronic
1160567297 18:79794868-79794890 CTGGGACCTGAGCATCTGGAAGG + Intergenic
1161273328 19:3402373-3402395 ATGGTACATGGGGGAGTGGAAGG - Intronic
1161989684 19:7677629-7677651 CTGGGTCATGGGCACCTGGGAGG - Exonic
1162848305 19:13411271-13411293 CTATCACATGGGCAAGTGAAAGG - Intronic
1163113944 19:15178236-15178258 GTGGGACATGGGGAGGTTGAGGG - Intronic
1163518077 19:17776732-17776754 CGGAGACATGGGGAGGTGGAGGG - Intronic
1164685508 19:30164017-30164039 CGGGGACATGGGAATGTGAATGG - Intergenic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1166069023 19:40377018-40377040 TGGGGACATGGGCAGGTAGAGGG + Intronic
1166704997 19:44903574-44903596 CGAGGAGATGGGAAAGTGGACGG - Exonic
1167682099 19:50929969-50929991 CTGGGACCTGGGAAAGTTGTGGG - Intergenic
925260198 2:2522054-2522076 ATGGGGGATGGGCAGGTGGATGG - Intergenic
925874264 2:8298584-8298606 CTGGGGCAGGGGCCTGTGGATGG - Intergenic
927415387 2:22874110-22874132 TTGGGACATGGGCAGGGGGAGGG - Intergenic
927572139 2:24169123-24169145 CAGGGACATGGTCAAATAGATGG - Intronic
927921067 2:26971951-26971973 CTGCAAGATGGGCAGGTGGAGGG - Intronic
929014623 2:37482033-37482055 GAGGTACATGGACAAGTGGAGGG - Intergenic
929561000 2:42956399-42956421 GTGGGAGGTGGGGAAGTGGAAGG - Intergenic
930766201 2:55088159-55088181 CTAGGACATGGGCTGCTGGATGG + Intronic
930971141 2:57397300-57397322 GAGGTACATGGACAAGTGGAGGG + Intergenic
932262941 2:70342259-70342281 CTGGCACATAGGCAAGGGAAAGG + Intergenic
932770244 2:74497088-74497110 CTGGGACACAGGCAAATAGACGG - Intergenic
933260635 2:80127520-80127542 CTAGGACATAGCCAAGTGTATGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
933920447 2:87040313-87040335 CTGGGACCTGGGCTGGTGCAGGG - Intergenic
933931177 2:87153473-87153495 CTGGGACCTGGGCTGGTGCAGGG + Intergenic
933997961 2:87683768-87683790 CTGGGCCATGTCCCAGTGGAGGG - Intergenic
934002550 2:87729585-87729607 CTGGGACCTGGGCTGGTGCAGGG + Intergenic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934300687 2:91774464-91774486 CTGGGACAGGGTGGAGTGGAGGG + Intergenic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
935236120 2:101139569-101139591 CTGAGGCATGGGCAAGGGGCAGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936361946 2:111811959-111811981 CTGGGACCTGGGCTGGTGCAGGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937094072 2:119224349-119224371 CAGGGACAGGGGCAGGTGCAGGG + Intronic
937826544 2:126373314-126373336 CTGGGAGATGGGTATGTGGCAGG - Intergenic
938086773 2:128407077-128407099 CTGGGGCCTGGCCAGGTGGACGG + Intergenic
938487139 2:131723199-131723221 CGAGGAGATGGGGAAGTGGACGG + Intronic
938794935 2:134710027-134710049 CTGGGACAACTGGAAGTGGATGG - Intronic
942481197 2:176390199-176390221 CTGGCACATGTGCAGGTGCAGGG - Intergenic
943426949 2:187749568-187749590 GAGGTACATGGACAAGTGGAAGG + Intergenic
943852014 2:192735617-192735639 CTGGGACATTATCAAGTGAAAGG - Intergenic
944458744 2:199921985-199922007 AAGGGAAATGGGCAACTGGAGGG - Intronic
944766783 2:202872009-202872031 CTGAGGCGTGGGGAAGTGGAAGG + Intergenic
946009666 2:216554614-216554636 CTAGGAGATGGGCTGGTGGAGGG + Intronic
946027273 2:216679454-216679476 CTGGGGGATGGCCAAGTAGATGG + Intronic
946326852 2:218989082-218989104 CTGGGTTCTGGGCAAGTGGCAGG - Intergenic
947875983 2:233468624-233468646 CTGGGACATGGCCAGGTCGGGGG - Intronic
948136340 2:235639141-235639163 GTGGGGCATGGGGAATTGGACGG + Intronic
948780910 2:240321030-240321052 TTGGGAAATGGCCCAGTGGAGGG - Intergenic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
1169117439 20:3074903-3074925 CAGTGACATGGGCAGGGGGATGG - Intergenic
1169200252 20:3705826-3705848 CCAGGACATGGCCATGTGGAGGG + Exonic
1169417678 20:5431873-5431895 CTGAGGCATGGGACAGTGGAGGG - Intergenic
1169743121 20:8916621-8916643 CTGAGAAATGGGGTAGTGGATGG - Intronic
1169940656 20:10933660-10933682 CCGGAACATTGGCAAATGGATGG + Intergenic
1170458420 20:16554530-16554552 AAGGTACATGGGAAAGTGGAGGG - Intronic
1170883586 20:20318744-20318766 CTGGGACATGGCCATGCTGATGG - Intronic
1171258266 20:23708523-23708545 CTCTGACATGAGCAGGTGGATGG - Intergenic
1171275489 20:23853566-23853588 CTCTGACATGAGCAGGTGGATGG - Intergenic
1172301540 20:33853735-33853757 CTGGGAGATGGGCGGGGGGAGGG + Exonic
1173455674 20:43199427-43199449 CAGGGATATTGGCAAGGGGAAGG + Intergenic
1173972762 20:47165397-47165419 CTGGGAAGTGGGGGAGTGGAAGG - Intronic
1174141254 20:48415443-48415465 CAGGGCCATGGACTAGTGGAGGG - Intergenic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174565728 20:51463217-51463239 CTGGGAAGTGGGAGAGTGGAGGG + Intronic
1174593781 20:51667555-51667577 CTGAAACATGGGAAAGGGGAGGG + Intronic
1174606164 20:51763171-51763193 CTGGGACTGGGGCAAGGGCAGGG + Intronic
1175284340 20:57827837-57827859 CTGGGGGATGGGGAAGGGGATGG + Intergenic
1178013369 21:28313453-28313475 CTGGGGCTAGGGAAAGTGGAAGG - Intergenic
1178131208 21:29574355-29574377 CTGGGAAATGGGCTAGCAGAAGG - Intronic
1178413237 21:32383082-32383104 CAGGGCCATGGGCACATGGAGGG + Intronic
1179257061 21:39726371-39726393 CTGGGATAGTGGCATGTGGATGG + Intergenic
1179638508 21:42731363-42731385 CTGGGGCATGAGCTAGAGGATGG + Intronic
1181028273 22:20137935-20137957 CTGGGCCCTGGACAAGAGGAAGG + Intronic
1181699042 22:24609600-24609622 CTGGGACAGGGTGGAGTGGAGGG + Intronic
1181753220 22:25004548-25004570 CAGGGAAATGGGCAGATGGAGGG - Intronic
1181988178 22:26816375-26816397 CTGGGATTTGGGTAAGTGAATGG - Intergenic
1182010459 22:26996493-26996515 CAGGTAGATGGGCAAATGGATGG - Intergenic
1182442186 22:30371064-30371086 CTGGGACACAGGCAAGAGGCAGG + Intronic
1182915099 22:34022073-34022095 ATGGGAAAGGGGCAAGTGAAAGG + Intergenic
1183278917 22:36921983-36922005 CTGGGACACGTGGAAGGGGAGGG + Intronic
1183451611 22:37899010-37899032 CTGGGGCCTGGGGCAGTGGAAGG - Intergenic
1184955923 22:47885826-47885848 CCGGGACAATGGGAAGTGGATGG + Intergenic
949471582 3:4402108-4402130 CAGGGCTAAGGGCAAGTGGAGGG + Intronic
949570219 3:5285378-5285400 CTGTGATATTGGCAACTGGATGG + Intergenic
951207210 3:19937327-19937349 ATGGAACATGTGCATGTGGAAGG - Intronic
951281482 3:20755235-20755257 CTGGGAATTGGGAAAGTTGAAGG + Intergenic
952204886 3:31171275-31171297 TTGGGACATGGGGAAGTGATGGG - Intergenic
952264712 3:31774447-31774469 GAGGCAGATGGGCAAGTGGAGGG + Intronic
952748489 3:36804347-36804369 CTGGGCCAGGGGCAATTGAAGGG - Intergenic
953233522 3:41085612-41085634 CAGGGGCATAGGCATGTGGATGG - Intergenic
954273132 3:49524841-49524863 CTGGGACATAGGCACGTGCCCGG - Intronic
954744457 3:52779207-52779229 CTGGGAAAAGGGCAACTGCACGG - Intronic
954879241 3:53822686-53822708 CTGGCACCTGGGCAGGAGGAAGG + Intronic
957459086 3:80494267-80494289 CTGGGACGTGGACAGGTGGCTGG + Intergenic
957760490 3:84548920-84548942 CTGGGAAATGGGTGAGTGAAGGG - Intergenic
961818555 3:129563728-129563750 CTTGGAGATGGGCAAGAGCAGGG - Intronic
962159392 3:132982868-132982890 CTGAGGCATGGGAAAATGGAAGG + Intergenic
962234132 3:133693305-133693327 TTGGGACATGGGCAAGGAAAGGG + Intergenic
962468127 3:135679518-135679540 CTGACAAATGGACAAGTGGAGGG - Intergenic
962875687 3:139534496-139534518 CAGGGCCATGGGCATGTAGAGGG - Intronic
962886221 3:139630383-139630405 CTGGGACTTGGGAGGGTGGAAGG + Intronic
964432403 3:156621145-156621167 CTGGGAGATGGGTATGTGGCAGG + Intergenic
964780391 3:160330807-160330829 CTGGGCCATGGAGAAGTGGATGG - Intronic
965019091 3:163203114-163203136 CTGGCAGATGGGCATATGGAGGG + Intergenic
966036405 3:175422347-175422369 CTGGGACATGAACAAGTTTAAGG - Intronic
967701844 3:192602340-192602362 CTGGGTCATGGGTAAGGTGAGGG + Intronic
968129535 3:196184844-196184866 CTTGGACAGGGGCAGGTGCAGGG - Intergenic
969265518 4:6061794-6061816 GTGGGAGAAGGGCCAGTGGATGG + Intronic
973594973 4:52478716-52478738 CTGGCACTTGGGCATGTGGCTGG - Intergenic
979530999 4:121769127-121769149 CTGTGGCATGGGCAAGATGAGGG + Intergenic
979562957 4:122120609-122120631 CTGGGATAGAGGCATGTGGATGG + Intergenic
980664081 4:135905606-135905628 CAGGGACATAGGGACGTGGATGG - Intergenic
981146877 4:141334063-141334085 CTGGGACATAGGCCAGTGTCTGG + Intergenic
981737862 4:147971659-147971681 TTGGAACATGGGCAAATGGCAGG + Intronic
982749461 4:159142388-159142410 CTAGTACATTGGCAAGTGGATGG + Intronic
984412786 4:179416090-179416112 CTAAGACATGTGAAAGTGGAAGG - Intergenic
985790866 5:1926327-1926349 CTGGGACAGGAGCAAGGGAAGGG - Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985837473 5:2281374-2281396 CAGGTAGGTGGGCAAGTGGATGG + Intergenic
986608197 5:9544580-9544602 CTGGGTCCTGGGCGAGTGGGCGG - Intronic
986852850 5:11833044-11833066 CTTGGAAATGGAAAAGTGGATGG + Intronic
989012153 5:36885385-36885407 CAGGGGCCTGGCCAAGTGGATGG + Intronic
989520722 5:42397003-42397025 GAGGTACATGGACAAGTGGAGGG - Intergenic
991596448 5:68311538-68311560 CTGGGAAGTGGGCAGGGGGAAGG + Intergenic
991671552 5:69053418-69053440 CTAGGTCATGGGTATGTGGATGG - Intergenic
994584740 5:101692532-101692554 CTGGGTATTGGGCAAGGGGAGGG - Intergenic
994828968 5:104752901-104752923 CTGGGCCATTGTCAAGTGGGAGG + Intergenic
995332119 5:110957236-110957258 GAGGTACATGGACAAGTGGAGGG - Intergenic
995562300 5:113395901-113395923 CTGGGAAATGGGAGAGGGGAAGG + Intronic
997283034 5:132660460-132660482 CTGAGCCCTGGGCAAGGGGAAGG - Exonic
999270364 5:150293325-150293347 CTGGGGGATGGGCAAGTTGAGGG + Intergenic
999375670 5:151085121-151085143 TTGGGAAATGGGCAAGTTGTGGG - Intronic
999624069 5:153501710-153501732 CTGGCAGATGGGCAGGAGGATGG + Intronic
1000123066 5:158216432-158216454 CAGGGAGAGGGGCAAGGGGAGGG - Intergenic
1000411389 5:160937560-160937582 CTGGGAGATGGGTATGTGGCAGG - Intergenic
1000552185 5:162680736-162680758 CTGGGACTTGAGTAAGTTGAAGG + Intergenic
1000809753 5:165846263-165846285 ACGGGATATGGGAAAGTGGAGGG - Intergenic
1002094430 5:176822760-176822782 CTGGGACCTTGGCATGTGGTGGG + Intronic
1002549124 5:179973972-179973994 GTGGGACATAGGAAAGGGGAGGG - Intronic
1003444893 6:6175350-6175372 GTGGGACAGGCCCAAGTGGAAGG - Intronic
1007077731 6:39078545-39078567 CTGGGACAGGGGCAGGGGCAGGG - Intronic
1007315340 6:40983780-40983802 CTGGGATGGGGGCAGGTGGAAGG - Intergenic
1007751105 6:44072621-44072643 CTGGGCCACTGGCAAGTGGGTGG - Intergenic
1007775035 6:44219996-44220018 CTGGGACATCTGTAAGTGGCTGG - Intronic
1008373052 6:50758401-50758423 GTGGGACATTGGGAAATGGAAGG - Intronic
1009281912 6:61763084-61763106 ATGGGAATTGGGCAATTGGAAGG - Intronic
1009852447 6:69214701-69214723 CTGAGACATGGGCAATTGTGGGG - Intronic
1011628587 6:89302949-89302971 CTGGTACATGGGCAAGGGCATGG + Intronic
1014780461 6:125559299-125559321 CTGGGACATAGGACAGTAGAAGG - Intergenic
1015157095 6:130108845-130108867 GGGGGACAGGGGCAAGGGGAGGG - Intronic
1016330303 6:142946732-142946754 CTGGGAAATGGGGAAGGGGTGGG - Intergenic
1016472594 6:144390219-144390241 CTGGGACGTGGTGAGGTGGATGG - Intronic
1017040908 6:150307896-150307918 GTGGGACAAGGGCAAATGGTGGG + Intergenic
1017304355 6:152899158-152899180 CTGGCACATGGGCAAGAGCATGG + Intergenic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1019419856 7:945894-945916 CTGGGGCACGGGCAGGGGGAAGG + Intronic
1019738621 7:2662238-2662260 CAGAGAGATGGGCACGTGGAGGG - Exonic
1021883462 7:25115399-25115421 CTGGGAGATGGAACAGTGGAGGG + Intergenic
1023075961 7:36483039-36483061 CTGGGAAATGCCCAAGTGGCAGG - Intergenic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023362949 7:39434220-39434242 CAGGGAAATGGGAAAGAGGATGG + Intronic
1023980639 7:45068073-45068095 CTGAGGCATGGGAAAGTGAAAGG - Intronic
1024573819 7:50747814-50747836 CTCGGGCCTGGGCAAGTAGAAGG + Intronic
1024914122 7:54479859-54479881 CTGGAACAGAGGCAAGGGGAAGG + Intergenic
1026000750 7:66557854-66557876 CTAGGACAGGGGCAGATGGAGGG + Intergenic
1028625381 7:92871348-92871370 CTGTGAGATGTGCAAGTGGAAGG + Intergenic
1031786643 7:126041367-126041389 GAGGTACAAGGGCAAGTGGAGGG - Intergenic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1032697203 7:134347740-134347762 CTGGGACATGGATGGGTGGATGG + Intergenic
1032901587 7:136315668-136315690 GGGGGTCATGGGCAAGAGGAGGG - Intergenic
1033588798 7:142793687-142793709 CGGGGACATGGCCAGCTGGAGGG - Intergenic
1033595825 7:142856997-142857019 CTGAGAGATGAGTAAGTGGAAGG - Intronic
1033653036 7:143356327-143356349 CTGAGACCTGGGCAACTAGATGG - Exonic
1035829620 8:2680664-2680686 CCGGGACATGGGCCAGTGTGTGG - Intergenic
1037775828 8:21835030-21835052 CTGGCTTATGGGCAAGGGGAAGG - Intergenic
1039010904 8:33091586-33091608 ATGGGACTGGGGCAAGTGGGTGG - Intergenic
1039926856 8:41941925-41941947 TTGAGACATGGGCAAGAGGAAGG + Intronic
1040311212 8:46237800-46237822 GTGTGGCATGGGCAAGTGGCAGG + Intergenic
1040387213 8:46921631-46921653 CTGGGACATCGGCAAGAGACAGG - Intergenic
1041205865 8:55497746-55497768 CAGGGACAAGGGCTAGTGCAAGG - Intronic
1041433693 8:57814480-57814502 CTGGGACATTGCCAGGTGGCAGG - Intergenic
1041955730 8:63556572-63556594 GTAGGACAGGGGCATGTGGAAGG + Intergenic
1045356108 8:101390449-101390471 CAGGCACATGGGGAAATGGATGG + Intergenic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047067096 8:121296850-121296872 CTGGGGCATGAACTAGTGGAGGG + Intergenic
1048484487 8:134833780-134833802 CTGGGACATGGGAAACTTCAGGG - Intergenic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049043793 8:140132738-140132760 CTGGGAAAGGTGCAAGTGGGAGG + Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1051195839 9:14562155-14562177 CTGGGACCTGGGGGAGGGGAGGG + Intergenic
1052677508 9:31645841-31645863 CTGGGACAAGTAAAAGTGGAAGG + Intergenic
1053274283 9:36771449-36771471 TTGGGAAATGGTAAAGTGGAGGG - Intergenic
1056037952 9:82628949-82628971 CTTGGACTTGGGGAAGTGTAAGG - Intergenic
1056935766 9:90913921-90913943 CTGGGGAATGGGCAGGTGAAAGG + Intergenic
1056954603 9:91072191-91072213 CTCGGCCAGGGGCATGTGGAAGG - Intergenic
1058838347 9:108879929-108879951 CTGTGCCATGGGCAAGTGTGAGG - Intronic
1059009907 9:110445744-110445766 ATGGGAAATGGGAAAGTAGAGGG - Intronic
1059447293 9:114346299-114346321 CTCGGCCAAGGACAAGTGGAGGG + Intronic
1059735159 9:117093125-117093147 CTGAAACATGGGAGAGTGGACGG - Intronic
1060073518 9:120571286-120571308 CTGAGATATGTGCAAGAGGAGGG - Intronic
1060817172 9:126641107-126641129 CTGGCACGGGGGCATGTGGAAGG + Intronic
1061397054 9:130349027-130349049 CTGGATCCTGGGGAAGTGGAGGG - Intronic
1061891933 9:133626537-133626559 CTGGGTAATGGGCAAGAGGTTGG - Intergenic
1062137082 9:134934887-134934909 CTGGGACAGAGGAAAGGGGAAGG - Intergenic
1062378556 9:136275907-136275929 CTGGGACACGGACAGGTGGGAGG + Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1185582024 X:1217111-1217133 CTGGGAAAAGGGGAAGTGGCCGG + Intergenic
1186331234 X:8536374-8536396 CAGGGACATTGGCAAGGAGATGG + Intronic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1190252518 X:48737832-48737854 CTGGAACGTGGGCAGGAGGAAGG - Intergenic
1190310406 X:49113487-49113509 CTGGGACAAGGACAAGGGAAAGG - Exonic
1199429802 X:147746088-147746110 CTGGGAGATGGGGGAGTGGGGGG - Intergenic
1199550250 X:149053648-149053670 CTAGGACAGGGGGAGGTGGAAGG - Intergenic
1199720004 X:150536706-150536728 CTGGGACAAGGGAAAGATGAGGG - Intergenic
1201413999 Y:13729636-13729658 CTGGGGGATGGGCAGGGGGAAGG - Intergenic