ID: 1048986692

View in Genome Browser
Species Human (GRCh38)
Location 8:139738614-139738636
Sequence CAGAGTCTGATCGGTGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048986692_1048986698 -1 Left 1048986692 8:139738614-139738636 CCCGCAACACCGATCAGACTCTG 0: 1
1: 0
2: 0
3: 11
4: 55
Right 1048986698 8:139738636-139738658 GGACCCCAGAACCACACGGCGGG No data
1048986692_1048986697 -2 Left 1048986692 8:139738614-139738636 CCCGCAACACCGATCAGACTCTG 0: 1
1: 0
2: 0
3: 11
4: 55
Right 1048986697 8:139738635-139738657 TGGACCCCAGAACCACACGGCGG No data
1048986692_1048986699 0 Left 1048986692 8:139738614-139738636 CCCGCAACACCGATCAGACTCTG 0: 1
1: 0
2: 0
3: 11
4: 55
Right 1048986699 8:139738637-139738659 GACCCCAGAACCACACGGCGGGG No data
1048986692_1048986696 -5 Left 1048986692 8:139738614-139738636 CCCGCAACACCGATCAGACTCTG 0: 1
1: 0
2: 0
3: 11
4: 55
Right 1048986696 8:139738632-139738654 CTCTGGACCCCAGAACCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048986692 Original CRISPR CAGAGTCTGATCGGTGTTGC GGG (reversed) Intronic
1074729944 10:116360638-116360660 CACAGTCTGATCGGTGAATCTGG + Intronic
1077351200 11:2093978-2094000 CAGAGTCTCATCGCTGTGGCCGG - Intergenic
1083194911 11:61080087-61080109 TAGTGTCAGATCGGTTTTGCTGG + Intergenic
1085388379 11:76169965-76169987 CAGAGTCTGGTTGGAGGTGCAGG + Intergenic
1088701096 11:112412491-112412513 CACAGTCTGATGGGGGTTGAGGG - Intergenic
1089596192 11:119582165-119582187 CAGGGCCTGATCAGTTTTGCAGG + Intergenic
1097052161 12:56230148-56230170 CAAAGTCTGATCGGGGTGACTGG - Intronic
1104164995 12:126219389-126219411 CAGAGTGTGACAGGTGCTGCTGG - Intergenic
1118161604 14:63296464-63296486 CAGAATCTGATCAGTGTTACAGG + Intergenic
1118257349 14:64216559-64216581 CTAAGTCTAATCGGTTTTGCCGG - Intronic
1119785004 14:77306422-77306444 CAGATGCTGATAGGTCTTGCTGG - Exonic
1128002069 15:64202512-64202534 CAGAGTCTGTTGGCTGTTGGGGG - Intronic
1128772177 15:70290811-70290833 CAGATTTTGATGGGTGTTTCAGG + Intergenic
1133812151 16:9168976-9168998 CAGTGGCTGATGGGAGTTGCTGG + Intergenic
1139482397 16:67237646-67237668 CAGTCTCTGACCGGTGGTGCTGG + Exonic
1140793925 16:78417714-78417736 CAGAGTCTAATGAGTGTTACAGG + Intronic
1140797163 16:78449353-78449375 CTGAGTCTGATCGTTGTTAAAGG + Intronic
1141785544 16:86198178-86198200 CAGAGGCTGATCTGTGGGGCTGG + Intergenic
1144680287 17:17188785-17188807 CAGAGCCCGCTAGGTGTTGCAGG + Exonic
1146659162 17:34653099-34653121 CAGAGTCTGGTGTGTGTCGCTGG - Intergenic
1149621206 17:58046707-58046729 CAGACCTTGATCGGTGATGCTGG - Intergenic
1153880378 18:9417164-9417186 CAGAGTCCGATAGGTTTGGCAGG + Intergenic
1157714556 18:49874575-49874597 CAGATTCTGATCTATATTGCTGG - Intronic
930308288 2:49704454-49704476 CAGAGTTTGTTTTGTGTTGCTGG - Intergenic
936275241 2:111090495-111090517 GAGAGTCTGAGCTGTGTTCCTGG + Intronic
939607161 2:144267175-144267197 CACACTCTGATGGGTATTGCCGG - Intronic
942941263 2:181620554-181620576 CACAGGCAGATCTGTGTTGCTGG + Intronic
946370943 2:219280852-219280874 CAGAGTCTGGTAGGAGTGGCTGG + Intronic
1168841064 20:910571-910593 CAGAGTCTGACTGGAGGTGCAGG + Intronic
1168892725 20:1305435-1305457 CAGCTTCTCATAGGTGTTGCTGG - Exonic
1178621466 21:34180740-34180762 AAGAAGCTGATCGATGTTGCTGG + Intergenic
1184527881 22:45036232-45036254 CAGAGGCTGCGCGGTGTGGCTGG - Intergenic
950156293 3:10723860-10723882 AAGAGCCTGATCGGAGTTGGTGG + Intergenic
960219076 3:115081925-115081947 CAGTGTCTGATTGGTGTCTCTGG + Intronic
960346509 3:116539348-116539370 AACAGTCTGATGGGGGTTGCAGG - Intronic
968926118 4:3549326-3549348 CAGAGACTGAGCAGTGGTGCTGG - Intergenic
971218335 4:24682387-24682409 CAGAGTCTGAGAGGGGTAGCAGG - Intergenic
977799664 4:101211812-101211834 CAGTTTCTGCTCTGTGTTGCTGG - Intronic
987544680 5:19298007-19298029 CTGTGTCTTATCGGTGTTGCAGG - Intergenic
994175420 5:96705290-96705312 CAGAGTCTCATCGCTGTGTCAGG - Intronic
1008722511 6:54373596-54373618 TAGAGTCTGATTGGTTTTGTGGG + Intronic
1009455934 6:63856117-63856139 CAGAGCCTGATAGGTGTGGTGGG + Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1029746947 7:102521290-102521312 CAGAGTCTGATGGGTGAGGACGG - Intergenic
1029764900 7:102620379-102620401 CAGAGTCTGATGGGTGAGGACGG - Intronic
1033246073 7:139717240-139717262 CTGAGTCTCAGCTGTGTTGCTGG - Intronic
1034895241 7:154872239-154872261 CAGCATCTGATCGGGGATGCTGG - Intronic
1038361761 8:26886504-26886526 CAGACTCTGATCGGAGTTCCTGG + Intergenic
1047549578 8:125855291-125855313 CACAGGCTGATCTGTATTGCAGG - Intergenic
1048986692 8:139738614-139738636 CAGAGTCTGATCGGTGTTGCGGG - Intronic
1053535048 9:38917053-38917075 CAGAGTCTGATCCATATTGCAGG + Intergenic
1053801049 9:41764732-41764754 CAGAGACTGAGCGGTGGTGCTGG - Intergenic
1054144150 9:61550105-61550127 CAGAGACTGAGCAGTGGTGCTGG + Intergenic
1054189480 9:61976882-61976904 CAGAGACTGAGCGGTGGTGCTGG - Intergenic
1054207268 9:62141475-62141497 CAGAGTCTGATCCATATTGCAGG + Intergenic
1054463924 9:65481434-65481456 CAGAGACTGAGCGGTGGTGCTGG + Intergenic
1054631083 9:67446879-67446901 CAGAGTCTGATCCATATTGCAGG - Intergenic
1054649036 9:67611727-67611749 CAGAGACTGAGCGGTGGTGCTGG + Intergenic
1057565463 9:96162675-96162697 AAGACTCTGCTCCGTGTTGCTGG - Intergenic
1061476897 9:130873744-130873766 CAGAGCCTGATGGGCTTTGCTGG + Intronic
1062004051 9:134230486-134230508 CCGAGGCTCATGGGTGTTGCTGG + Intergenic
1185726209 X:2423942-2423964 CAGAATCTGAACAATGTTGCGGG - Intronic
1186689759 X:11962790-11962812 CAGATTCTGCTCTGTGGTGCTGG - Intergenic
1190266912 X:48832087-48832109 CAGAGCCGGATCAGAGTTGCGGG + Exonic
1194983823 X:100468506-100468528 AACACTCTGATTGGTGTTGCTGG + Intergenic
1197298361 X:124747816-124747838 CAGAGTGTGATCTGGGTTCCTGG + Intronic
1200853967 Y:7917425-7917447 CACAGTCTTATATGTGTTGCAGG + Intergenic