ID: 1048991018

View in Genome Browser
Species Human (GRCh38)
Location 8:139760183-139760205
Sequence CTCTGTGAGTAGGGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048991008_1048991018 17 Left 1048991008 8:139760143-139760165 CCAGTGGCTTGGGGGCTGCAGCG 0: 1
1: 0
2: 2
3: 26
4: 248
Right 1048991018 8:139760183-139760205 CTCTGTGAGTAGGGGAAGGAGGG No data
1048991007_1048991018 23 Left 1048991007 8:139760137-139760159 CCTACTCCAGTGGCTTGGGGGCT 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1048991018 8:139760183-139760205 CTCTGTGAGTAGGGGAAGGAGGG No data
1048991012_1048991018 -9 Left 1048991012 8:139760169-139760191 CCAGGTCTGTGTGGCTCTGTGAG 0: 1
1: 0
2: 8
3: 35
4: 326
Right 1048991018 8:139760183-139760205 CTCTGTGAGTAGGGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048991018 Original CRISPR CTCTGTGAGTAGGGGAAGGA GGG Intronic
No off target data available for this crispr