ID: 1048992552

View in Genome Browser
Species Human (GRCh38)
Location 8:139769945-139769967
Sequence CCTGGGGAGTTGCAGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 421}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048992552_1048992564 -5 Left 1048992552 8:139769945-139769967 CCTAGCTCCTGCAACTCCCCAGG 0: 1
1: 0
2: 5
3: 42
4: 421
Right 1048992564 8:139769963-139769985 CCAGGGAAGGCAGGGAACTGGGG No data
1048992552_1048992562 -6 Left 1048992552 8:139769945-139769967 CCTAGCTCCTGCAACTCCCCAGG 0: 1
1: 0
2: 5
3: 42
4: 421
Right 1048992562 8:139769962-139769984 CCCAGGGAAGGCAGGGAACTGGG No data
1048992552_1048992560 -7 Left 1048992552 8:139769945-139769967 CCTAGCTCCTGCAACTCCCCAGG 0: 1
1: 0
2: 5
3: 42
4: 421
Right 1048992560 8:139769961-139769983 CCCCAGGGAAGGCAGGGAACTGG No data
1048992552_1048992565 -4 Left 1048992552 8:139769945-139769967 CCTAGCTCCTGCAACTCCCCAGG 0: 1
1: 0
2: 5
3: 42
4: 421
Right 1048992565 8:139769964-139769986 CAGGGAAGGCAGGGAACTGGGGG No data
1048992552_1048992569 7 Left 1048992552 8:139769945-139769967 CCTAGCTCCTGCAACTCCCCAGG 0: 1
1: 0
2: 5
3: 42
4: 421
Right 1048992569 8:139769975-139769997 GGGAACTGGGGGCACGGGGCAGG No data
1048992552_1048992568 3 Left 1048992552 8:139769945-139769967 CCTAGCTCCTGCAACTCCCCAGG 0: 1
1: 0
2: 5
3: 42
4: 421
Right 1048992568 8:139769971-139769993 GGCAGGGAACTGGGGGCACGGGG No data
1048992552_1048992570 11 Left 1048992552 8:139769945-139769967 CCTAGCTCCTGCAACTCCCCAGG 0: 1
1: 0
2: 5
3: 42
4: 421
Right 1048992570 8:139769979-139770001 ACTGGGGGCACGGGGCAGGCAGG No data
1048992552_1048992567 2 Left 1048992552 8:139769945-139769967 CCTAGCTCCTGCAACTCCCCAGG 0: 1
1: 0
2: 5
3: 42
4: 421
Right 1048992567 8:139769970-139769992 AGGCAGGGAACTGGGGGCACGGG No data
1048992552_1048992566 1 Left 1048992552 8:139769945-139769967 CCTAGCTCCTGCAACTCCCCAGG 0: 1
1: 0
2: 5
3: 42
4: 421
Right 1048992566 8:139769969-139769991 AAGGCAGGGAACTGGGGGCACGG No data
1048992552_1048992571 30 Left 1048992552 8:139769945-139769967 CCTAGCTCCTGCAACTCCCCAGG 0: 1
1: 0
2: 5
3: 42
4: 421
Right 1048992571 8:139769998-139770020 CAGGTTTTGCCACCCGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048992552 Original CRISPR CCTGGGGAGTTGCAGGAGCT AGG (reversed) Intronic
900396284 1:2454492-2454514 CCTGGGGAGTAGCAGGTCCATGG - Intronic
900473275 1:2864742-2864764 CCTGGGGAGGTGCCAGTGCTTGG + Intergenic
900519688 1:3099532-3099554 CCTGGGGACTGGCTGGTGCTGGG + Intronic
900523182 1:3115997-3116019 CCTGGGGAGCTGCAGACGCTGGG - Intronic
900598432 1:3493029-3493051 CCTGGGGCGGGGCAGGAACTCGG - Intronic
900692949 1:3992755-3992777 CCTATGGAGTTGCTGTAGCTGGG - Intergenic
901646038 1:10717269-10717291 ACTGGGGAGCTGCAGAGGCTGGG - Intronic
901879029 1:12183096-12183118 CCTGGGAGGTAGCAGGTGCTCGG + Intronic
902386363 1:16078177-16078199 CCTGGGGGGTTCCAGGGGCCAGG + Intergenic
903030292 1:20459183-20459205 GCTGGGGAATTTCAGGTGCTTGG + Intergenic
903447266 1:23430663-23430685 CCTGGGGAGAAGCCAGAGCTTGG + Intronic
903535653 1:24064552-24064574 CCTGGGGAACTGCAGGTGGTGGG - Intronic
903737976 1:25542507-25542529 CCTGGGAAGTTGCGGGGGCATGG + Intergenic
905631439 1:39521276-39521298 CCTGGGCAGGTCCAGGAGCGTGG - Intronic
905666315 1:39764895-39764917 CCTGGGCAGGTCCAGGAGCGTGG + Intronic
906666300 1:47624511-47624533 CATATGGAGTTGGAGGAGCTTGG - Intergenic
907194978 1:52679204-52679226 CCTGGGGAGGGGCACCAGCTGGG + Intergenic
908523443 1:64966300-64966322 CCGGGGGAGGTGGAGGAGCCGGG - Intronic
908885446 1:68782820-68782842 CCAGGAGAGTTTCAGGAGCCAGG - Intergenic
909482555 1:76141431-76141453 AATGGGGACTTGCAGGACCTAGG - Intronic
909837652 1:80276876-80276898 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
910905517 1:92173492-92173514 CCTGGTGAGTAGCAGGGGATAGG - Intronic
912715841 1:111982983-111983005 CCTGCCGAGCTCCAGGAGCTAGG - Intronic
914980520 1:152410741-152410763 TCTGGGGCCTCGCAGGAGCTGGG - Exonic
916384308 1:164250017-164250039 GTTGGGCAGGTGCAGGAGCTGGG - Intergenic
917220892 1:172727573-172727595 CATGTGGTGGTGCAGGAGCTGGG + Intergenic
917750939 1:178052769-178052791 AATCGGGAGTTTCAGGAGCTAGG - Intergenic
918139855 1:181711075-181711097 CCTGGGGGGCTGCAGGAGGCTGG + Intronic
919301833 1:195779888-195779910 ACTGAGGAGTAGCAGAAGCTAGG - Intergenic
919914980 1:202133671-202133693 CCTGGGGAGGGGCGGGAGCTGGG + Exonic
920077833 1:203350034-203350056 CCTGGGCTGTTGCAGGACCAAGG + Intronic
922802875 1:228372109-228372131 CCTGGGGAACTGCAGGGGCCGGG - Exonic
924466426 1:244302981-244303003 CCTGGGATGGTGCAGGAACTAGG + Intergenic
924902737 1:248418679-248418701 GCTGAGCAGGTGCAGGAGCTGGG - Intergenic
1063379727 10:5576831-5576853 CCTGGGACGTTCCAAGAGCTGGG + Intergenic
1063725467 10:8632832-8632854 CTTAGGGAGTGGAAGGAGCTAGG + Intergenic
1064081125 10:12308878-12308900 CCTGCTGAGTTGCAGCAACTGGG - Intergenic
1065276487 10:24091575-24091597 CCTGGGTAGGTACAGGAGTTGGG - Intronic
1065841483 10:29704854-29704876 CCTGGGGATTTTCAGGGGGTTGG + Intronic
1067234214 10:44434911-44434933 GCTGGGGAGGTGCAGGAGAAGGG + Intergenic
1067410865 10:46063396-46063418 CCTCGGGAGTTGCAGCGTCTTGG - Intergenic
1068907106 10:62338798-62338820 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
1069546058 10:69329794-69329816 GCTGGGGAGGGGCAGGAGATGGG - Intronic
1069941810 10:71961914-71961936 TCTGGGAAGTAGCAGGAGCAAGG - Intergenic
1070240254 10:74673482-74673504 CGTGAGCAGGTGCAGGAGCTGGG + Intronic
1070567101 10:77612161-77612183 CTTTGGGATTTGCAGGAGCAAGG - Intronic
1070982551 10:80661033-80661055 CTTGGGGAGCTGCAGGAGTTTGG + Intergenic
1071519286 10:86319107-86319129 CCTGGGGTGCTGCAGGAGCAAGG + Intronic
1073066818 10:100765694-100765716 TCTGGGCAGTGGCAGGGGCTGGG - Intronic
1074814919 10:117136347-117136369 CCTTGGGAGGTGGAGGAGATGGG - Intronic
1075486994 10:122830442-122830464 CCTGGTGGGTTACATGAGCTAGG - Intergenic
1075894430 10:125982861-125982883 ACTGGGCAGGTGTAGGAGCTGGG - Intronic
1076029089 10:127142462-127142484 CCTGGGGAGGAGCAGCAGCCTGG + Intronic
1076061861 10:127419317-127419339 CCTGGGCAGGTGCAGGGGCTAGG + Intronic
1076267398 10:129119418-129119440 GCTGGGGACCTCCAGGAGCTAGG + Intergenic
1077093461 11:789732-789754 CCTGGGAGGTGGCAGCAGCTGGG - Intronic
1077190793 11:1255278-1255300 CCTCGGGGGTTGCAGGCCCTGGG + Intronic
1077205523 11:1341325-1341347 TCTGGGGAGGTGAAGGGGCTGGG - Intergenic
1077328936 11:1975607-1975629 GCTGGGGATCTGCAGGAGGTTGG - Intronic
1077504338 11:2923132-2923154 CCTGGGGTGGGGCAGGAGCCTGG - Intronic
1078668044 11:13342072-13342094 CCTGGGGAGAGGCAGCACCTGGG + Intronic
1079284567 11:19117241-19117263 CCTGGGGAGATGGAGGGGCCGGG + Exonic
1080455649 11:32416411-32416433 CCTGGGGCAATGCAGGAGTTAGG - Intronic
1081864119 11:46350449-46350471 ACTGGGGAGAAGCAAGAGCTAGG - Intronic
1083431404 11:62615363-62615385 ACTGGGGGGCTGGAGGAGCTGGG - Exonic
1083596594 11:63920675-63920697 CCTGGGGAAATGGAGGAGGTGGG + Intergenic
1083858144 11:65404090-65404112 CCTGTGGAGAGGCAGGAGCCAGG + Intronic
1083876348 11:65526076-65526098 GATGGGGGGTTGCAGGTGCTGGG + Intronic
1083890456 11:65593210-65593232 CCTGGGGAGGAGAAGGTGCTGGG + Exonic
1084591759 11:70094394-70094416 CCTGGGCACTGGCAGGGGCTGGG + Intronic
1085439180 11:76542389-76542411 CATGGGCAGTTGCAGAAGATAGG - Intronic
1085638216 11:78174322-78174344 CCTGAGGACTTCCAGGAGATGGG - Exonic
1087735190 11:101824642-101824664 ACTTGGGAGTTGCATGAGCTTGG + Intronic
1089134343 11:116237395-116237417 GTTGGGGAGTTGGAGGAGTTTGG + Intergenic
1089561139 11:119343802-119343824 CCTGGGCAGGTACAGGAGCCAGG - Exonic
1089567069 11:119377567-119377589 CCAGGGGACATGCAGGGGCTTGG - Intronic
1089698388 11:120229403-120229425 CCAGGGGAGATGCAGGAGGGAGG - Exonic
1202811915 11_KI270721v1_random:30786-30808 GCTGGGGATCTGCAGGAGGTTGG - Intergenic
1091449760 12:565174-565196 CCTGGGGAGTCCCTGGAGCTGGG + Intronic
1094526860 12:31236963-31236985 CCTGGGGAGCTGCTGAACCTGGG - Intergenic
1094745558 12:33340948-33340970 GATGGGCAGTTGCAGGAGCCAGG + Intergenic
1095222113 12:39628025-39628047 CCTAGGCAGTTTCAGAAGCTTGG + Intronic
1095748155 12:45682441-45682463 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
1095981290 12:47976118-47976140 GCTGGGGAGTCGCTGGGGCTGGG + Intronic
1096070642 12:48773784-48773806 CCTGGTGTGTTGTAGGGGCTGGG - Intronic
1096801588 12:54114070-54114092 TCTGGGAAGTTGAAGGGGCTGGG + Intergenic
1098226291 12:68328750-68328772 CCTGGGGATTTGCTGGTGCTGGG - Intronic
1098638671 12:72814707-72814729 TGTGGGGAGGTGCAGGAGGTGGG + Intergenic
1099035474 12:77582084-77582106 CCTGGTGAGTTGTATGATCTTGG - Intergenic
1099365067 12:81758578-81758600 CCGGTGGCGTGGCAGGAGCTCGG + Intronic
1100478162 12:94953019-94953041 GATGGGCAGATGCAGGAGCTGGG - Intronic
1101199497 12:102419752-102419774 TGTGGGGAGAGGCAGGAGCTGGG - Intronic
1101341108 12:103841932-103841954 CGTGGGCAGGGGCAGGAGCTGGG - Intronic
1101965047 12:109276734-109276756 CCAGGGACTTTGCAGGAGCTAGG - Intergenic
1102197717 12:111036314-111036336 CCCGGGGAGAGGCAGGGGCTGGG + Intronic
1102600483 12:114026017-114026039 CCTGGGGAGCAGCAGGGGCCAGG + Intergenic
1103169229 12:118799412-118799434 CCTGGGAAGTGCAAGGAGCTGGG - Intergenic
1104096760 12:125565326-125565348 GATGGGCAGGTGCAGGAGCTGGG + Intronic
1105439788 13:20405667-20405689 GCTGGGGAGCAGCAGGAGCGTGG - Intronic
1106354038 13:28962623-28962645 TCTTGAGAGTTTCAGGAGCTAGG - Intronic
1107788651 13:43978687-43978709 CCAGGGAAGTGGCAGGAGATAGG + Intergenic
1108104797 13:46997554-46997576 GATGGGCAGGTGCAGGAGCTGGG + Intergenic
1111407492 13:87827842-87827864 CATGTGTAGTTGCAGGTGCTGGG - Intergenic
1112259811 13:97867945-97867967 CATGGGCAGGTGCAGGAGCTGGG - Intergenic
1112289746 13:98135037-98135059 GCTGGGGAGTTGGAGGAGAATGG - Intergenic
1114269559 14:21092498-21092520 CCTCGGGAGCGGCAGGAGCTGGG + Exonic
1118758506 14:68863261-68863283 CCTGGGGTGCTGAAGGGGCTTGG - Intergenic
1119179686 14:72597419-72597441 CCTGGGGGTTTCCAGGTGCTGGG - Intergenic
1119541881 14:75444408-75444430 TCTGAGGCGTTGCAGGAGCAGGG + Intronic
1121221947 14:92292278-92292300 CCTGGGCTGTAGCAGGTGCTAGG - Intergenic
1121433926 14:93906501-93906523 CCAGGGGAGGTGGAGGAGGTGGG - Intergenic
1122265031 14:100542538-100542560 GCTGGGGAGGGACAGGAGCTGGG - Intronic
1122355300 14:101119577-101119599 GCTGGGCAGTCGGAGGAGCTAGG + Intergenic
1122886228 14:104711648-104711670 CCGGGGCAGCTGCAGGAGGTCGG - Exonic
1202922290 14_KI270723v1_random:36439-36461 GCTGGGGTGTTGCAGGGGCACGG - Intergenic
1124824981 15:33084708-33084730 CTTGGGGAATGGCAGGAGGTGGG - Intronic
1124983485 15:34584056-34584078 GCTGGGGAGTTGCAGGGGTCTGG + Intronic
1126766821 15:52018632-52018654 CCTGGCTTGTTGCAGGAACTGGG - Intronic
1126964669 15:54038245-54038267 CCTGAGTAGCTGCAGTAGCTGGG + Intronic
1127633746 15:60849999-60850021 CCTGGAAAGATGCAGGAGCAGGG + Intronic
1127871838 15:63080402-63080424 CCTGGGGAGACACAGGACCTGGG - Intergenic
1128337377 15:66795920-66795942 GCATGGGAGGTGCAGGAGCTGGG - Intergenic
1128345400 15:66849814-66849836 CCTGGGGAGCTGTCGGAGATGGG - Intergenic
1128345627 15:66850741-66850763 GTTGGGGAGAAGCAGGAGCTGGG + Intergenic
1128546864 15:68574231-68574253 ACTTGAGAGCTGCAGGAGCTTGG + Intergenic
1128727495 15:69998889-69998911 GCTGGGGAGTGGCAGGAAGTTGG - Intergenic
1129144222 15:73633031-73633053 CCTGAGGAGACGCTGGAGCTCGG - Intronic
1130306057 15:82712757-82712779 CCAGGGGTGTTAGAGGAGCTGGG + Intergenic
1130336136 15:82958745-82958767 CCTGGGAAGCTGCAGCTGCTGGG + Intronic
1131365640 15:91837119-91837141 TCTGGGCAGGTGCAGGAGCCAGG + Intergenic
1132675093 16:1118214-1118236 CCTGGGGGGGTGCAGGCGGTGGG - Intergenic
1133333003 16:4987903-4987925 GCTGGGGAGTAGCGGGAACTGGG + Intronic
1133343618 16:5055394-5055416 CCTGGGGAGTGGGAGGAGGTGGG - Intronic
1134080241 16:11319879-11319901 TCTGAGGAATTGCAGGAGCCTGG + Intronic
1135036824 16:19085814-19085836 CCTGGGCTGTGGTAGGAGCTGGG - Intergenic
1135134702 16:19879023-19879045 GGTGGGGAGGTGAAGGAGCTAGG - Intronic
1135709277 16:24701236-24701258 CAGGGGGAGCTTCAGGAGCTGGG + Intergenic
1137712273 16:50574634-50574656 CCTGGGGCGTGCCAGGAGCCAGG + Intronic
1139251708 16:65502777-65502799 CCTGGGGAGGGACAGGAGATGGG - Intergenic
1139348852 16:66322781-66322803 GCTGGGGAGAGGCAGGAGCCAGG - Intergenic
1139386809 16:66578342-66578364 GCTGGAGAGGTGCAGGATCTGGG - Intronic
1139484641 16:67248782-67248804 ACTGGGGAATTTCCGGAGCTGGG + Intronic
1140682881 16:77402450-77402472 CCCAGGGATTTGCAGGAGCCTGG - Intronic
1141198834 16:81882131-81882153 CCTGAGCACTTGCAGGAGCCTGG - Intronic
1141516284 16:84547492-84547514 CCTGAGGAGGTGGAGGAGCTGGG - Intronic
1141733041 16:85834977-85834999 CCAGGGCAGGTGCAGGAGCCAGG + Intergenic
1142264607 16:89057936-89057958 CCTGGACAGCTGCAGGACCTGGG + Intergenic
1142706396 17:1697689-1697711 GCTGGGGAGATGGAGGAGATGGG - Intergenic
1142881865 17:2888036-2888058 CCCAGGGAATAGCAGGAGCTTGG + Intronic
1143482589 17:7236209-7236231 CCTGGGGAGGCCCAGGAGGTGGG + Exonic
1143502053 17:7345015-7345037 GCTGGGGAGTTGGAAGAGCAGGG + Intronic
1143684570 17:8503763-8503785 CCTGGGGAGTTGCTGAGGCCTGG - Intronic
1144595065 17:16562574-16562596 GCTGGGGAGATGTAGGAACTGGG + Intronic
1144608277 17:16686924-16686946 CGTGTGGAGGTGCAGGACCTGGG + Intergenic
1144848755 17:18233520-18233542 CCTGGTGGGTGGGAGGAGCTGGG + Intronic
1144951083 17:18993807-18993829 CCTGGGAAGCTGCATGACCTTGG + Intronic
1145091620 17:19990957-19990979 ACTGGTTAGCTGCAGGAGCTTGG - Intergenic
1145128048 17:20317875-20317897 CGTGTGGAGGTGCAGGACCTGGG + Intronic
1145196561 17:20899338-20899360 CGTGTGGAGGTGCAGGACCTGGG - Intergenic
1146301628 17:31694063-31694085 CCTGGGGAAGAGCAGGAGTTAGG + Intergenic
1146554936 17:33815237-33815259 CCTAGGAAGATTCAGGAGCTGGG - Intronic
1146651060 17:34606685-34606707 CCTGGCAAGTTGGAGGAGCTGGG + Intronic
1146695047 17:34902642-34902664 CCTGGGGAGATGCAGTAGGAAGG - Intergenic
1146824090 17:36008566-36008588 GATGGGAAGGTGCAGGAGCTGGG - Intergenic
1146884459 17:36461909-36461931 CGTGGGGAGGGGCAGGAGCCTGG - Intergenic
1147164257 17:38585091-38585113 CCTGGGCAGGGGTAGGAGCTGGG + Intronic
1148020159 17:44548120-44548142 TGTTGGGAGTTGGAGGAGCTGGG - Intergenic
1148382399 17:47209506-47209528 CCTTGGGAGCCTCAGGAGCTGGG - Exonic
1151743580 17:76000308-76000330 CCTCTGGAGCTGCAGGAGCCCGG + Exonic
1152097392 17:78279916-78279938 CCTGGGCTGTTCCAGGGGCTGGG + Intergenic
1152610879 17:81314547-81314569 CTGGGGGAGTTGCAGGTGGTGGG - Intronic
1153757644 18:8300183-8300205 ACTGGGGACTTGCAGGAGAAGGG + Intronic
1153783585 18:8515231-8515253 CCTGAGGAGTGGCAGGATATGGG - Intergenic
1155189608 18:23417909-23417931 CCTTTGGAGAAGCAGGAGCTTGG - Intronic
1155334435 18:24749892-24749914 GCAGGGGAGGTGCAGGAACTGGG + Intergenic
1155374627 18:25142272-25142294 CCTGGTGAGCTGCCTGAGCTTGG - Intronic
1156500372 18:37553837-37553859 CCTGGGCTGCTGCAGGAGCTGGG + Intronic
1157113233 18:44840689-44840711 CCTTGGCAGTTTCAGGAACTGGG - Intronic
1157174930 18:45442913-45442935 CATGGGGATTGGCAGGTGCTAGG + Intronic
1157277474 18:46321978-46322000 CCTGGGGACTTGAAGGAGAGAGG - Intergenic
1157478526 18:48038165-48038187 TCTGGGGAGTAACAGGAGCAGGG + Intronic
1158350802 18:56563090-56563112 TCTGGGGGGTCTCAGGAGCTGGG - Intergenic
1159867815 18:73727115-73727137 GCTGGGGACTTGCAAGAGCTAGG - Intergenic
1160429918 18:78804203-78804225 GCTGGGGAGTGTCATGAGCTTGG + Intergenic
1160787747 19:909138-909160 GCTGGGGAGCTGCTGGAGTTTGG + Intronic
1161085062 19:2331180-2331202 ACTGAGGAGTTCCAGGAGCCGGG - Intronic
1161332204 19:3693684-3693706 CCTGGGAAGCTGCACGACCTGGG - Intronic
1161363372 19:3864039-3864061 CCTGGAGAGTTTCAGGAAGTGGG - Intronic
1162061798 19:8100753-8100775 CCTGGGGAGTTGGAGGTGTGTGG + Intronic
1162922169 19:13909680-13909702 CCTGGGGAGTGCCAGGAGGCTGG - Intronic
1163182781 19:15615811-15615833 CCTGGTGAGTGGCAGGAGGATGG + Exonic
1163476060 19:17526874-17526896 CCTGGGGACTCCTAGGAGCTGGG + Intronic
1163779652 19:19239712-19239734 CCTGGGGAGGAGCAGGAGGGAGG - Intronic
1164822432 19:31260429-31260451 CCTGGGGCTGTGCAGAAGCTGGG + Intergenic
1165010241 19:32840756-32840778 CCAGGGGAGGTGGAGGAGCAGGG - Intronic
1165420842 19:35721213-35721235 CCGGGGGAGGTGGAGGGGCTGGG - Exonic
1165591721 19:36974331-36974353 CCTGGGGTGGGGCAGGAGTTTGG + Intronic
1166122007 19:40691834-40691856 AGTGGGGAGGTGCAGGATCTAGG + Exonic
1166230071 19:41421494-41421516 CCTGGCGTGTTTGAGGAGCTGGG + Intronic
1166293856 19:41879448-41879470 TCTGGGGCCTTGCAGGAGGTGGG + Intronic
1166702047 19:44887904-44887926 CAGGGTGAGTTGCACGAGCTGGG + Intronic
1166871189 19:45872206-45872228 CCAGGGGGGCTGCAGGTGCTGGG - Exonic
1167382943 19:49149134-49149156 CGTGGGGATCTGCAGGAGCAAGG - Exonic
1167402163 19:49280068-49280090 GCTGTGGAGTTGGTGGAGCTGGG + Intergenic
1167593671 19:50416946-50416968 TCTGGGGACTTTCAGAAGCTGGG + Intronic
1168164025 19:54534230-54534252 CCTGGGGAGTAGCAGACGCAGGG + Intronic
925314087 2:2908033-2908055 CCTTGGTGGTTGTAGGAGCTGGG + Intergenic
925389048 2:3483218-3483240 GCTGGAGAGCGGCAGGAGCTCGG - Intronic
926504880 2:13701308-13701330 CCGGAGGAGGTGCAGGAGCACGG + Intergenic
927146986 2:20172589-20172611 TCTGGGGAGCTGCTGGGGCTTGG + Intergenic
927701293 2:25270536-25270558 CCTGGGGAACAGCTGGAGCTGGG + Intronic
928359497 2:30651579-30651601 GCTGTGGAGTTGAGGGAGCTGGG - Intergenic
929594856 2:43169667-43169689 CCTGGGGGGCTCCAGGAGATAGG + Intergenic
929630029 2:43450112-43450134 CATGGGGAGTTACAAAAGCTAGG + Intronic
930106250 2:47642256-47642278 TCTGGGGAGCAGCAGGAGTTTGG - Intergenic
930216314 2:48700975-48700997 ACTGGACAGTGGCAGGAGCTAGG + Intronic
931188168 2:59973804-59973826 CCTGGGGAGTTTCAGGGGAAAGG - Intergenic
931464068 2:62471654-62471676 GCTGGGGAGGGGGAGGAGCTTGG + Intergenic
932486106 2:72085275-72085297 CCAGGGCAGTTGCAGAAGCCTGG + Intergenic
932770915 2:74500306-74500328 CCTGGGCAGTTGCACCAGCTGGG - Intronic
933425993 2:82112776-82112798 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
933882160 2:86680658-86680680 GCTGAGCAGGTGCAGGAGCTGGG + Intronic
934036880 2:88095675-88095697 TCTGGGGAGATACAGGAGCATGG + Intronic
934580563 2:95434466-95434488 CCTGGGCACTGCCAGGAGCTGGG + Intergenic
934598886 2:95642251-95642273 CCTGGGCACTGCCAGGAGCTGGG - Intergenic
934649382 2:96082322-96082344 CCTGGGCAGCTGCCGGAGGTGGG - Intergenic
934662986 2:96153025-96153047 GCTGGGGAGCTGCAGGAGGTGGG + Intergenic
934791719 2:97067806-97067828 GATGGGTAGGTGCAGGAGCTGGG + Intergenic
935165801 2:100567685-100567707 CCTGAGGAGCTGGAGGCGCTGGG + Intronic
936269385 2:111037162-111037184 CTTGGGGAGATGGAGAAGCTTGG - Intronic
936532233 2:113284244-113284266 CCTGGGCACTGCCAGGAGCTGGG - Intergenic
936622954 2:114119140-114119162 CCTGGGAGATTGCATGAGCTAGG + Intergenic
936989444 2:118346903-118346925 CCTGCAGAGCTGCTGGAGCTAGG - Intergenic
937365333 2:121257186-121257208 CCTTGGGAGTGGCAGGGGCTGGG + Intronic
940655722 2:156485683-156485705 CCTGGGTAATTGCAGGAAATAGG - Intronic
941912200 2:170774506-170774528 CCTGGGAAGTGACAGGAACTGGG + Intergenic
942705286 2:178764794-178764816 CTTGGGGCGGTTCAGGAGCTAGG + Exonic
943787444 2:191893933-191893955 CCTACGGACTTGAAGGAGCTGGG + Intergenic
944254776 2:197614648-197614670 GATGGGCAGGTGCAGGAGCTGGG - Intronic
944502674 2:200378183-200378205 CCAGGGTAGTAGCAGGATCTTGG - Intronic
945050344 2:205818206-205818228 TTTGGGGAGTTGTAGAAGCTAGG - Intergenic
947129223 2:226904308-226904330 GATGGGCAGGTGCAGGAGCTGGG - Intronic
948589199 2:239038654-239038676 CCTTGGGAGATGGAGGAGCCTGG - Intergenic
948614810 2:239191588-239191610 CCTGGGCACTGGCCGGAGCTTGG + Intronic
948774122 2:240272832-240272854 CCTGCCAAGTTACAGGAGCTTGG - Intergenic
948933749 2:241149363-241149385 CCTGGGGAGATGGCGGAGCCCGG + Intronic
949058373 2:241942179-241942201 CCAGGGGAGTGGGAGGAGGTGGG + Intergenic
1168759762 20:342027-342049 ACTGGGGAGCTGGAGCAGCTGGG - Intergenic
1168957347 20:1843587-1843609 CCTGGTGTGTAGCAGGAGCTCGG - Intergenic
1169572378 20:6920538-6920560 CCTGGGGAGTAAAAGGGGCTAGG + Intergenic
1171091144 20:22286870-22286892 CCTGGGGAATAGCCTGAGCTAGG - Intergenic
1171795111 20:29560396-29560418 TCTGGGAAGTTGAAGGGGCTGGG - Intergenic
1171853343 20:30323869-30323891 TCTGGGAAGTTGAAGGGGCTGGG + Intergenic
1172189595 20:33053943-33053965 CTTGTGGAGCTGCAGGAGCAAGG + Intergenic
1172286634 20:33745278-33745300 CCTGGCGATTGGCAGGAGTTGGG - Exonic
1172781409 20:37438829-37438851 CCTGGAGAGTTGGAGGAGCGAGG - Intergenic
1172846346 20:37931813-37931835 CCTGGGGAGATGCCCAAGCTGGG + Intronic
1174137079 20:48387100-48387122 CTTGGGGAATGGCAGGAGCAGGG - Intergenic
1174183031 20:48686942-48686964 CCTGGGAAGGAGCAGGAGCCCGG - Intronic
1174355064 20:49992010-49992032 CCTGGTGGGTTGCAGGAGGTGGG + Intergenic
1175897580 20:62346215-62346237 CCTGGGCAGGGGCAGGAGCCGGG + Exonic
1176981058 21:15381330-15381352 GATGGGTAGGTGCAGGAGCTTGG - Intergenic
1179259766 21:39747441-39747463 CCTGGGGGGTTCCAGGAACCTGG + Intronic
1179552370 21:42151261-42151283 GCTGGGGAGAGGCAGGCGCTGGG + Intergenic
1179572731 21:42287391-42287413 CCTGGGGACTTGGAGGTCCTGGG - Intronic
1180224899 21:46386488-46386510 CCTGGGTAGCTGCAGGCACTGGG + Intronic
1181171011 22:21010110-21010132 CCTTGAGAGGTGAAGGAGCTTGG - Intronic
1181636458 22:24176960-24176982 TCTAGGGAGCTGCACGAGCTGGG - Intronic
1181648294 22:24245591-24245613 CCTGGGGAGTTGTGGGACCCAGG - Intergenic
1181697640 22:24601930-24601952 CTTGGCCAGTTACAGGAGCTGGG - Intronic
1181935506 22:26435588-26435610 CCTGGGAAGGAGCCGGAGCTGGG + Intronic
1182516987 22:30864646-30864668 GCTGGGGAGTGGCAAGAGCAGGG - Intronic
1183210815 22:36450033-36450055 CGTGGGGACTTCCCGGAGCTGGG + Intergenic
1183278065 22:36913797-36913819 CCTGGGGACTTGGAGGAGTTAGG + Intronic
1183281231 22:36933719-36933741 CCTGGGGTATGGCAGGAGCTAGG + Intronic
1183288822 22:36985200-36985222 CCAGGGCAGTGGCAGGAGCCAGG - Intergenic
1183416596 22:37686181-37686203 GCTGGGGAGGGGCTGGAGCTGGG + Intronic
1183510647 22:38232753-38232775 GCTCGGGAGTGGCGGGAGCTTGG - Intronic
1183689740 22:39381967-39381989 CCTGGGCAGGAGCAGGGGCTGGG - Exonic
1184020771 22:41819841-41819863 GCTGGGGAGTGTCAGGAGATGGG + Intronic
1184160610 22:42695112-42695134 CCTGGTGTGTTGGAGGAACTTGG + Intronic
1184324968 22:43775921-43775943 GCTGGGGAGGTGCAGAGGCTGGG - Intronic
1184676454 22:46045697-46045719 CCTGGGGAGGAGGAGAAGCTGGG + Intergenic
1184766767 22:46576466-46576488 CCTGGGGAGATGCAGGGGTGTGG + Intronic
1184965137 22:47966020-47966042 CTGGGGGAGGTGCAGGAGCCTGG - Intergenic
1184994184 22:48192808-48192830 CTTGTGGAGAGGCAGGAGCTTGG - Intergenic
949229138 3:1730053-1730075 CCTTGGGAGGTTTAGGAGCTGGG - Intergenic
949260671 3:2099478-2099500 CCTGGGGAGTGGAGGGACCTGGG + Intronic
950427951 3:12934832-12934854 CTTGGGGAGATGCATGAGTTGGG - Intronic
950936222 3:16842411-16842433 CTTGGGTTGCTGCAGGAGCTGGG - Intronic
952908985 3:38166006-38166028 CGTGGGGAGCCGCGGGAGCTCGG + Intronic
953056039 3:39387896-39387918 CCTGGGGTGCAGCAGGTGCTTGG + Intronic
953850852 3:46464631-46464653 CATGGGGAGGAACAGGAGCTGGG - Intronic
956476189 3:69622273-69622295 CCTGGGCAGGTCCAGGAGCCAGG - Intergenic
956652741 3:71520407-71520429 CCTGTGGAGTTGCACAAGATGGG - Intronic
956689331 3:71861383-71861405 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
958467293 3:94473406-94473428 GGTGAGGAGATGCAGGAGCTAGG + Intergenic
960993335 3:123325606-123325628 CCTGGGGAGTTCCAGGATCTGGG - Intronic
961349775 3:126292398-126292420 CGTGGGGAGCAGCAGGAGCTGGG - Intergenic
961369100 3:126418864-126418886 CCAGAGGAGTTGCAGGGGCTGGG - Intronic
961402987 3:126660245-126660267 CCTTGGGATGTGCAGGAACTTGG - Intergenic
961824767 3:129593226-129593248 CCTGGGAGCTGGCAGGAGCTGGG - Intronic
962850720 3:139306617-139306639 CCTGGGTAGATGCAGGGGCTTGG - Intronic
962882986 3:139596299-139596321 CCTGTGTAGTTCCAGGAGGTAGG + Intronic
962946556 3:140176344-140176366 CCTGTGGAGTTGGAGAAGTTGGG + Intronic
962952633 3:140233377-140233399 CATGGGGTGCTGCATGAGCTTGG - Intronic
963102898 3:141623010-141623032 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
964391317 3:156201075-156201097 CCTGGGAAGTGCAAGGAGCTAGG - Intronic
964791153 3:160453722-160453744 ACTGGGGGGCTGGAGGAGCTGGG + Intronic
967963180 3:194941433-194941455 CCTGGTGACTGGCAGGAGTTTGG + Intergenic
967989833 3:195122607-195122629 CCTGTGGAGTCGAAGGACCTTGG - Intronic
968615226 4:1574721-1574743 CCTGGACAGGTGCAGGAGGTGGG + Intergenic
968643409 4:1726439-1726461 CCTGGGGACTTGCAGGCCCCAGG - Intronic
968880269 4:3294967-3294989 CCTGGGGAGGGTCAGGAGGTGGG + Intronic
968883221 4:3312096-3312118 CCCTGGGAGGTGCAGGGGCTTGG + Intronic
969212468 4:5698308-5698330 CCTGGAAACTTGCAGGATCTTGG - Intronic
969308955 4:6340950-6340972 CCTGGAGAGCTGCAGGGTCTGGG + Intronic
972667789 4:41183822-41183844 CTGGGGGAGTTGCAGGGGGTGGG + Intronic
973153109 4:46912665-46912687 CCTGGGAAGGGGCAGGAGATGGG - Intergenic
973217668 4:47688506-47688528 CCTGGAGAATTGCTTGAGCTCGG + Intronic
973772980 4:54223594-54223616 CCTGGGGGATAGCAGGAGTTTGG - Intronic
974301992 4:60081180-60081202 CCTGGGAAGTGCAAGGAGCTGGG + Intergenic
977445169 4:97122309-97122331 CCTGGAGAGTGGCAGGAGCTTGG - Intergenic
978861276 4:113452052-113452074 GCTGGGGAGTAGCAGGAGCTGGG + Intronic
980871508 4:138616026-138616048 GATGGGCAGGTGCAGGAGCTGGG - Intergenic
981614443 4:146632583-146632605 TCTGAGGAGTGGCAGGAGGTGGG + Intergenic
985531429 5:436055-436077 CCTGGGGTGTGGCTGCAGCTGGG + Exonic
985891671 5:2720391-2720413 CATGTGGAGTCACAGGAGCTGGG + Intergenic
985988881 5:3538927-3538949 CCTGGGGAGCTGCAGTTCCTGGG - Intergenic
986082628 5:4410047-4410069 GCTGTGGGGTTGAAGGAGCTCGG + Intergenic
986469590 5:8060808-8060830 CCTGGCCACTTGCTGGAGCTGGG - Intergenic
987113355 5:14707647-14707669 CCTTGGGAGGTGCAGGGGGTGGG - Exonic
987322633 5:16784728-16784750 CCTGTGGAGTACCAAGAGCTGGG + Intronic
987504783 5:18754049-18754071 GATGGGCAGGTGCAGGAGCTGGG + Intergenic
988855458 5:35224007-35224029 CCTGGGATGTCGCAGGAGCTTGG + Intronic
989156816 5:38352203-38352225 GCTGGGGAGCTGCAGGAGGCAGG - Exonic
990682112 5:58256602-58256624 CTTGGGGAGGAGCAGGAGGTTGG - Intergenic
991451442 5:66754993-66755015 CGAGTGGAGTGGCAGGAGCTGGG + Intronic
992160049 5:73992387-73992409 GATGGGCAGGTGCAGGAGCTGGG + Intergenic
994533161 5:100992566-100992588 GATGGGCAGATGCAGGAGCTGGG + Intergenic
996513269 5:124341578-124341600 CCTGCAGAGCTCCAGGAGCTTGG + Intergenic
996879824 5:128283591-128283613 CCTGGAGAGTAGGAGGAGCAGGG - Intronic
997228121 5:132224775-132224797 CCTGGGTACTTGTAGGAGCCTGG - Intronic
998204368 5:140148499-140148521 CCATGGGAGGTGCAGGAGCCAGG + Intergenic
1000334869 5:160234773-160234795 CCTGGGTTGTTGCAGGTGATTGG - Intronic
1001452974 5:171840354-171840376 CCTGGGGAAGAGCAGGTGCTAGG + Intergenic
1001541508 5:172542944-172542966 CCAGGGGTGCTGCCGGAGCTGGG + Intergenic
1001633151 5:173191700-173191722 CCTGGCAGGTGGCAGGAGCTTGG - Intergenic
1002632813 5:180591937-180591959 CCTGGGGAGGTGGAGGCGCCAGG + Intergenic
1002847700 6:962542-962564 CCAGGGGAGATGGAAGAGCTAGG - Intergenic
1002897495 6:1388218-1388240 CCTGGGGAGTTGCAGGAGGCAGG - Intergenic
1004428639 6:15523788-15523810 CCTGGGGAAGAGAAGGAGCTTGG - Intronic
1004469496 6:15916695-15916717 GATGGGCAGGTGCAGGAGCTGGG + Intergenic
1006019863 6:31111687-31111709 CCTGGGGAGGTGGAGGCCCTGGG - Exonic
1006199883 6:32279091-32279113 CCTGGGAAGTGCAAGGAGCTGGG + Intergenic
1006349903 6:33513332-33513354 ACTGGGGACTTGCAGAAACTGGG - Intergenic
1006809468 6:36810596-36810618 CCTGGGGAGGCGGAGGAGCACGG + Intronic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1007712991 6:43836393-43836415 CCTGGGGAACTGCAGGAGCAAGG + Intergenic
1008656933 6:53624679-53624701 CCCTGGGAGTTGAAGGAGCTTGG - Intergenic
1009976414 6:70675710-70675732 CCTGGGGATTAGCAGGGGATAGG + Intronic
1011700601 6:89951100-89951122 CCTGGAGAGATCCAGGAGCGTGG - Exonic
1013793350 6:113859128-113859150 CCTGGGTGGGCGCAGGAGCTCGG + Intronic
1016886339 6:148963209-148963231 GCTGGGGAGAGGCAGGAGCGGGG + Intronic
1017358304 6:153536295-153536317 CCATGGGAGCTGGAGGAGCTGGG - Intergenic
1017366999 6:153654941-153654963 CCTGGGTATTTGCAGGGGATTGG - Intergenic
1018650525 6:165988317-165988339 CCCGGGGAGGTGCTGGGGCTGGG + Intergenic
1018840670 6:167514276-167514298 CCTGGGGACTGGCAGGACTTGGG + Intergenic
1019734737 7:2645107-2645129 CCTGGGGGGTGTCAGCAGCTGGG - Intronic
1019770818 7:2882802-2882824 CTTGGAGAGGTGAAGGAGCTGGG - Intergenic
1020044609 7:5031757-5031779 CCTGGGGAGATGGAGGAGGTGGG - Intronic
1020044621 7:5031785-5031807 CCGGAGGAGTTGGAGGAGGTGGG - Intronic
1020289969 7:6715779-6715801 CCTGGGGAGGTGGAGGAGGTGGG - Intergenic
1020841091 7:13218856-13218878 GCTGGTAAGTAGCAGGAGCTGGG + Intergenic
1021393193 7:20119543-20119565 GCTGGGAAGTTGGAGGAGCATGG + Intergenic
1022640388 7:32177463-32177485 CCTGAGGAGGTGCAGGGGCAAGG - Intronic
1023175856 7:37434742-37434764 CCTTGGATGTTGCAGGAACTGGG - Intronic
1023264850 7:38393951-38393973 CCTGGGAAGTAGCATGGGCTGGG - Intronic
1023825744 7:44007597-44007619 CCTGGGGAGGTGGAGGAGGTGGG + Intronic
1023834437 7:44060039-44060061 CCTGGGCAGGTGCAGCAGCAAGG + Exonic
1024054036 7:45648223-45648245 CCTGGGGAGAAGCAGCTGCTGGG + Intronic
1024145541 7:46512977-46512999 CCTGGAGTGTTGCAAGAGCAAGG + Intergenic
1025018074 7:55457088-55457110 GCTGGGAAGTTGCAGGGGTTGGG - Intronic
1025187735 7:56874209-56874231 CCTTGGGAGTTCAAGTAGCTGGG + Intergenic
1025684188 7:63702717-63702739 CCTTGGGAGTTCAAGTAGCTGGG - Intergenic
1026089316 7:67286448-67286470 CCTGGGGAGGTGGAGGAGGTGGG + Intergenic
1026724968 7:72864052-72864074 CCTGGGGAGGTGGAGGATGTGGG - Intergenic
1026833335 7:73623182-73623204 CCTGCGGGGGAGCAGGAGCTGGG - Intronic
1027118891 7:75501738-75501760 CCGGAGGAGTTGGAGGAGGTAGG + Intergenic
1027118904 7:75501766-75501788 CCTGGGGAGGTGGAGGAGGTGGG + Intergenic
1027272917 7:76533843-76533865 CCTGGGGAGGTGGAGGAGGTGGG - Intergenic
1027326366 7:77052927-77052949 CCTGGGGAGGTGGAGGAGGTGGG - Intergenic
1028479039 7:91284539-91284561 CCTGGGAAGTTGAAGAAGCATGG + Intergenic
1029243967 7:99185049-99185071 CTTGTTGTGTTGCAGGAGCTGGG + Exonic
1029397741 7:100319791-100319813 CCGGAGGAGTTGGAGGAGGTGGG + Exonic
1029397753 7:100319819-100319841 CCTGGGGAGGTGGAGGATGTGGG + Intronic
1029718588 7:102348251-102348273 CCTGGGGAGGTGGAGGAGGTGGG - Intergenic
1029754028 7:102561004-102561026 CCTGGGGAGGTGGAGGAGGTGGG + Intronic
1029771978 7:102660094-102660116 CCTGGGGAGGTGGAGGAGGTGGG + Intronic
1031292377 7:119952495-119952517 CCTGGGGGGTTTTAGGAGCGAGG + Intergenic
1031863558 7:127012170-127012192 TTTGAGGAGTTGCAGGTGCTTGG - Intronic
1032641983 7:133780066-133780088 TCTGGGGAGTTGGAAGAGCAGGG + Intronic
1032919434 7:136528464-136528486 TCTGGGGAGGAGGAGGAGCTAGG - Intergenic
1034162793 7:149005266-149005288 GCTGGGGAGGTGAAGGACCTGGG - Exonic
1035216618 7:157372389-157372411 CCTGGGGACGTAGAGGAGCTCGG + Intronic
1035652770 8:1281438-1281460 GCTGGGGAGGCGCAGGAACTTGG - Intergenic
1037446522 8:18971300-18971322 CCTGTGGTGTGGCAGGACCTTGG - Intronic
1037724618 8:21473041-21473063 GCTGGGGAAGTGGAGGAGCTTGG - Intergenic
1037762167 8:21748856-21748878 TCTGGGGAGCTGCAGGTGTTGGG - Intronic
1038328330 8:26589001-26589023 CCTGGCGAGAGGCAGGAGGTGGG - Intronic
1039531838 8:38269294-38269316 CCTGGGGAGCCGCCGGAGCGCGG - Intronic
1041889753 8:62855981-62856003 CCTGAGGAGTTGCTGGTGATTGG - Intronic
1044745491 8:95366866-95366888 CCTGGGCAGAAGCAGGAGATGGG - Intergenic
1044955534 8:97475940-97475962 CCTGGAGATTTGCATGAGCATGG - Intergenic
1045534088 8:103010765-103010787 GCATGGGAGGTGCAGGAGCTGGG + Intergenic
1046033234 8:108808246-108808268 CCTGGGGAGTTTCATCAGCCAGG - Intergenic
1046366097 8:113235040-113235062 TCATGGGAGGTGCAGGAGCTGGG + Intronic
1046770611 8:118112896-118112918 CACTGGGAGTGGCAGGAGCTTGG - Intergenic
1047327499 8:123853872-123853894 TCTGTGGAGTTGCAGGAGACTGG - Intronic
1048992376 8:139768344-139768366 CCCAGGGAACTGCAGGAGCTAGG - Intronic
1048992552 8:139769945-139769967 CCTGGGGAGTTGCAGGAGCTAGG - Intronic
1049497521 8:142943310-142943332 CTTCGGGAGCTGCGGGAGCTGGG + Intergenic
1049849586 8:144823606-144823628 CCTGGGGAGGTGCAGCAGGCAGG + Intergenic
1050981138 9:12017708-12017730 GGTGGGCAGGTGCAGGAGCTGGG + Intergenic
1051991771 9:23161105-23161127 ACTGGGGAGGAGCATGAGCTAGG + Intergenic
1052023576 9:23551217-23551239 GCTGTGGAGAAGCAGGAGCTTGG - Intergenic
1053175142 9:35917307-35917329 GCTGGGGAGTTGCAAGCGGTAGG + Intergenic
1054179490 9:61898862-61898884 TCTGGGAAGTTGAAGGGGCTGGG + Intergenic
1054473793 9:65558724-65558746 TCTGGGAAGTTGAAGGGGCTGGG - Intergenic
1054658048 9:67681959-67681981 TCTGGGAAGTTGAAGGGGCTGGG - Intergenic
1055954436 9:81760999-81761021 CCTGGTGTGTTCCAGGAGCAAGG - Intergenic
1056317977 9:85409713-85409735 CCTGGGGAGTGGCAAGAGGCAGG + Intergenic
1056319213 9:85420824-85420846 CCTGGGAAGCTGCACCAGCTCGG - Intergenic
1056789205 9:89614868-89614890 CCAGAGGGGCTGCAGGAGCTGGG + Intergenic
1057146215 9:92761020-92761042 CCTGGGCAGCTGCAGGAAGTGGG - Intronic
1057806495 9:98223359-98223381 CCTGGGGTGTGGCAGGAAGTTGG + Intronic
1058484372 9:105428819-105428841 CCTCTGGAGTTGTAGTAGCTGGG + Intronic
1059431589 9:114253875-114253897 TGTGGGCAGTTTCAGGAGCTGGG + Intronic
1059761601 9:117342945-117342967 CCATGGGAATTTCAGGAGCTTGG + Intronic
1060153367 9:121302518-121302540 ACTGGGGAGTGCCTGGAGCTGGG - Intronic
1060718311 9:125955319-125955341 CCTGGGGAGGAGCAGGAGCAAGG - Intronic
1060881573 9:127121806-127121828 CTCGGAGAGTTACAGGAGCTGGG - Intronic
1061214095 9:129210390-129210412 GATGGGGAGTGCCAGGAGCTGGG + Intergenic
1061288440 9:129637471-129637493 CCAGGGCATTTGCAGAAGCTGGG - Exonic
1061363451 9:130158021-130158043 CCTGGGAATCTGCAGGATCTGGG - Intergenic
1061367256 9:130178476-130178498 CCTTGGGAGCAGCAGGAGCTGGG - Intronic
1061371969 9:130202351-130202373 CCTGGGGGGTTTCAGGGGGTGGG - Intronic
1061492828 9:130955797-130955819 CCAGGGGAGAGCCAGGAGCTGGG - Intergenic
1061959559 9:133981097-133981119 CCTGGGGAGAAGCAGGAGACGGG + Intronic
1062222984 9:135429126-135429148 CCTGGGGGGTTAGAGGAACTAGG + Intergenic
1062318334 9:135978752-135978774 CCTGGGGAGGTAGAGAAGCTGGG - Intergenic
1062373969 9:136253767-136253789 CTTGGGGAGTGGGAGGAGGTGGG + Intergenic
1062385699 9:136310695-136310717 CCGAGGGCGTTGCAGGGGCTGGG - Intergenic
1062594660 9:137293903-137293925 CCTTGGGAGTTGAAAGAGCTGGG + Intergenic
1186452367 X:9684227-9684249 CCTGGGAAGCTGCAGGAGCTTGG + Intronic
1186820423 X:13282471-13282493 ACTGGGCAGTTGCAGGAGGATGG + Intergenic
1187324534 X:18274267-18274289 GGTGGGCAGGTGCAGGAGCTGGG - Intronic
1188107106 X:26159209-26159231 GCTGGGAAGTAGTAGGAGCTGGG - Intergenic
1189523945 X:41800134-41800156 CCTAGGAAGTTGAAGGAGATGGG - Intronic
1193236395 X:79112853-79112875 CCTGGAGGGGTGCAGGAGATAGG + Intergenic
1196983608 X:121243046-121243068 CCTGGCTTATTGCAGGAGCTTGG - Intergenic
1197821027 X:130540990-130541012 CGGGGGGAGTGTCAGGAGCTGGG + Intergenic
1198645568 X:138802353-138802375 CCTGGGAAGTACAAGGAGCTGGG - Intronic
1200124005 X:153804734-153804756 CCCGGGGTGTTGGTGGAGCTCGG + Exonic
1200141866 X:153906501-153906523 CCTGTGGAGGTGGAGGATCTAGG - Exonic
1200761500 Y:7043164-7043186 CCTGGGAAGGTGCAAGAGGTTGG + Intronic
1201359170 Y:13127510-13127532 CCTGGGAAGTGCAAGGAGCTGGG - Intergenic
1201725927 Y:17152219-17152241 GATGGGCAGGTGCAGGAGCTGGG + Intergenic
1201731680 Y:17211147-17211169 GGTGAGTAGTTGCAGGAGCTGGG - Intergenic