ID: 1048993819

View in Genome Browser
Species Human (GRCh38)
Location 8:139776632-139776654
Sequence CGTGCACACAGGCAGATGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048993819_1048993822 17 Left 1048993819 8:139776632-139776654 CCCGTCATCTGCCTGTGTGCACG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1048993822 8:139776672-139776694 GTGCGCACACACACACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048993819 Original CRISPR CGTGCACACAGGCAGATGAC GGG (reversed) Intronic
900165679 1:1243447-1243469 CGTGCAGACTGGCAGAGAACTGG + Exonic
900888499 1:5432277-5432299 CTTGACCACAGGCAGCTGACTGG + Intergenic
901494127 1:9611823-9611845 CCACCACACAGGTAGATGACTGG - Exonic
903324574 1:22562735-22562757 CGGGCACACAGCCAGGTGGCCGG - Intergenic
915536460 1:156539058-156539080 CCTACACAGAGGCAGAAGACTGG - Intronic
916456571 1:164976914-164976936 CGTGCAAGAAGGCAGGTGACAGG - Intergenic
920260224 1:204684106-204684128 CATGCACCCAGGCCGATGGCAGG - Intronic
921032549 1:211345996-211346018 TGGGCAAACAGGCAAATGACTGG + Intronic
921184319 1:212656709-212656731 CGAGGACACAGGCAGAAGGCAGG + Intergenic
923407006 1:233671491-233671513 CATCCACGCAGGCAGATGACTGG - Exonic
1062788041 10:281599-281621 CATGCAATCAGGCAGTTGACTGG - Intronic
1062798079 10:359093-359115 CGTGCCCAGATGCAGCTGACGGG + Intronic
1062934745 10:1377309-1377331 TGTGCACACATGCACATGCCTGG + Intronic
1062934758 10:1377407-1377429 TGTGCACACATGCACATGCCTGG + Intronic
1063072595 10:2680954-2680976 CGTCCACACAGGCAGCTGCAAGG + Intergenic
1065875033 10:29990211-29990233 CGTGCACACATACAGACGCCTGG + Intergenic
1069823155 10:71239829-71239851 TGTGCTCACATGCAGATCACAGG - Intronic
1070390035 10:75961982-75962004 CATGCACACGGGGAGATGCCAGG - Intronic
1071404133 10:85312576-85312598 CCTGAACTCAAGCAGATGACAGG - Intergenic
1073755032 10:106572466-106572488 AGAGAACACAGGCAGGTGACTGG - Intergenic
1074296437 10:112193494-112193516 AGGGCAAACAGGCAGATGATGGG + Intronic
1076824121 10:132958785-132958807 CTTGCACACAGCCAGGTGACAGG + Intergenic
1078601322 11:12733607-12733629 CATGCACACAGGCAGGAGGCAGG - Intronic
1079292620 11:19201946-19201968 AGTCCACACAGGCAGGTGAGTGG - Exonic
1083664271 11:64266102-64266124 TGTGGACACAGGGAGCTGACAGG - Intronic
1084455320 11:69264891-69264913 GGTGCACACAGCCAGAAGCCAGG + Intergenic
1087345407 11:96965157-96965179 GGTGAACACAGGCAGTAGACAGG + Intergenic
1087422427 11:97946895-97946917 CATGCACACAAACACATGACTGG - Intergenic
1097767495 12:63542765-63542787 GGTGCTCACAGGCAGAGAACAGG + Intergenic
1101878517 12:108610856-108610878 CGGGCACAAAGCCAGATAACAGG + Intergenic
1104918835 12:132280050-132280072 CGTGGACACAGGCAGAATCCAGG - Intronic
1111909009 13:94289419-94289441 TGTTCACACAGGGAGATGACTGG + Intronic
1112567263 13:100562201-100562223 GGTCCACACAGGCAGTGGACAGG - Intronic
1113836616 13:113332204-113332226 CGTGCAGATAGGGAGGTGACGGG - Intronic
1114382867 14:22226650-22226672 CGCGCACACAGGCAGACGCTAGG + Intergenic
1117312400 14:54541128-54541150 CCTGCCCACAGGCAGTTGAGAGG + Intergenic
1121070324 14:91013551-91013573 AGTGCAGACAGGCAGATGCATGG + Intronic
1122920305 14:104877236-104877258 AGTCCACACAGGCAGAGGAGCGG - Intronic
1127803419 15:62496922-62496944 CATGTACACAGGCAGAGCACAGG + Intronic
1127817353 15:62622946-62622968 AGGGCACACAGACAGATGATGGG - Intronic
1128977049 15:72161656-72161678 CTGGCACACAGGCAGAACACTGG - Exonic
1130442533 15:83969473-83969495 CATGCCCATAGGCAGATGAATGG + Intronic
1132329320 15:101000702-101000724 CGTGAACAGAGGCAGACAACGGG - Intronic
1141901957 16:86996796-86996818 CATGCACACAGGCACATTCCAGG - Intergenic
1142137673 16:88459114-88459136 CCTGCACACAGGCAAATTCCAGG - Intronic
1143129314 17:4666259-4666281 TGTGCACACAGGCAGATCGATGG + Intergenic
1143265427 17:5633380-5633402 CGGAGACACAGGCAGATGGCAGG + Intergenic
1145102696 17:20089983-20090005 GCTGTACACAGGCAGATGCCAGG + Intronic
1145914528 17:28563818-28563840 CTTGCACACTGCCCGATGACAGG + Exonic
1149041982 17:52200992-52201014 AATGAACACAGGCAGATGAATGG + Intergenic
1150328374 17:64274808-64274830 TGTGCACACAGGCAGAGGCAGGG - Intergenic
1150917706 17:69453309-69453331 TGTGAAGGCAGGCAGATGACAGG + Intronic
1151043015 17:70885991-70886013 TGTGAACACAGTCAAATGACAGG - Intergenic
1151390566 17:73784240-73784262 CGGGCTCCCAGGCAGATGAAAGG - Intergenic
1151487458 17:74410184-74410206 AATGCAAACAGGCAGAGGACAGG + Intergenic
1152088270 17:78233123-78233145 CGTGCACACAGGTGCATGTCAGG - Intronic
1154253399 18:12763101-12763123 CATGCACACATGCAAATAACTGG - Intergenic
1154494183 18:14943969-14943991 CGAGCCCACAGGAAGAGGACTGG + Intergenic
1155052585 18:22161828-22161850 CTTGCCCACAGGCAGGTTACAGG + Intergenic
1155174337 18:23289693-23289715 CCTGCACACATCCAGATGGCCGG + Intronic
1156252235 18:35361721-35361743 CATGTACACATCCAGATGACTGG - Intergenic
1161267437 19:3370844-3370866 CGTGGACACAGGCAGGAGAGTGG - Intronic
926044220 2:9697956-9697978 CGTGCACACACACAAATAACAGG - Intergenic
926465628 2:13182701-13182723 CCTGCACACAGGTTGTTGACTGG + Intergenic
934903853 2:98182114-98182136 AGGGCAGACAGGCAGGTGACAGG + Intronic
935138865 2:100333447-100333469 CATGCACAAAGGCAGATCATGGG - Intergenic
935664021 2:105494604-105494626 CGTGCCCGCAGGCAGTCGACTGG - Intergenic
936977643 2:118235498-118235520 GGGGTACACAGGCAGATCACAGG + Intergenic
940251462 2:151681475-151681497 CATGCACAAAGGAAGAGGACTGG - Intronic
943638782 2:190336181-190336203 CGTACACACAGAGAGATGACTGG + Intronic
945046288 2:205784687-205784709 CTGGCACAAAGGCAGATGAGTGG - Intronic
945180945 2:207090546-207090568 TGTGAACACAGGCAGAGGAAAGG - Intronic
946852708 2:223922564-223922586 CGAACACACAGGCAGCTGGCAGG - Intronic
948106463 2:235418087-235418109 TGAGCACACAGCCAGATGCCAGG + Intergenic
948142657 2:235685235-235685257 AGGGCACACAGGCAGCTGCCAGG - Intronic
1172309907 20:33909642-33909664 CGTGCACATATGCCTATGACTGG + Intergenic
1172620637 20:36316279-36316301 GGTGCACAGAGGCAGGTGACAGG - Intronic
1173895265 20:46546051-46546073 AGTGCAAACAGGCAGCGGACTGG + Exonic
1175123759 20:56736466-56736488 GGTTCACACATGCAGATGAGAGG - Intergenic
1175551220 20:59819236-59819258 GGTGCCCACAGGCAGATAAGAGG + Intronic
1175688108 20:61046028-61046050 GGTGGACACCTGCAGATGACAGG - Intergenic
1175688142 20:61046178-61046200 GGTGGACACCTGCAGATGACAGG - Intergenic
1180229758 21:46420055-46420077 CGGGCACAGAGGCAGTGGACAGG - Intronic
1180589727 22:16926807-16926829 CATGCAGCCAGGAAGATGACTGG - Intergenic
1181011543 22:20043785-20043807 CATGCACACACTCATATGACTGG - Intronic
1181293842 22:21819090-21819112 CGGACACACAGGGACATGACAGG + Intronic
1183370564 22:37429376-37429398 CTTGCACTCTGGAAGATGACTGG - Intergenic
1184492126 22:44815830-44815852 TGTGCACAGAGCCACATGACGGG + Intronic
952173837 3:30839839-30839861 GGTGCACACAAACAGATGAATGG + Intronic
955666642 3:61356025-61356047 AGTGGAAACAGGCAGATGATGGG + Intergenic
955958219 3:64312373-64312395 AGAGTACACAGGCAGATGAATGG + Intronic
961346504 3:126266873-126266895 CGTGCACACAGGCACAATAGTGG - Intergenic
961442178 3:126959676-126959698 TCTGCACACAGGCAGGTGCCAGG - Intronic
965085615 3:164092114-164092136 AGTTGACACAGGCAGATTACTGG - Intergenic
968177225 3:196561420-196561442 CTTGCATTCAGGCAGAGGACAGG + Exonic
968751373 4:2391052-2391074 CGTGCCCACAGGCAGGTCTCTGG - Intronic
968943365 4:3650988-3651010 CGTGCAGACAGGGAGAGGTCTGG + Intergenic
970005387 4:11405979-11406001 CCTGCAGACAGACAGATGGCAGG - Intronic
982237282 4:153263383-153263405 AGTGCAAACATTCAGATGACCGG + Intronic
983412261 4:167416655-167416677 CGTGCACACATGGAGATATCTGG - Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
990735067 5:58851358-58851380 CGTGCACACAGGCAGCTCCAGGG + Exonic
990739192 5:58895051-58895073 AGTGCACACAGGTGGTTGACTGG - Intergenic
995297089 5:110535166-110535188 CCTGTACACATCCAGATGACCGG + Intronic
996488082 5:124059905-124059927 CGAGGACACAGGGAGAAGACAGG - Intergenic
997397850 5:133578836-133578858 CCTGCACACAGCCAGATTAAGGG + Intronic
997835813 5:137192519-137192541 AGCCCACACAGGCAGATGCCAGG - Intronic
1006420529 6:33931175-33931197 ACTGCAATCAGGCAGATGACTGG - Intergenic
1007658599 6:43468326-43468348 CATGAACACAAGCAGATGACTGG - Intergenic
1011367431 6:86598580-86598602 CGCGCACACATCCAGATGGCGGG - Intergenic
1017819651 6:158039935-158039957 CGTGCACACAGGCGGCTGTGCGG + Intronic
1018084885 6:160292244-160292266 CATGTACACATCCAGATGACCGG - Intergenic
1018610474 6:165643272-165643294 CGAGCAGACAGACAGATGAACGG + Intronic
1018799785 6:167213015-167213037 TGTGTACACAGGCAGAACACAGG + Intergenic
1019262558 7:89657-89679 CCTGCACACAGCCTGCTGACTGG + Intergenic
1019996114 7:4725470-4725492 CCTGCCCACAGGCAGAGGCCCGG + Intronic
1022712264 7:32863197-32863219 CGTGCACAAAGACACAGGACAGG - Intergenic
1022911613 7:34904163-34904185 CGTGCACAAAGACACAGGACAGG + Intergenic
1026553331 7:71386071-71386093 CGGGCTCACAGGCAGTTGGCAGG - Intronic
1027380565 7:77604593-77604615 ATTGCAAACAGGCAGAAGACAGG - Intronic
1031117532 7:117684061-117684083 CGTGTACACAGCCAGAAGATGGG - Intronic
1033250192 7:139752144-139752166 TGTGCACACAGGCACATGCATGG - Intronic
1033611710 7:142969420-142969442 CCTGCAAACAGGCAAATGACTGG + Intergenic
1034285454 7:149880716-149880738 CCTGCACACAGGCAGAGGCCAGG - Intergenic
1039303538 8:36236285-36236307 CAGGCCCACAGGCATATGACGGG + Intergenic
1040694504 8:49979532-49979554 TGTGCAGACAGGCAGAGGAAGGG - Intronic
1041337022 8:56797170-56797192 TGTGCCCAAAGGCAGATGGCAGG - Intergenic
1041912477 8:63103529-63103551 AGAGCAAAGAGGCAGATGACAGG + Intergenic
1043649257 8:82568177-82568199 CTTGCACACAGCCAGAAAACGGG - Intergenic
1043737727 8:83768667-83768689 GCCGCACTCAGGCAGATGACAGG - Intergenic
1044277444 8:90318813-90318835 CTTGCACACAGGAAGAAAACTGG - Intergenic
1048993819 8:139776632-139776654 CGTGCACACAGGCAGATGACGGG - Intronic
1056291734 9:85150413-85150435 CATTCACACAGGCAGATGCATGG - Intergenic
1057192181 9:93094427-93094449 CAGGCACACAAGCAGATGAGAGG + Intergenic
1059327087 9:113510568-113510590 CATGCACACAGGCTGGTGTCTGG + Intronic
1061475243 9:130860994-130861016 CGTGCACACAGGAATGTGTCGGG - Intronic
1187245530 X:17550148-17550170 CGTGCACACACACAGCTGGCTGG + Intronic
1197342224 X:125287721-125287743 GGCGGACTCAGGCAGATGACAGG + Intergenic
1198044742 X:132890126-132890148 CAAGCACACAGCCAAATGACTGG - Intronic
1199738951 X:150714402-150714424 CGTGCAAACAGACAGGTGAAAGG - Intronic