ID: 1048997792

View in Genome Browser
Species Human (GRCh38)
Location 8:139804867-139804889
Sequence TCCCATGAGGACCCCTGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048997785_1048997792 20 Left 1048997785 8:139804824-139804846 CCCCACAGCCTCTTCCATGCAGT 0: 1
1: 0
2: 2
3: 53
4: 269
Right 1048997792 8:139804867-139804889 TCCCATGAGGACCCCTGTATGGG No data
1048997787_1048997792 18 Left 1048997787 8:139804826-139804848 CCACAGCCTCTTCCATGCAGTGC 0: 1
1: 0
2: 1
3: 35
4: 288
Right 1048997792 8:139804867-139804889 TCCCATGAGGACCCCTGTATGGG No data
1048997786_1048997792 19 Left 1048997786 8:139804825-139804847 CCCACAGCCTCTTCCATGCAGTG 0: 1
1: 0
2: 2
3: 27
4: 249
Right 1048997792 8:139804867-139804889 TCCCATGAGGACCCCTGTATGGG No data
1048997788_1048997792 12 Left 1048997788 8:139804832-139804854 CCTCTTCCATGCAGTGCTTCAGA 0: 1
1: 1
2: 4
3: 24
4: 211
Right 1048997792 8:139804867-139804889 TCCCATGAGGACCCCTGTATGGG No data
1048997789_1048997792 6 Left 1048997789 8:139804838-139804860 CCATGCAGTGCTTCAGACACATT 0: 1
1: 0
2: 0
3: 18
4: 203
Right 1048997792 8:139804867-139804889 TCCCATGAGGACCCCTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048997792 Original CRISPR TCCCATGAGGACCCCTGTAT GGG Intronic
No off target data available for this crispr