ID: 1049002203

View in Genome Browser
Species Human (GRCh38)
Location 8:139833279-139833301
Sequence CTAAGGAAGGGGAAGTCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049002203_1049002209 -2 Left 1049002203 8:139833279-139833301 CCAGCCGACTTCCCCTTCCTTAG 0: 1
1: 0
2: 1
3: 11
4: 201
Right 1049002209 8:139833300-139833322 AGCTTTAAGATTCTGCTAAAAGG No data
1049002203_1049002211 0 Left 1049002203 8:139833279-139833301 CCAGCCGACTTCCCCTTCCTTAG 0: 1
1: 0
2: 1
3: 11
4: 201
Right 1049002211 8:139833302-139833324 CTTTAAGATTCTGCTAAAAGGGG No data
1049002203_1049002210 -1 Left 1049002203 8:139833279-139833301 CCAGCCGACTTCCCCTTCCTTAG 0: 1
1: 0
2: 1
3: 11
4: 201
Right 1049002210 8:139833301-139833323 GCTTTAAGATTCTGCTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049002203 Original CRISPR CTAAGGAAGGGGAAGTCGGC TGG (reversed) Intronic
900931995 1:5743527-5743549 CTGACGAAGGGGCTGTCGGCTGG - Intergenic
901798005 1:11691687-11691709 GGAAGGAAGGGGGAGTGGGCGGG - Intergenic
902625183 1:17672200-17672222 TTAAGGGTGGGGAAGGCGGCTGG - Intronic
903170138 1:21547518-21547540 CTCAGGTAGGGGAACTCAGCTGG + Intronic
903226027 1:21894624-21894646 CTCAGGAAGGGCAGGTGGGCTGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905234031 1:36533276-36533298 CTATGGAAGGAGAAGTCATCTGG + Intergenic
907447683 1:54519402-54519424 CTAGGGAAGGGGAACTGGCCAGG + Intergenic
907487651 1:54788454-54788476 CTCAGGAAGGTGAAGACTGCAGG - Intronic
909772164 1:79437619-79437641 GAAAGGAAGGGAAAGACGGCCGG - Intergenic
911595410 1:99793755-99793777 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
912089794 1:106056938-106056960 CTAAGGAAAGGGTAGTGGGAAGG + Intergenic
913975082 1:143449632-143449654 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
914069474 1:144275248-144275270 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
914084541 1:144440962-144440984 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914109681 1:144691106-144691128 CTGACGCAGGGGAAGCCGGCCGG - Intergenic
914190554 1:145406228-145406250 CTGAGTAAAGAGAAGTCGGCCGG - Intergenic
914588360 1:149083102-149083124 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914912465 1:151798959-151798981 CTAAAGAAGGGGAAGTTGCTGGG + Intergenic
915355205 1:155251680-155251702 CTAAGGAAGGGGACTGGGGCTGG - Intronic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
915568705 1:156732094-156732116 CTGGGGAAGGGGAGGTCGTCAGG + Exonic
916179411 1:162070518-162070540 GTAAGGATGGGGGAGTCTGCAGG - Intronic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
917145905 1:171891166-171891188 ATAAGGAAGGTGAAGGAGGCAGG + Intronic
917844236 1:179007034-179007056 GTAAGAAAGGTGAAGTAGGCTGG + Intergenic
922183004 1:223250828-223250850 CTCAGGAAGGGGCTGTGGGCAGG + Intronic
924257530 1:242197180-242197202 GTAAGGAAGGGGAGGAAGGCAGG - Intronic
1063245747 10:4216454-4216476 CTTAGGAAGGGGAAGAAGGATGG + Intergenic
1064016186 10:11774107-11774129 CTAATGAAGGGCTTGTCGGCAGG + Intergenic
1064124626 10:12649340-12649362 GAAAGAAAGGGGAGGTCGGCTGG + Intronic
1065133287 10:22643897-22643919 CAAGGGAAGGGGAAGTGGCCAGG - Intronic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1070983409 10:80667979-80668001 CTAATGAAGAGGAATTGGGCTGG - Intergenic
1072965219 10:99966320-99966342 CAAAGGAAGAGGATGTGGGCAGG - Intronic
1074153248 10:110777265-110777287 CTAAGGAGTGGGAAGACAGCAGG + Intronic
1075671164 10:124265004-124265026 CTACGGGAGGAGAAGTGGGCAGG - Intergenic
1076677492 10:132154694-132154716 CAAAGCAAGGGAAAGTGGGCTGG + Intronic
1078245436 11:9570097-9570119 TTCAGGAAGGGGAACTGGGCTGG + Intergenic
1078259175 11:9688545-9688567 ATAAGGAAGGTGAAGTGGGCTGG + Intronic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1079635828 11:22739276-22739298 TTAAGAAAGGGGAAGTTGGCCGG + Intronic
1080572045 11:33565521-33565543 CTCAGGAAGGGGAAGCCAGGAGG + Intronic
1086467589 11:87071174-87071196 CTAAGGCAGGGGCAGTAGGTTGG + Intronic
1087267372 11:96075647-96075669 CTGAGCTAGGGGAAGTCGGGTGG + Intronic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1091089229 11:132754074-132754096 CTAAGGGAAGGGAAGCCAGCAGG + Intronic
1091368296 11:135039550-135039572 CTCAGGAAGGGGAATTTAGCAGG + Intergenic
1091694521 12:2618756-2618778 AGAAGGAAGGGGAAGTGGGATGG + Intronic
1093762934 12:22930472-22930494 TTAGGGAAGGGGAGTTCGGCTGG - Intergenic
1095450959 12:42329977-42329999 CTCAGCAAGGGGAATGCGGCAGG + Intronic
1096033977 12:48447504-48447526 CAAAGGAAGGGCAAGTCTGGAGG - Intergenic
1096530489 12:52239603-52239625 CTAAGGAAGGGGGATTGGGTGGG + Intronic
1098477942 12:70927252-70927274 CTAAGTAAGGGGAATTAGGCAGG + Intergenic
1102808499 12:115803207-115803229 GTAATGAAGGGGAAGAAGGCAGG - Intergenic
1105752175 13:23431428-23431450 TTAAGGAAAGGAAAGACGGCAGG + Intronic
1106369259 13:29115704-29115726 CTAAGGAAGGAGAGGTGGACTGG + Intronic
1107235528 13:38165006-38165028 CCAAGGAATGGGAAGTGGGGAGG + Intergenic
1108143173 13:47447842-47447864 CTTAGGCATGGGAAGTCAGCAGG + Intergenic
1110987400 13:81987791-81987813 CTTAGGAAAGGGAGGTCGGAGGG - Intergenic
1112235361 13:97631055-97631077 CTAAGAGATGGGAAGTCGTCAGG + Intergenic
1113832937 13:113311140-113311162 CTAAAGCAGTGGGAGTCGGCGGG + Intronic
1116980171 14:51160747-51160769 TTAAGAAAGAGGAAGTAGGCAGG - Intergenic
1117034705 14:51716026-51716048 CAAAGGAGAGGGAAGTCAGCTGG + Intronic
1117253167 14:53954807-53954829 CTCAGGAAAGGGAGGTCGGGTGG - Intronic
1117772722 14:59151091-59151113 ACAAGGATGGGGAAGTGGGCAGG + Intergenic
1118705051 14:68472460-68472482 CTAAGGAAGGGGAGGTCCAGGGG + Intronic
1121526268 14:94621551-94621573 CTAAGGGAGGGGGAGTTTGCAGG + Intronic
1123102902 14:105817912-105817934 CCAAGGGAGAGGAGGTCGGCTGG + Intergenic
1126297686 15:47159406-47159428 ATAAGGAAGGGGAGGTGTGCTGG - Intergenic
1127038266 15:54944033-54944055 CTAAGAAAAGGGTAGTCGGGGGG + Intergenic
1128549821 15:68590916-68590938 GTAGGGATGGGGAAGGCGGCCGG - Intronic
1129230410 15:74194084-74194106 CTCGAGAAGGGGAAGTGGGCAGG - Intronic
1131928117 15:97408496-97408518 CGCAGGAAGGGGAAGTGGTCCGG + Intergenic
1132117087 15:99145500-99145522 CTGAGGACTGGGGAGTCGGCAGG + Intronic
1134562012 16:15219039-15219061 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1134667290 16:16028094-16028116 CAAAGGAAAAGGAAGGCGGCAGG - Intronic
1134897065 16:17897778-17897800 CTAAGGAAGGGGAATCAGGTGGG - Intergenic
1134922550 16:18130665-18130687 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1138627220 16:58261896-58261918 CAAAGGAGGGGGAAATCGGTGGG + Intronic
1139616451 16:68097107-68097129 GTAAGGAAAGGGAAGGAGGCAGG + Intronic
1139895976 16:70288403-70288425 ATCAAGAAGGGGAAGGCGGCCGG - Intronic
1140600296 16:76467951-76467973 CCAAGGCAGGGGAATTCAGCTGG + Intronic
1141416479 16:83879384-83879406 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
1141426010 16:83945095-83945117 CTAAGGAAAGGCAATTCGGTGGG - Intronic
1141621107 16:85236861-85236883 CTAAGGAAGGGATGGTCGGGGGG - Intergenic
1142177955 16:88653518-88653540 CTCAGGGAGGGGGAGACGGCAGG + Intronic
1142875996 17:2852701-2852723 CTAGGGAAAAGGAAGTGGGCAGG - Intronic
1143016595 17:3893859-3893881 CTAAGGGAGGGGAAGTGGGGTGG - Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1143990356 17:10954454-10954476 CTCAGGCAGGGGAGGTGGGCAGG - Intergenic
1146054532 17:29574513-29574535 CTAAGGATGGGGAGGTGGGGGGG - Exonic
1147615100 17:41822871-41822893 CTAGGGAAGGGGAAGGCTCCTGG + Exonic
1148861314 17:50605714-50605736 GAAAGGAAGGGGGTGTCGGCAGG + Intronic
1152570321 17:81118823-81118845 CTAGGGAAGAGGAAGCTGGCAGG + Intronic
1153659164 18:7311174-7311196 AGAAGGAAGGGGAATTCAGCAGG - Intergenic
1156626015 18:38909920-38909942 CGAAGGAAGGGGAAAGAGGCAGG + Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1161125827 19:2556618-2556640 CCAAGGAAGCTGAGGTCGGCGGG + Intronic
1161273575 19:3403784-3403806 AGAAGGAAGGGGAAGCCGGGAGG + Intronic
1161306435 19:3571800-3571822 TTGAGGAAGAGGAAGTGGGCCGG + Intronic
1166234767 19:41447543-41447565 CAAAGGAAGGGGAAATAGCCGGG + Intergenic
925726371 2:6876231-6876253 CTACTGCAGGGGAAGCCGGCTGG - Intronic
927692743 2:25219683-25219705 CTAAGGCAGGGGAAGGCTGAGGG + Intergenic
928540919 2:32282726-32282748 TTAAGAAAGGGTAAGTTGGCGGG - Intronic
930066645 2:47332713-47332735 GCAAGGAAGGGGAAGTCAGGTGG + Intergenic
932623782 2:73283126-73283148 CTAAGGATGGGGGAGGCAGCCGG + Intronic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933892112 2:86781542-86781564 GGAAGGAAGAGGAAGTGGGCGGG + Intergenic
933969630 2:87459730-87459752 CTCAGGAAGGAGGAGTGGGCAGG + Intergenic
934123819 2:88866698-88866720 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
934179784 2:89610605-89610627 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
934290076 2:91684866-91684888 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
936324156 2:111490767-111490789 CTCAGGAAGGAGGAGTGGGCAGG - Intergenic
936619039 2:114075985-114076007 ATAAGGAATGTGAAGTTGGCAGG + Intergenic
939202992 2:139062665-139062687 CTGAAGAAGGGGAAGTCTTCTGG - Intergenic
940887462 2:159001964-159001986 CAAAGGAATGAGAAGTCGGATGG + Intronic
943449377 2:188028764-188028786 CTAGGGAAGGGGAAGGAAGCCGG + Intergenic
945802560 2:214451283-214451305 CTAAGGAAGGATAAGTGGGTCGG + Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
947947687 2:234120570-234120592 CAAAGGAAGGGGGAGGCTGCTGG + Intergenic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1170556403 20:17518531-17518553 CTACCGCAGGGGAAGTGGGCAGG + Intronic
1170799959 20:19582884-19582906 CTAGGAAAGGTGAAGTCGGATGG + Intronic
1172134174 20:32675994-32676016 CAGCGGAAGGGGAATTCGGCTGG - Intergenic
1173200785 20:40953644-40953666 CTAAGGATGAGGAAGTTGGTAGG + Intergenic
1175057560 20:56211981-56212003 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
1177190711 21:17848096-17848118 CTAAGGAAGGGGGAATGAGCAGG - Intergenic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1181019372 22:20090947-20090969 CTGAGGATGGGGAAGTGGCCCGG + Intronic
1182227267 22:28808644-28808666 CTAAGGAAGGGCAATGTGGCAGG - Intergenic
1184965072 22:47965639-47965661 ATAGGGAAGGGGAAGAGGGCCGG + Intergenic
954142657 3:48617342-48617364 CCAAGTGAGGGGAAGTGGGCTGG - Intergenic
955985557 3:64570572-64570594 CTTAGGTAGGGGAAGTTGGGAGG + Intronic
961320382 3:126069008-126069030 CTGAGGAAGGGGATGTCAACAGG + Intronic
962378203 3:134876137-134876159 ATAAGGCTGGGGAAGTGGGCAGG - Intronic
962413212 3:135159717-135159739 CTAATGAAGGGGATGTCTACTGG - Intronic
962493361 3:135915480-135915502 AGATGGAAGGGGAAGTCTGCTGG + Intergenic
963197366 3:142547292-142547314 CTAAGGAAAGAGTAGTCGGAGGG + Intronic
965384473 3:168029760-168029782 TTAAGGAAGGGGAAGGCTACCGG + Exonic
969258766 4:6020948-6020970 CTAAGGACAGGGAAGCAGGCAGG + Intergenic
969829494 4:9783017-9783039 CTGACGCAGGGGAAGCCGGCCGG - Exonic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
977603511 4:98959060-98959082 CTGAGGAAGGAGAACTCGGGAGG - Intergenic
980843788 4:138299804-138299826 CTAAGGAAAGGGGATTGGGCTGG - Intergenic
982258746 4:153474797-153474819 CTATGGGAGGCGAAGTCGGGCGG - Intronic
983351988 4:166602036-166602058 CAAAGGAAGGGTAAGACGGGTGG - Intergenic
985658538 5:1144198-1144220 CTCAGGGAGGGGAAGTTGGCCGG + Intergenic
986133858 5:4956197-4956219 CAAAGGAAAGGGAGGTCAGCCGG + Intergenic
987447264 5:18035106-18035128 AAAATGAAGGGGAAGCCGGCAGG - Intergenic
993160040 5:84278730-84278752 CTAAGCAAGGGCAATTCAGCAGG - Intronic
994534107 5:101006390-101006412 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
995468485 5:112475432-112475454 ATAGGGAAGGGGAAGTGGGGTGG + Intergenic
1000450832 5:161384832-161384854 CTAAGAATGGGGATGTAGGCAGG - Intronic
1001420039 5:171579286-171579308 GTCAGGAAGGGGAAGAGGGCAGG - Intergenic
1003514115 6:6804247-6804269 CTATGGGAGGGGAAGGAGGCAGG + Intergenic
1005854752 6:29852547-29852569 CTGAGGAGGGAGAAGTCGTCAGG - Intergenic
1006101209 6:31687470-31687492 CTAAGGAGTGGGAAGTGGGAAGG - Intronic
1011364649 6:86568593-86568615 CTAGGGAAAGGGCAGTCAGCAGG - Intergenic
1011365432 6:86576576-86576598 GTAGGGAAGGGGAAGGGGGCAGG - Intergenic
1012248143 6:96949814-96949836 CTAAGGAAGGGAAATTCAGTAGG + Intronic
1013211989 6:107995345-107995367 CTAAGGAAGGGGAAGAGAGGAGG + Intergenic
1015102376 6:129496460-129496482 CAAAAGAAGGGGAAATAGGCCGG - Intronic
1015394730 6:132721004-132721026 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
1015721668 6:136249292-136249314 GAAAGGAAGGGGAAGTCTGGGGG + Intronic
1016283962 6:142451795-142451817 CTGAGGAAGGGGTAGTGGGGAGG - Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1025983781 7:66429540-66429562 TCAAGGCAGGGGATGTCGGCTGG - Intergenic
1026031416 7:66797831-66797853 TCAAGGCAGGGGATGTCGGCTGG + Intronic
1027206957 7:76108092-76108114 TCAAGGCAGGGGATGTCGGCTGG - Intergenic
1029123715 7:98283951-98283973 CTAGGGAAGGGGAAGTGGCAGGG - Intronic
1029157584 7:98528302-98528324 CTAAGGAATGCCAAGGCGGCCGG - Intergenic
1029171013 7:98628967-98628989 CCAAGGAACTGGAAGGCGGCAGG - Exonic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1032799997 7:135310263-135310285 CTAAGGAAGGAGAACTGGCCTGG + Intergenic
1032836531 7:135680457-135680479 CAAAGGAAAGGGAAGTCGGCCGG - Intronic
1034083557 7:148302700-148302722 ATGGGGAAGGGGAAGTAGGCAGG - Intronic
1037560835 8:20073140-20073162 CTAAGGAAGGGGAGAGAGGCTGG - Intergenic
1037587442 8:20287926-20287948 CTAGGGAAGGGGAAGAAGCCAGG - Intronic
1039075646 8:33688561-33688583 CCAGGGAAAGGGAAGTGGGCGGG + Intergenic
1040906226 8:52472306-52472328 CTGAGGAAGGGGAGCTCTGCAGG - Intergenic
1042209620 8:66366742-66366764 GTAAGGAAGGGGAGGGTGGCAGG - Intergenic
1045447583 8:102283325-102283347 CTTAGGAAGGGGAAGGCGGGGGG + Intronic
1045496114 8:102710294-102710316 CTAAGAAAAAGGAAGTAGGCCGG + Intergenic
1045822470 8:106356334-106356356 CTAAGGAAAAGGAAGTCAGGAGG + Intronic
1047576095 8:126156977-126156999 GTAAGGAAGTGGAAGATGGCAGG - Intergenic
1048288905 8:133164674-133164696 GTGAGGAAGGGGAATTAGGCAGG - Intergenic
1048902140 8:139049084-139049106 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
1048902343 8:139050902-139050924 CTCAGCAAGGGGAATGCGGCAGG - Intergenic
1049002203 8:139833279-139833301 CTAAGGAAGGGGAAGTCGGCTGG - Intronic
1052792222 9:32886341-32886363 CTAAGGAAGAGGAACTCTGGAGG - Intergenic
1053051478 9:34964539-34964561 ATAAGGAAGGGGAAGGAAGCTGG - Intronic
1055470294 9:76604006-76604028 GTGAGGAAGGTGAATTCGGCAGG + Intergenic
1056832354 9:89927510-89927532 TTTGGGAAGGGGAAGTTGGCAGG - Intergenic
1057258981 9:93573736-93573758 AAAAGAAAGGGGAAGTCAGCTGG + Intergenic
1060309679 9:122448127-122448149 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1061098741 9:128475938-128475960 CTAAAGAAGTTGAACTCGGCCGG - Intronic
1061912205 9:133731247-133731269 CTAAGGCAGGAGGAGTGGGCTGG + Intronic
1186104072 X:6187230-6187252 CTAAAGAAGGTGGAGTTGGCCGG - Intronic
1186877089 X:13827438-13827460 CTAAGAAGGGGGAAATGGGCTGG - Intronic
1187403176 X:18980631-18980653 CTCAGCAAGGGGAATGCGGCAGG - Intronic
1192557013 X:72098282-72098304 ATAAGAAAGAGGAAGTTGGCCGG + Intergenic
1193170638 X:78331884-78331906 GTATGGATGGGGAAGTGGGCTGG + Intergenic
1196520653 X:116667517-116667539 CTACGGAAGGGGAAGGCGCCTGG + Intergenic
1200232316 X:154450159-154450181 CAAGGGAAGGGGAGGTCAGCAGG + Intronic
1200688786 Y:6283819-6283841 GTAATGAAGGGGTAGGCGGCAGG + Intergenic
1200986664 Y:9308036-9308058 CCAAGGATGGGGACGTTGGCGGG - Intergenic
1201046486 Y:9890902-9890924 GTAATGAAGGGGTAGGCGGCAGG - Intergenic
1201458929 Y:14201326-14201348 ATAAGGAAGGGGAAGTGGGGAGG + Intergenic