ID: 1049004079

View in Genome Browser
Species Human (GRCh38)
Location 8:139843871-139843893
Sequence CTGGTGAATCAGCGTGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049004079_1049004085 28 Left 1049004079 8:139843871-139843893 CCATGTGCACGCTGATTCACCAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1049004085 8:139843922-139843944 TGAGCTGCGGACTCCAGCGCTGG No data
1049004079_1049004086 29 Left 1049004079 8:139843871-139843893 CCATGTGCACGCTGATTCACCAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1049004086 8:139843923-139843945 GAGCTGCGGACTCCAGCGCTGGG No data
1049004079_1049004084 15 Left 1049004079 8:139843871-139843893 CCATGTGCACGCTGATTCACCAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1049004084 8:139843909-139843931 CTGCTGCAGCTGATGAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049004079 Original CRISPR CTGGTGAATCAGCGTGCACA TGG (reversed) Intronic
901971924 1:12914953-12914975 CTGTTGATTGAGCATGCACAAGG - Intronic
902013244 1:13286787-13286809 CTGTTGATTGAGCATGCACAAGG + Intergenic
916880319 1:169014330-169014352 CTGGTCAATCATCTTGAACATGG - Intergenic
917687307 1:177430410-177430432 ATGGTGAATCAGATTGCAGAGGG - Intergenic
1062929720 10:1344873-1344895 ATGGAGAAACAGCGGGCACACGG - Intronic
1063172548 10:3522557-3522579 CCGGTGAATCTCCGTGCAGACGG - Intergenic
1063361531 10:5463221-5463243 CTGGGGAGTCAGCGTGCAAAGGG - Intergenic
1065168675 10:23006467-23006489 CTTGTGAAACTGCCTGCACAGGG + Intronic
1065886210 10:30079597-30079619 CTGGTGAATCAGCTGACCCAAGG - Intronic
1067170845 10:43904607-43904629 CTGGGGAAACAGCTTGCAGAGGG - Intergenic
1071049951 10:81435179-81435201 ATGGTGAATCAGAGGCCACAAGG + Intergenic
1071960098 10:90801788-90801810 CTGTTCAATCAGATTGCACAAGG - Intronic
1077161037 11:1113011-1113033 CTGGTGATGCAGCGTGGACACGG + Intergenic
1083259159 11:61513895-61513917 CTGGGGCATCGGCGTGCTCAAGG + Intergenic
1084857246 11:71997097-71997119 CTGAAGAATGAGCTTGCACAAGG - Exonic
1095370977 12:41466928-41466950 CAGGCGAAGCAGCGTGCACTGGG - Intronic
1095765109 12:45886300-45886322 CTCGTGCATCAGCGTGACCAGGG - Intronic
1103915815 12:124375111-124375133 CAGGTTAATCAGCTTGCCCAAGG + Intronic
1112465624 13:99642211-99642233 CTGAAGAGTCAGCATGCACAGGG - Intronic
1113802839 13:113095450-113095472 CTGGTGGAACAGGGTGCACGGGG + Intronic
1129080381 15:73034050-73034072 GTGGTGAACCTGCCTGCACAGGG + Intergenic
1129750802 15:78061999-78062021 CTAGTGCATCATGGTGCACATGG - Intronic
1144298630 17:13902611-13902633 CTGGTGAAACTGCCCGCACAAGG + Intergenic
1146498573 17:33344643-33344665 GTGTTGAATCAGTGTTCACAGGG + Intronic
1148189460 17:45668437-45668459 CTGGTGGCTCAGGGTGCACCAGG + Intergenic
1159034808 18:63266744-63266766 GTGGTGAAGCAGCTTGCCCAAGG - Intronic
1160226111 18:77012302-77012324 CTCCTGAATGAACGTGCACATGG - Intronic
1161157926 19:2743501-2743523 TTGGAGAATCAGCCTGCTCAGGG + Intergenic
1161249151 19:3271103-3271125 GTGGTGAATCAGCGTTGCCATGG + Intronic
1164484533 19:28643471-28643493 CTGGTGAGCCAGCCTGCAGAGGG - Intergenic
926158152 2:10469464-10469486 CTGGTGCTCCAGAGTGCACAAGG - Intergenic
926697738 2:15782485-15782507 CTGGAGAATCAGGGTGGTCAGGG - Intergenic
926942643 2:18154489-18154511 CTGGCTCATCAGCTTGCACATGG - Intronic
931411622 2:62037996-62038018 CTGGTGAATCAGTCTGGGCATGG + Intronic
932124154 2:69128129-69128151 CAGGAGAATCAGCCTGAACATGG + Intronic
932593508 2:73080630-73080652 CTGGTGATTCAGGCTGCACCTGG + Intronic
932890922 2:75597012-75597034 CTGGTAAATCACCCTGCATAAGG - Intergenic
933765957 2:85709987-85710009 CTGATGAATGAGAATGCACATGG + Intergenic
934947966 2:98555661-98555683 CTGGTGCAGCTGCCTGCACAGGG - Exonic
938195412 2:129323236-129323258 CTGGTTATTCAGCTTGCAGATGG - Intergenic
939322628 2:140644079-140644101 CTGGGGAATCAGCACGCAGAGGG - Intronic
943872176 2:193013620-193013642 CTGGTGGATCAGTGGGCTCAAGG - Intergenic
1168966386 20:1900943-1900965 ATGGTGAAGCAGCTTGCCCAAGG + Intronic
1169529226 20:6466136-6466158 CCAGTGAATCAACGTGCACTTGG + Intergenic
1178775918 21:35550637-35550659 CAGGTGTCTCAGCCTGCACATGG - Intronic
1181317403 22:21979468-21979490 CTGGGGACTCAGAGTCCACATGG - Intronic
1183481338 22:38067181-38067203 CTGGGGAATCAGTGGGGACAGGG - Intronic
954514559 3:51161102-51161124 CTGGTGATTCTGTGTCCACAAGG - Intronic
955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG + Intronic
956056396 3:65303166-65303188 CTGGTGAAGCAGAATGGACAGGG + Intergenic
963017860 3:140842649-140842671 CTGGTGCTTCAGCTTGCAGATGG + Intergenic
963815206 3:149822507-149822529 CACGTGATTCAGCTTGCACATGG - Intronic
964266622 3:154904381-154904403 CTGAAGAATCAGTGTGCACAAGG + Intergenic
967843753 3:194028558-194028580 CTGGTGAATGAGCCAGCCCAGGG + Intergenic
970248678 4:14091602-14091624 CTGGTGAATAAGAGTTCACATGG - Intergenic
985687000 5:1287057-1287079 GTGGAGAATCAGAGTGCACCAGG + Intronic
986565659 5:9111194-9111216 CTGGTGAATCAGCTTAGAAATGG - Intronic
987514487 5:18888369-18888391 CTTGTGCATCAGCGTGCTCTGGG - Intergenic
991471425 5:66973005-66973027 CTGGTGAATCAAGATGAACATGG - Intronic
994478087 5:100296538-100296560 CTAGTGAATCACAGTGCTCAAGG - Intergenic
998808041 5:145937881-145937903 CTGGAGGAGCAGCGTCCACATGG - Exonic
999155609 5:149455568-149455590 CTGGTGAATCAGCCTATAGATGG + Intergenic
1001934610 5:175695264-175695286 AAGGTTAATCAGCGTGCCCAAGG - Intergenic
1002854275 6:1023461-1023483 CTGTAGAGTCAGCGTCCACAGGG + Intergenic
1014006345 6:116423521-116423543 TTGGTGAATCTGTGTACACATGG + Intronic
1015865699 6:137724290-137724312 CAGGTGACTCACCATGCACATGG - Intergenic
1023345364 7:39266096-39266118 CTGGTGAATCAGTGTGTTCATGG - Intronic
1024530906 7:50392132-50392154 CGGCTGCACCAGCGTGCACAGGG + Intronic
1025015829 7:55438558-55438580 CAGGTGAATAAGTGTGGACAGGG + Intronic
1028631130 7:92935123-92935145 CTGGTGAAACAATGTACACAAGG - Intergenic
1032660720 7:133980941-133980963 CTCATCAATCAGCCTGCACAGGG + Intronic
1034572215 7:151965152-151965174 CTGGTGAGTCAGTGGACACATGG - Intronic
1037103722 8:15079760-15079782 CTATTTAATCAGCCTGCACATGG - Intronic
1039833827 8:41239104-41239126 CTGGTGAATCAGCGAGTAAGTGG - Intergenic
1043521257 8:81048052-81048074 CTGGTGAATCAGGTTACAGAGGG - Intronic
1043831482 8:84994459-84994481 CTGGTGAACCAGCTTGGAAACGG - Intergenic
1044952993 8:97451695-97451717 CTGGTGAAGCAGTGTGTCCAGGG - Intergenic
1049004079 8:139843871-139843893 CTGGTGAATCAGCGTGCACATGG - Intronic
1055469951 9:76601344-76601366 CTGGAGGCTCAGCGTGGACAAGG - Intergenic
1059298474 9:113293945-113293967 CTGGTGAATTAGCATGCAATTGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061704720 9:132444171-132444193 GTGGGAAATCAGCTTGCACATGG + Intronic
1198892658 X:141415811-141415833 CTGGTGAATTAGCTTGCCTACGG - Intergenic
1199964525 X:152808578-152808600 ATGGTGTATAAGGGTGCACAAGG + Intergenic