ID: 1049004822

View in Genome Browser
Species Human (GRCh38)
Location 8:139847906-139847928
Sequence GGGAGCGGAGGCTTTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 401}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049004822_1049004835 18 Left 1049004822 8:139847906-139847928 CCACCACCAAAGCCTCCGCTCCC 0: 1
1: 1
2: 1
3: 40
4: 401
Right 1049004835 8:139847947-139847969 CCTGTGTCAGCAGCAGCCCTGGG No data
1049004822_1049004838 27 Left 1049004822 8:139847906-139847928 CCACCACCAAAGCCTCCGCTCCC 0: 1
1: 1
2: 1
3: 40
4: 401
Right 1049004838 8:139847956-139847978 GCAGCAGCCCTGGGGCACGTGGG No data
1049004822_1049004837 26 Left 1049004822 8:139847906-139847928 CCACCACCAAAGCCTCCGCTCCC 0: 1
1: 1
2: 1
3: 40
4: 401
Right 1049004837 8:139847955-139847977 AGCAGCAGCCCTGGGGCACGTGG No data
1049004822_1049004833 17 Left 1049004822 8:139847906-139847928 CCACCACCAAAGCCTCCGCTCCC 0: 1
1: 1
2: 1
3: 40
4: 401
Right 1049004833 8:139847946-139847968 CCCTGTGTCAGCAGCAGCCCTGG No data
1049004822_1049004839 28 Left 1049004822 8:139847906-139847928 CCACCACCAAAGCCTCCGCTCCC 0: 1
1: 1
2: 1
3: 40
4: 401
Right 1049004839 8:139847957-139847979 CAGCAGCCCTGGGGCACGTGGGG No data
1049004822_1049004836 19 Left 1049004822 8:139847906-139847928 CCACCACCAAAGCCTCCGCTCCC 0: 1
1: 1
2: 1
3: 40
4: 401
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049004822 Original CRISPR GGGAGCGGAGGCTTTGGTGG TGG (reversed) Intronic
900138921 1:1130937-1130959 GGAAGCGAAGGCCTTGGTGGGGG - Intergenic
900227446 1:1539914-1539936 GGGAGCGTAGGCCTTGGTAGGGG + Intronic
900227468 1:1539972-1539994 GGGAGCGCAGGCCGGGGTGGGGG + Intronic
900227524 1:1540110-1540132 GGGAGCGGAGGCCGGGGTGGGGG + Intronic
900393574 1:2444085-2444107 GGGAGCGGAGGCTCGGATCGCGG + Intronic
900975133 1:6011990-6012012 GGGGGCAGAGGCCATGGTGGTGG + Intronic
901784771 1:11617298-11617320 GGGACCGGAGGCTGTGGGGCAGG - Intergenic
901798370 1:11693053-11693075 GGGGGAAGAGGCTGTGGTGGTGG - Intronic
902615358 1:17620669-17620691 GGGAGCCGGGGTTCTGGTGGTGG + Intronic
903142480 1:21347276-21347298 GGGTGAGGAGGCTGTAGTGGTGG + Intergenic
903168992 1:21540593-21540615 GGGAGCAGAGCCCTTTGTGGTGG + Intronic
903446155 1:23424172-23424194 GGGAGCGGCGGCGATGGCGGGGG - Intronic
903543026 1:24107563-24107585 GGGCTAGGAGGCTTGGGTGGTGG - Intronic
904773908 1:32895323-32895345 TGGAGCTGAGGCCCTGGTGGGGG - Exonic
905231073 1:36515290-36515312 GGGAGAGCAGGCTCTGGGGGAGG + Intergenic
905295301 1:36950898-36950920 GGGAGCGGAGGGTCTGGAGTGGG + Intronic
905553138 1:38859733-38859755 GGGGGCGGTGGCGGTGGTGGCGG - Exonic
906208106 1:43997644-43997666 AGGAGAGGGGGCTATGGTGGGGG + Exonic
907367594 1:53975353-53975375 GGAGGAGGAGGCTATGGTGGTGG - Intergenic
907900933 1:58740955-58740977 GCAAGGAGAGGCTTTGGTGGTGG + Intergenic
908466487 1:64401466-64401488 GGCAGTGGAGGCTCTGGGGGTGG - Intergenic
909924862 1:81427214-81427236 GGAAGAGGAGGCTATGCTGGTGG + Intronic
910970770 1:92853506-92853528 GCCAGCGGAGGCTTTGGGGAAGG + Intronic
913059928 1:115195298-115195320 GGGAGCAGTGGCTTGGGCGGAGG + Intergenic
914900890 1:151710498-151710520 GGGGGTGGAGGATTTGGTGGGGG + Intronic
915248575 1:154572653-154572675 GGGAGGGGTGGCGTTGGTGGCGG + Intronic
915466494 1:156101555-156101577 GGGAGCAGAGGCAAGGGTGGAGG + Intronic
915466534 1:156101707-156101729 GGGAGCAGAGGCAAGGGTGGAGG + Intronic
915960489 1:160262464-160262486 GAGAGCGGAGGCGGTGGTGGTGG - Intronic
917214026 1:172659379-172659401 GGTAGTGGAGGCAGTGGTGGCGG - Exonic
917513487 1:175687851-175687873 GGGAGGGGAGGGTGTGGTGGGGG - Intronic
917693210 1:177490337-177490359 GTGAGGGGTGGCTGTGGTGGTGG - Intergenic
918078835 1:181190398-181190420 GGGAGTGGAGGGTTGGGGGGCGG + Intergenic
918101813 1:181382897-181382919 AGGGGCGGAGGCTTAGGTGGTGG + Intergenic
919761272 1:201099632-201099654 GGGAGCTCAGGCTGGGGTGGAGG + Intronic
920560050 1:206932483-206932505 GGGAGCCGTGGCTGTGGGGGTGG - Exonic
920921611 1:210302234-210302256 GGAATCAGGGGCTTTGGTGGTGG + Intergenic
921174003 1:212577577-212577599 GAGAGCTGAGGCCGTGGTGGGGG - Intronic
922424076 1:225477884-225477906 GGAAGGGGAGGCTTTTGAGGAGG + Intergenic
922558108 1:226548623-226548645 GTGAGCGGTGGTTTTGGTTGGGG + Intergenic
923051211 1:230392656-230392678 TGGAGCACAGGTTTTGGTGGTGG - Intronic
923513058 1:234670181-234670203 GGGAGCTGAGGCTCTTGTGAGGG - Intergenic
1062843112 10:686413-686435 GGGTGCGGAGGCTGTGCAGGTGG - Intronic
1062899579 10:1132743-1132765 TGGGGCGGAGGCTTTGGTTGAGG + Intergenic
1063375461 10:5551814-5551836 ACGAGGGGAGGCTGTGGTGGGGG - Intergenic
1066012890 10:31210599-31210621 GGGTGCCGATGCTTTGGTGCTGG + Intergenic
1067156877 10:43789633-43789655 GGAAGAGGAGGCTATGGTGGTGG - Intergenic
1067441523 10:46311537-46311559 GGAGGCGGAGGCGGTGGTGGTGG - Exonic
1067805400 10:49388828-49388850 GGGGACGTGGGCTTTGGTGGTGG - Intronic
1069840133 10:71334713-71334735 GGGTGTGCAGGCTGTGGTGGAGG - Intronic
1069960990 10:72079358-72079380 AGGAGAGGAGGGTCTGGTGGTGG + Intronic
1070143666 10:73757805-73757827 GGGAGGGGAGGCTTAGGGGGAGG + Intronic
1070644974 10:78195484-78195506 GGGAGAGGAGGCATTGCTGTGGG - Intergenic
1071567534 10:86679542-86679564 GGGGGCGGAGGTTTGGGTGTGGG + Intronic
1072008769 10:91285515-91285537 GGGAGGAGAGGCTTTTGTAGTGG - Intergenic
1072914083 10:99526588-99526610 GGGAGTGGGGGCTTGGGAGGTGG + Intergenic
1073445386 10:103577253-103577275 TGGAGGGGAGGGTTTGGTGTGGG - Intronic
1075101160 10:119507254-119507276 GGTGGCAGAGGCTGTGGTGGTGG - Intronic
1076001874 10:126918908-126918930 GGGCACGGAGGATTTGGAGGAGG + Intronic
1076350422 10:129811481-129811503 GTGAGAGGAGGCTCCGGTGGGGG - Intergenic
1076381511 10:130027295-130027317 GGGTGTGGAGGTTTTGGGGGAGG - Intergenic
1076520201 10:131076501-131076523 TGGAGAGCAGGCTTGGGTGGAGG + Intergenic
1076771673 10:132669466-132669488 GGGAGCTGGGGGTGTGGTGGAGG + Intronic
1076811776 10:132890152-132890174 GGCAGAGGAGGCTGTGGAGGGGG - Intronic
1076992395 11:282306-282328 AGGAGCCGAGGGTCTGGTGGAGG - Intronic
1077065076 11:637403-637425 GGGCGCGGCGGCGCTGGTGGGGG + Exonic
1077175181 11:1186259-1186281 GGGAGCAGAGGTTGTGCTGGTGG - Intronic
1077175312 11:1187099-1187121 GGGAGCAGAGGTTGTGCTGGTGG - Intronic
1077207885 11:1352910-1352932 GGGAGGGGAGTCATTGGGGGTGG - Intergenic
1077653505 11:3996251-3996273 AGGAGCTGAGGACTTGGTGGAGG + Intronic
1080230289 11:30012500-30012522 GGTAGCGGGGGTTCTGGTGGGGG - Exonic
1080239361 11:30108696-30108718 GGGAAAGAAGGTTTTGGTGGTGG - Intergenic
1080386161 11:31812240-31812262 GGGAGTGGAAGCCTGGGTGGGGG + Intronic
1080802010 11:35618332-35618354 GGGAGCGGAGGCGGAGGAGGGGG + Intergenic
1080922083 11:36719538-36719560 GGGAGGTGAGGTTTCGGTGGGGG + Intergenic
1081164127 11:39786737-39786759 TGGAGCTGAGGCTTTGCTTGAGG - Intergenic
1083658482 11:64241501-64241523 CGGAGCGGAGGCGCTGGGGGCGG + Intronic
1083700459 11:64474071-64474093 GAGAGCAGAGACTCTGGTGGGGG + Intergenic
1083929741 11:65834120-65834142 GTGAGGGGAGGCTGGGGTGGGGG - Intronic
1084191996 11:67503663-67503685 GGGCGAGGAGGCTCTGGTGTAGG - Intronic
1084709754 11:70836572-70836594 GTGAGCAGAGGCTGTGATGGAGG - Intronic
1085311653 11:75520477-75520499 GGGAGGGGAGGATTCGGTGGGGG + Intronic
1085452441 11:76642933-76642955 GGGAGGGCAGGGTTTGGAGGTGG + Intergenic
1088799606 11:113293503-113293525 GGGAGGGGAGGAGTTGGAGGAGG - Intergenic
1090012433 11:123057180-123057202 AGGAGCAGAGGCTTTCCTGGAGG - Intergenic
1090021955 11:123136442-123136464 GGGAGAGGAGGGTGGGGTGGGGG - Intronic
1090049269 11:123362949-123362971 GGGAGGGGAGGGTAGGGTGGCGG + Intergenic
1090381678 11:126331865-126331887 GCGAGAGAAGGCTTTGGGGGTGG + Intronic
1090660827 11:128880546-128880568 TTGAGCAGAGGCTTTGGTCGGGG - Intergenic
1091773952 12:3172222-3172244 GAGAGCTGAGGCTGGGGTGGGGG - Intronic
1091809227 12:3380935-3380957 GGGGGTGGAGGGTGTGGTGGGGG + Intergenic
1091889400 12:4041224-4041246 TGGAGCCGAGGCTTTTGTGAAGG + Intergenic
1091916368 12:4273849-4273871 GGGAGGCGAGGATTGGGTGGTGG - Exonic
1092605373 12:10112376-10112398 GGCAGCGGAGGTGGTGGTGGAGG + Intergenic
1095705117 12:45228687-45228709 GGGAGGGCAGTATTTGGTGGAGG + Intronic
1095870748 12:47025326-47025348 GGGGGCTGAGGGTTTGGGGGAGG - Intergenic
1096103837 12:48985473-48985495 GAGGGGGGAGGCTTTGGGGGAGG - Intergenic
1096156851 12:49345819-49345841 AGGATCGGAGGCTGGGGTGGTGG - Intergenic
1096180189 12:49546430-49546452 GGGAGGTGAGGCTGAGGTGGGGG + Intronic
1096230363 12:49893403-49893425 GGGGGCTCAGGCTTTGGTTGAGG - Intronic
1096448079 12:51712852-51712874 GGAAGAGGAGGCTATGGTGGTGG - Intronic
1096589995 12:52651781-52651803 GGTGGAGGCGGCTTTGGTGGAGG - Exonic
1096590037 12:52651976-52651998 GGTGGCGGGGGCTTCGGTGGAGG - Exonic
1096593682 12:52680014-52680036 GGTGGTGGTGGCTTTGGTGGAGG - Exonic
1096593686 12:52680029-52680051 GGTGGTGGTGGCTTTGGTGGTGG - Exonic
1096593690 12:52680044-52680066 GGTGGTGGTGGCTTTGGTGGTGG - Exonic
1096597148 12:52703136-52703158 GGGGGCAGAGGCTTTGGGGTTGG - Exonic
1096612744 12:52813796-52813818 GGCACTGGTGGCTTTGGTGGTGG - Exonic
1097173148 12:57128569-57128591 GGTAGGGGAGCCTTTGGAGGGGG - Exonic
1097174862 12:57136631-57136653 GGGAGCTCAGCCTTGGGTGGGGG + Intronic
1097235836 12:57538880-57538902 GGGAGAGAAGGCTGAGGTGGTGG + Intronic
1097248020 12:57617267-57617289 GGAAGGGGAGGCTGTAGTGGGGG + Intronic
1100340941 12:93678822-93678844 GGGTGCAGAGGTATTGGTGGAGG + Exonic
1102572133 12:113833312-113833334 TGGAGCAGAGGCTGTGGAGGTGG - Intronic
1102969570 12:117155557-117155579 GGGAGCGGAGGCCCTGGGGGAGG + Intronic
1103595684 12:122023030-122023052 GGGAGAGGGGGACTTGGTGGCGG + Intronic
1103724293 12:122990105-122990127 AGGAGCTGAGGCTGGGGTGGGGG - Intronic
1103775656 12:123364770-123364792 TGGAGCGGAGGCGGCGGTGGCGG + Intronic
1103931627 12:124453768-124453790 GGGAGCGGGCGCAGTGGTGGAGG - Intronic
1104968651 12:132521238-132521260 GGGAGCGCAGGCTGTGGGGCTGG + Intronic
1105949176 13:25214032-25214054 GGGAGGGGAGGAATTGATGGTGG + Intergenic
1106247743 13:27963248-27963270 GGCTGGGGAGGCTGTGGTGGCGG + Exonic
1107476901 13:40745753-40745775 GGGGGTGGAGGATTTGTTGGGGG - Intronic
1107655521 13:42589031-42589053 GGTAGCGGCGGCGGTGGTGGTGG + Intronic
1108449093 13:50542439-50542461 GGGAAAGAAGGCTTTGGTGGTGG - Intronic
1109134922 13:58635712-58635734 GTGAACAGATGCTTTGGTGGTGG - Intergenic
1109683962 13:65788317-65788339 GGAAGAGGAGGCTATGGTGGTGG - Intergenic
1114318047 14:21525219-21525241 GGGGGCGGAGGGGGTGGTGGAGG + Exonic
1114654042 14:24305307-24305329 GGGACAGGAGGCATTGGTAGGGG + Exonic
1117790089 14:59331335-59331357 GGGAGGGGAGGCGGTGGAGGGGG - Exonic
1118770504 14:68939625-68939647 GGGAACGGAGGAGTTGGGGGAGG + Intronic
1120004546 14:79342104-79342126 GGGAGTGGAGGTATTGGTGAGGG + Intronic
1121528979 14:94639466-94639488 GGGAACAGAGGCTTTCCTGGAGG + Intergenic
1121772179 14:96556225-96556247 GAGACCGTAGGCTTTGGTGGTGG - Exonic
1122292024 14:100685839-100685861 TGGAGAGGAGGCTGAGGTGGAGG - Intergenic
1122292082 14:100685993-100686015 TGGAGAGGAGGCTGAGGTGGAGG - Intergenic
1122292343 14:100686684-100686706 TGGAGAGGGGGCTGTGGTGGAGG - Intergenic
1122292367 14:100686748-100686770 TGGAGAGGAGGCTGAGGTGGAGG - Intergenic
1122800709 14:104228223-104228245 TGGAGCGTAGACTTTGGTGGTGG + Intergenic
1123114515 14:105888593-105888615 GGGACAGGAGGATTTTGTGGGGG - Intergenic
1123116676 14:105898002-105898024 GGGACAGGAGGATTTTGTGGGGG - Intergenic
1123118728 14:105907256-105907278 GGGACAGGAGGATTTTGTGGGGG - Intergenic
1123120956 14:105916871-105916893 GGGACAGGAGGATTTTGTGGGGG - Intergenic
1123403667 15:20008447-20008469 GGGACAGGAGGATTTTGTGGGGG - Intergenic
1123513004 15:21015093-21015115 GGGACAGGAGGATTTTGTGGGGG - Intergenic
1123988891 15:25668623-25668645 GGGAGGGCAGGCTGGGGTGGGGG - Intergenic
1124787012 15:32690933-32690955 GGGAGAAGGGGATTTGGTGGCGG - Intronic
1125059478 15:35401530-35401552 GGCAGAGGTGGCTTTGGTGGTGG + Intronic
1126209660 15:46086232-46086254 GGTAGCGGAGGGTGGGGTGGGGG + Intergenic
1126865579 15:52933443-52933465 GGTAGAGGAGGTCTTGGTGGGGG + Intergenic
1127546924 15:60000815-60000837 TGGAGCTGGGGCTTTGGGGGCGG - Intergenic
1127994023 15:64141998-64142020 GGGAGGGGAAGCAGTGGTGGGGG + Intronic
1128388166 15:67165184-67165206 GGGTGCGGGGACTTTGGTGCTGG + Intronic
1128866136 15:71116096-71116118 GGGAGGCGAGGCTGAGGTGGGGG - Intronic
1128893347 15:71350729-71350751 GTGAGCTGAGGCCTTGGGGGAGG + Intronic
1129582980 15:76831665-76831687 GGGAGAGTATGCTGTGGTGGTGG - Intronic
1129953106 15:79609259-79609281 AGGAGCTGAGGCATTGATGGAGG + Intergenic
1130844649 15:87733599-87733621 GGGAGTGGAGTCTGTGTTGGGGG - Intergenic
1130876054 15:88015521-88015543 GGGAGCAGAGGCTTGGGTAAAGG - Intronic
1131609818 15:93948757-93948779 GGGCTCGGAGGCTTTGGAGTGGG - Intergenic
1132912832 16:2324348-2324370 GGAAGCGGAGGCCTTGCTGATGG + Intronic
1133028028 16:2997113-2997135 GGGAGCTCAGGGTTTGGGGGAGG - Intergenic
1135526269 16:23215733-23215755 GGGAGCCGAGGCAGTGGTGCTGG + Exonic
1136375849 16:29864557-29864579 GGGGGAGGGGGGTTTGGTGGGGG - Intergenic
1136515399 16:30765145-30765167 GGGAGCAGATGCTTGGATGGGGG - Intronic
1136533923 16:30888056-30888078 GGGAGTGGAGGCTTTGGAGAAGG - Intronic
1138212000 16:55171269-55171291 GGGAGCAGAGACTGTGGAGGAGG + Intergenic
1138229397 16:55326271-55326293 GGGAGCGGGGGCGGGGGTGGGGG + Intronic
1138506531 16:57480968-57480990 GGCAGGGAAGGCTTAGGTGGTGG - Intronic
1139385552 16:66566766-66566788 GGGAGTGTGGGCTTTGGGGGTGG - Exonic
1139930721 16:70523991-70524013 GGGACCCGAGACTTTGGCGGGGG + Intronic
1140034794 16:71364022-71364044 GGGAGCAGAGGCAGGGGTGGGGG - Intronic
1140263753 16:73402855-73402877 GGGAGGGGAGGGCTTGGGGGTGG + Intergenic
1141193652 16:81842974-81842996 GGGAGTGGAGGGATGGGTGGTGG + Intronic
1141641279 16:85342998-85343020 GGGAGCAGAGGCTGTGGAGAAGG + Intergenic
1142146895 16:88496501-88496523 GGAAGCTGGGCCTTTGGTGGAGG + Intronic
1142240223 16:88941500-88941522 GGTGGCGGAGGCGTTGGGGGCGG - Intronic
1142248974 16:88982565-88982587 GGGGGAGGAGGCTGTGGGGGAGG - Intergenic
1143499226 17:7329272-7329294 GGGAGTGGGGGCTCTGGGGGAGG - Exonic
1143571320 17:7760398-7760420 GGGAGCAGGGGCTTGGATGGGGG + Intronic
1143962230 17:10730129-10730151 GGGAGCGCAGGTCTCGGTGGTGG + Exonic
1144264452 17:13554807-13554829 GGGGGTGGAGGGTATGGTGGAGG - Intronic
1144735905 17:17555381-17555403 GGGAGCCGAGGCTCGGGAGGTGG - Intronic
1144874499 17:18390355-18390377 GGGAGGGGTGGGTTTGGGGGTGG + Intergenic
1145246278 17:21271958-21271980 GGGAGGGGAGGCGTGGGAGGTGG + Intergenic
1146229459 17:31095220-31095242 GGGAGCGGAGGCTGAGGTGAGGG - Exonic
1146695901 17:34909058-34909080 TGGAGCAGAGGCGATGGTGGAGG - Intergenic
1146936402 17:36815001-36815023 CGAAGCGGAAGCTTGGGTGGGGG + Intergenic
1147129248 17:38396753-38396775 GGGAGCCATGACTTTGGTGGTGG + Intronic
1147132942 17:38419533-38419555 CGGAGCGGGGGCTCTGGGGGAGG + Intergenic
1147486685 17:40822212-40822234 GGTGGAGGCGGCTTTGGTGGAGG - Exonic
1147560403 17:41505384-41505406 GTGAGCTGTGGTTTTGGTGGAGG - Exonic
1147562673 17:41518730-41518752 GGGGGAGGTGGCTTTGGTGGGGG - Exonic
1147917336 17:43896633-43896655 AGGAGCGGGGGCTTTGGTCCAGG - Intronic
1147954311 17:44123738-44123760 GGCAGGGGAGGGGTTGGTGGTGG - Intergenic
1148238253 17:45983484-45983506 GGGAGGGGAGTCTTGGGGGGAGG - Exonic
1148858729 17:50593110-50593132 GGTGGGGGAGGCTTTGGTGATGG + Intronic
1149001311 17:51760452-51760474 GGGAGCGGTGGAGATGGTGGCGG + Intronic
1149336767 17:55643726-55643748 GGAACCGAAGGCTTGGGTGGAGG + Intergenic
1151018036 17:70579655-70579677 AGGAGTGGATGCTTTGATGGGGG - Intergenic
1151413624 17:73947486-73947508 GGGAGAGGAGGCGGTGGGGGTGG + Intergenic
1151474072 17:74335603-74335625 GGGAGAGGAGGCCGTGGAGGTGG + Intronic
1151823283 17:76508868-76508890 GGAAGAGGAGGCTTTGGCAGGGG + Intergenic
1151825105 17:76519633-76519655 GGGAGAGGAGGCTTTGGCAGAGG - Intergenic
1152525658 17:80887004-80887026 GTCAGCAGAGGCTTTTGTGGAGG + Intronic
1152577480 17:81149250-81149272 GGGGCTGGAGGCTGTGGTGGTGG - Intronic
1152691985 17:81722492-81722514 GGGAGCTGTGGCTTCTGTGGAGG - Intergenic
1152808860 17:82371820-82371842 GGGGGGCGCGGCTTTGGTGGCGG + Intergenic
1153051667 18:907155-907177 GGGCTCGGAGGCTGGGGTGGGGG + Intronic
1153617477 18:6947902-6947924 GGGAGCTGAGGCCATGGAGGGGG + Intronic
1154162244 18:11989323-11989345 GGGAGAGGAGGCGGTGGTGATGG + Intronic
1154172862 18:12063580-12063602 GGGAGCAGAGGCTGGGGAGGAGG - Intergenic
1154291021 18:13106667-13106689 GGGAGTGGTGGCGGTGGTGGTGG - Intronic
1157510217 18:48266222-48266244 GGGATCGGAGGCCTGGGTGTTGG - Intronic
1157658488 18:49417135-49417157 GGTAGCGGTGGTGTTGGTGGTGG + Intronic
1157885367 18:51361215-51361237 GAGAGAGCAGGCTTTTGTGGGGG + Intergenic
1159588153 18:70301938-70301960 GGTAGAGAAGGCTTTGGTGTGGG + Intronic
1160236203 18:77088221-77088243 GGAAGAGGTGGCTTTGGTGAGGG + Intronic
1161010678 19:1958195-1958217 AGGGGCACAGGCTTTGGTGGGGG - Intronic
1161073836 19:2275525-2275547 GGGAGGGGAGGCTCTGGAGTGGG + Exonic
1161428410 19:4217059-4217081 GGGAGTGGAGGCCATGGGGGTGG + Exonic
1162125666 19:8498429-8498451 GGCAGCGGGGGCTTGGCTGGAGG + Exonic
1162796034 19:13088228-13088250 GGGTTGGGGGGCTTTGGTGGTGG - Intronic
1162832940 19:13298546-13298568 AGGAGCGGAGGCATCGGAGGAGG - Exonic
1163282851 19:16327591-16327613 GGGAGCGGAGAGTTTGATGGAGG + Exonic
1163490415 19:17614518-17614540 GGGTGGGGAGGGGTTGGTGGAGG - Intronic
1163658384 19:18561631-18561653 GGGAGAGGAGACATTGGAGGTGG + Intronic
1164003865 19:21131824-21131846 AGGAGTTGATGCTTTGGTGGTGG + Intergenic
1164579840 19:29428062-29428084 GAGAGGGGAGACCTTGGTGGTGG - Intergenic
1164624111 19:29715229-29715251 GGTCGCGCAGGCCTTGGTGGCGG + Intronic
1165387317 19:35518182-35518204 GGAAGATGAGGCTTTGGGGGTGG + Intergenic
1165390660 19:35536908-35536930 GGGTGAGGAGGCAGTGGTGGCGG - Exonic
1165584562 19:36902560-36902582 GGGAGAGGCGGGTGTGGTGGAGG + Intronic
1165966204 19:39582999-39583021 GGAAGGGCAGGCTTGGGTGGGGG - Intergenic
1166352748 19:42207837-42207859 TGGAGCAGAGGCTTTGTGGGTGG - Intronic
1166364026 19:42269512-42269534 GGGAGTGGAGGAAGTGGTGGGGG + Intronic
1166881885 19:45934878-45934900 GGGTGGGGAGGCATGGGTGGTGG + Exonic
1167147826 19:47693754-47693776 GGAAGCAGAGGCAGTGGTGGCGG - Intronic
1167429009 19:49443589-49443611 GGGTGCGGAGGCGGTGGTTGCGG + Intergenic
1167476854 19:49706270-49706292 GGCAGCGGAGGCCCTGGAGGCGG + Exonic
1167796576 19:51713457-51713479 GCGTGCGGAGGCTTTGCCGGCGG - Exonic
1168292494 19:55363261-55363283 GGGGGAGGAGCCTCTGGTGGAGG + Intergenic
1168408008 19:56120835-56120857 AGGAGCGGGGGCCTCGGTGGGGG - Intronic
925902860 2:8521076-8521098 GGGAGAGGAGGATGTGGGGGAGG - Intergenic
926349027 2:11978450-11978472 GGGACCCTAGGCTTTGCTGGTGG + Intergenic
927931059 2:27044601-27044623 GGTGGGGGAGGCTGTGGTGGGGG - Intronic
928603105 2:32920513-32920535 GGGAGAGGGGGCTTTGGGGAGGG + Intergenic
928951458 2:36817134-36817156 GGGAGCTGAGACTTTGAAGGAGG + Intergenic
929452080 2:42044712-42044734 GGGAACACAGGCTTAGGTGGGGG + Intergenic
929559177 2:42945160-42945182 GGAAGAGGAGCCTCTGGTGGGGG + Intergenic
930008046 2:46913823-46913845 AGGAGCGGAGGCTGTGGTACAGG - Intronic
930715393 2:54589209-54589231 GGGAGCTGAGGTTATGATGGGGG - Intronic
934709498 2:96505645-96505667 GGAACCGGAGTCTTTGGGGGCGG - Intronic
935332709 2:101988737-101988759 GGGAGAGCAGGCTCTGGAGGGGG + Intergenic
935383731 2:102479361-102479383 GGGACCGGAGGCTGTGGAGACGG + Intronic
935468974 2:103434038-103434060 GGGAGAGGAGGCTTTGCTGCTGG - Intergenic
935624931 2:105164112-105164134 AGGAGCAGTGACTTTGGTGGAGG - Intergenic
937247433 2:120502826-120502848 GGGACAGGAGGCTTTGGTTGGGG - Intergenic
937259863 2:120578387-120578409 GGGAGAGGAAGTCTTGGTGGGGG + Intergenic
940620869 2:156111579-156111601 GGGACGGGAAGGTTTGGTGGTGG + Intergenic
941397542 2:164991925-164991947 GGGAGTGGTGGTGTTGGTGGTGG - Intergenic
941684429 2:168433926-168433948 GAGAGGAAAGGCTTTGGTGGTGG - Intergenic
942080740 2:172397293-172397315 GGGAGCGGAGGCGGAGGTGAAGG + Intergenic
942302507 2:174575332-174575354 GGTGGTGGTGGCTTTGGTGGAGG - Exonic
943399187 2:187383685-187383707 GGAAGCAGAGGCTTTGGGGGAGG - Intronic
943682866 2:190786363-190786385 GGGAGCGGGGGCTGGGGTGGAGG - Intergenic
944192255 2:197015736-197015758 GGTAGAGGGGGCTATGGTGGTGG + Intronic
944738520 2:202589780-202589802 GGGAGCTGTGGCGTTGCTGGAGG - Intergenic
947050016 2:226031347-226031369 GGAAGCGGAGGCATTGGGGAAGG - Intergenic
947590220 2:231381135-231381157 GGGAGTGGAGGATTGAGTGGAGG - Intergenic
947590276 2:231381346-231381368 GGGAGTGGAGGATGGGGTGGAGG - Intergenic
947810599 2:233001501-233001523 GGGTGCTGGGGCCTTGGTGGGGG + Intronic
947953182 2:234165371-234165393 GGGAGGGGGGGCTTGGGGGGTGG - Intergenic
948028788 2:234799846-234799868 GGGAGAGCAGGCATTGGGGGTGG - Intergenic
948860263 2:240749538-240749560 GTGAGGGGAGACCTTGGTGGAGG + Intronic
1169135386 20:3194179-3194201 GGGAGCGGGGGCGGTGGTGGGGG - Intronic
1171457774 20:25281591-25281613 GGGAGCGGAGGCTGTGCCCGGGG + Intronic
1172311453 20:33921461-33921483 GGTAGCTGAGGCAGTGGTGGTGG - Intergenic
1172313168 20:33933570-33933592 GGGACAGGAGGCGTTGTTGGCGG - Intergenic
1172445376 20:34990552-34990574 GGAAGTGAAGACTTTGGTGGTGG + Intronic
1172774350 20:37398411-37398433 GGGACCGGAGGCCAGGGTGGAGG + Intronic
1173955632 20:47030385-47030407 GGGAGAGGTGGCTGTGGTGTAGG + Intronic
1174324217 20:49766368-49766390 GGCAGTTGAGGCATTGGTGGAGG - Intergenic
1175917042 20:62430753-62430775 GAGGGCGGAGGCTTTCTTGGTGG + Intergenic
1176115247 20:63429307-63429329 GGGAGCAGAGGCTGAGGAGGCGG - Intronic
1176548583 21:8212198-8212220 GGGAGCGGAGTCCGCGGTGGAGG - Intergenic
1176556477 21:8256406-8256428 GGGAGCGGAGTCCGCGGTGGAGG - Intergenic
1176567514 21:8395233-8395255 GGGAGCGGAGTCCGCGGTGGAGG - Intergenic
1176575416 21:8439448-8439470 GGGAGCGGAGTCCGCGGTGGAGG - Intergenic
1178290234 21:31361427-31361449 GGGAGGGGAGGCTTTCTTGGGGG + Intronic
1178372601 21:32038568-32038590 TGGAGCAGGGGCTTTGGTGAAGG - Intronic
1179808456 21:43854921-43854943 GGGAGGGGTGGCTATGCTGGAGG - Intergenic
1179839022 21:44058345-44058367 CGGTGAGGAGGCCTTGGTGGTGG + Intronic
1179953954 21:44727550-44727572 CGGAGGGGAGGCTGTGGCGGAGG - Intergenic
1183472486 22:38017007-38017029 GGCAGCAGAGGCTGGGGTGGGGG - Intronic
1184092836 22:42301402-42301424 GGGTGAGGGGGCTATGGTGGGGG + Intronic
1184097415 22:42324000-42324022 GGTGGCGGAGGTTATGGTGGTGG + Intronic
1184711047 22:46249766-46249788 GGGAGCGGGGGCTGGGGGGGCGG + Intronic
1184717691 22:46291229-46291251 GGGAGCTCAGGCTGTGGTGTGGG + Intronic
1185081975 22:48714477-48714499 GGGAGCTGAGGCCCAGGTGGTGG - Intronic
1185279689 22:49964756-49964778 GGTAGAGGAGGCCTGGGTGGAGG + Intergenic
1185384942 22:50527273-50527295 GAGAATGGAGGCTTTGGGGGAGG + Exonic
1203253467 22_KI270733v1_random:128503-128525 GGGAGCGGAGTCCGCGGTGGAGG - Intergenic
1203261521 22_KI270733v1_random:173581-173603 GGGAGCGGAGTCCGCGGTGGAGG - Intergenic
950676275 3:14556123-14556145 GCCAGCGGTGGCATTGGTGGCGG + Intergenic
952730489 3:36632944-36632966 GGGAGCTGAGGTTATGGGGGTGG + Intergenic
954069337 3:48131399-48131421 TGAATCGGAGGCTTTGGTGGTGG - Intergenic
954654705 3:52186811-52186833 CGGAGTGGACACTTTGGTGGGGG - Intergenic
954797830 3:53170485-53170507 GGGCCCTGAGGCTATGGTGGAGG - Intronic
955391607 3:58526263-58526285 GGGGTCTGAGGCTGTGGTGGAGG + Intronic
955924906 3:63995237-63995259 GGGAACGGGGGCGTTGGGGGTGG + Intronic
956734345 3:72226432-72226454 AGGAGCTGAAGATTTGGTGGAGG + Intergenic
957779897 3:84805617-84805639 GGGAGTGGCGGCTGGGGTGGTGG - Intergenic
959781109 3:110234276-110234298 GGGAGTGTAGGTTTTGGTGGGGG + Intergenic
960474837 3:118110894-118110916 GGGAGGGGAGGGGATGGTGGAGG + Intergenic
960559104 3:119062905-119062927 GGGAGTGGAGGCTAAAGTGGAGG - Intronic
961550886 3:127670059-127670081 GGGAGCAGAGGCCCTGGTGGTGG + Intronic
961592310 3:127990258-127990280 GGAACTGGAGGCTTTGGTTGCGG - Intergenic
963147457 3:142008975-142008997 TAGAGCAGAGGCTTTGGAGGTGG - Intronic
964141292 3:153403230-153403252 GGTAGCGGAGGTAATGGTGGTGG - Intergenic
964201516 3:154122637-154122659 GGGAGGGCAGCCTTTGGAGGGGG - Exonic
964465639 3:156988643-156988665 GGGTGCAGAGGCATTGGTGGAGG - Intronic
967048798 3:185762866-185762888 AGGAAGGGAGGTTTTGGTGGGGG - Intronic
969054121 4:4390934-4390956 GGGAGAGGAGGATGTGGGGGTGG + Intronic
969096580 4:4736959-4736981 GGCAATGGAGACTTTGGTGGTGG + Intergenic
969362206 4:6672107-6672129 GGGAGCGGAGGCCCTGGCTGGGG + Intergenic
969691323 4:8705701-8705723 TGGAGCTGAGGCTGGGGTGGGGG - Intergenic
970360599 4:15305216-15305238 GGGAGAGAAGGCTTTGGTCAAGG - Intergenic
970980535 4:22091497-22091519 GGGAGCCTGGGCTTTGGTGGTGG + Intergenic
971071423 4:23097133-23097155 GGGAGCAGAGGCAGAGGTGGAGG - Intergenic
976154617 4:82129254-82129276 AGAAGAGGAGGCTATGGTGGTGG + Intergenic
979752877 4:124301104-124301126 GGGAGCTGGGGCTCTGGTGTGGG + Intergenic
981558746 4:146024051-146024073 GGGAGGGGAGATATTGGTGGAGG + Intergenic
984768763 4:183419707-183419729 GGTCGAGGAGGCTTTGGTGAAGG - Intergenic
985371395 4:189289180-189289202 GTGGGCAGAGCCTTTGGTGGCGG - Intergenic
985493484 5:192299-192321 GGGAGTGGAGGCGTAGGTGGGGG - Exonic
988523811 5:31969019-31969041 TGGAGAGGATGCTTTGGAGGTGG + Intronic
988529328 5:32013853-32013875 GGGTGTTGAGGCTTTGGTGATGG - Intronic
989170970 5:38469956-38469978 GGGTTGGGAGGCTTTGGGGGTGG + Intergenic
990753048 5:59039131-59039153 GGGGGCGGAGGCTGTGCTCGCGG + Intronic
992388461 5:76308594-76308616 GAGAGAGCAGGCTTTGGTTGTGG + Intronic
992832758 5:80610962-80610984 GGGAGGGGAGGCCGGGGTGGGGG - Intergenic
993968121 5:94383061-94383083 GTGAGAGGAGGGGTTGGTGGAGG - Intronic
997052844 5:130403054-130403076 GGGAACCGCGGGTTTGGTGGTGG - Intergenic
997202898 5:132023472-132023494 GGGAGCAGAGGCTGGGATGGAGG - Intergenic
997464050 5:134074860-134074882 GGCAAAGGAGCCTTTGGTGGTGG - Intergenic
997838604 5:137217438-137217460 GGAAACGGAGGCTGTGGTGGGGG - Intronic
998367370 5:141639987-141640009 AGGAGCTGGGGCTCTGGTGGGGG + Exonic
999119150 5:149195576-149195598 GGGAGAGGTGGCTCTGGGGGTGG + Intronic
1001852951 5:174985365-174985387 GGGAGTGGAGGCCTTGGCTGAGG - Intergenic
1002292485 5:178209420-178209442 GGCAGCGGAGGTGGTGGTGGAGG + Exonic
1002818828 6:703447-703469 CGGAGCAGAGGCTTTTGGGGAGG - Intergenic
1002870885 6:1166432-1166454 GGGAGAGGAGGCTTTGGTGGAGG + Intergenic
1002985898 6:2190784-2190806 GGCAGGGGAGGCGTGGGTGGTGG + Intronic
1003177692 6:3764966-3764988 GGCAGGGGTGGCTTTGGAGGTGG - Intergenic
1003425232 6:5994601-5994623 GGTAGTGGAGGGGTTGGTGGGGG + Intergenic
1003468788 6:6409243-6409265 GGGATCAGAGGTGTTGGTGGTGG - Intergenic
1003756944 6:9132145-9132167 GGGAGGGGAGGCTTGGAAGGAGG - Intergenic
1005384500 6:25272583-25272605 GGAAGAGGAGGCTATGATGGAGG - Intergenic
1006090702 6:31627124-31627146 GGTAGGGGAGGCTTTGGGGCAGG - Exonic
1006173685 6:32109465-32109487 GGGAGTGGGGGCTGGGGTGGGGG - Intronic
1006186001 6:32182104-32182126 GGCAGGGGAGGCTTGGGTGTGGG + Intronic
1006383696 6:33716713-33716735 GGGAGGTGAGGCCCTGGTGGGGG - Intergenic
1007387266 6:41528380-41528402 GGGAGCCCAGGCTTTGCTTGAGG - Intergenic
1008166820 6:48149259-48149281 GGAAGAGGAGGTTATGGTGGTGG - Intergenic
1011650597 6:89502970-89502992 GGGTGCAGAGGGTGTGGTGGAGG - Intronic
1013435531 6:110101812-110101834 GGCAGAGGAGGCGGTGGTGGGGG + Exonic
1013993344 6:116279371-116279393 GGGGGCGGAGGCTGAGGCGGAGG - Exonic
1015445046 6:133293863-133293885 GGAAGTGGAGGCTTTGGAAGTGG + Intronic
1016559779 6:145383072-145383094 GGGAGCTGTGGCTTTTGTAGTGG - Intergenic
1017717855 6:157224630-157224652 GGGAGCGGCAGCCTTGGAGGGGG + Intergenic
1017908312 6:158771907-158771929 GGGAGGGGAGGCTGTGGCAGAGG - Intronic
1017951921 6:159142258-159142280 GGGTGCAGAGGCTTTGGGGAAGG - Intergenic
1018913567 6:168118671-168118693 GGAAGTGGAGGCTTTGGGAGGGG + Intergenic
1019060169 6:169251833-169251855 GGGAGCAGATGGTTTGGGGGGGG - Intronic
1019164358 6:170088326-170088348 GGGAGCTGGGGCTGCGGTGGGGG - Intergenic
1019256594 7:56462-56484 GGGAGGGGAGGCCTTGGCCGTGG - Intergenic
1019341568 7:511141-511163 GGGAGCAGAGGCTTAGGGGCTGG + Intronic
1019358370 7:592585-592607 GGAACCTGAGTCTTTGGTGGAGG - Intronic
1019367995 7:645092-645114 GTGAGGGGAGGATGTGGTGGAGG - Intronic
1019494764 7:1332557-1332579 GGGAGCTGTGGCTCTGGAGGAGG - Intergenic
1019642582 7:2112203-2112225 GGGAGGGGAGTCTGGGGTGGTGG + Intronic
1021997401 7:26193637-26193659 GGAAGAGGAGGATATGGTGGTGG - Exonic
1024974677 7:55102174-55102196 GGGAGCTGAGGCTCTGGGTGAGG - Intronic
1025263582 7:57438578-57438600 GGGAGGGGAGGGTTTGGGGAGGG + Intergenic
1025611381 7:63078020-63078042 GGGAACAGAGGCTCTGTTGGGGG - Intergenic
1028752063 7:94393624-94393646 GGGAGTGGAGGGTTGGATGGAGG + Intergenic
1029202937 7:98851201-98851223 GGGATTGGAGAGTTTGGTGGTGG + Intronic
1029708036 7:102285894-102285916 GGGAGGGAGGGCTTCGGTGGGGG - Intronic
1030777415 7:113551996-113552018 GAGAGAGAAGGCTTTAGTGGGGG - Intergenic
1032096016 7:128938859-128938881 GGGAGCAGAGGCTGGAGTGGGGG + Intronic
1032206589 7:129871247-129871269 GGCAGCTGAGGCTTTGGCTGTGG - Intronic
1032883778 7:136116347-136116369 GGCAGTGGAGGCTGTGCTGGGGG + Intergenic
1034533224 7:151710384-151710406 GGGAGGGGAGTCTTTTGTGGTGG - Intronic
1034973765 7:155436256-155436278 TGGAGCTGAGGTTTTGGAGGTGG - Intergenic
1035388559 7:158490197-158490219 GGGAGCGGAGGCTTCCAGGGAGG + Intronic
1035396003 7:158535029-158535051 AGGAACAGAGGCTTTGGAGGTGG - Intronic
1035708281 8:1694432-1694454 GGGAGCGGAGCCTTTCGGGACGG + Intronic
1035989853 8:4477307-4477329 GGAAGCCGAGGCGTTGGTGCTGG + Intronic
1038591996 8:28847512-28847534 GGCAGTGGTGGTTTTGGTGGAGG - Intronic
1039453888 8:37695822-37695844 GGCGGCGGAGGCGTCGGTGGAGG + Exonic
1039610263 8:38913906-38913928 TGGGGCGGAAGCTTTGTTGGAGG + Intronic
1045235621 8:100350728-100350750 GGAGGCGGAGGCTGAGGTGGAGG - Intronic
1048900035 8:139028261-139028283 GGGAATGGAGGCTTTGCTGTAGG - Intergenic
1049004822 8:139847906-139847928 GGGAGCGGAGGCTTTGGTGGTGG - Intronic
1049272621 8:141703971-141703993 GGGAGTGGGGGCTCTGGGGGAGG - Intergenic
1049624390 8:143613550-143613572 GGCAGCCGAGGCGGTGGTGGAGG - Exonic
1049773449 8:144394192-144394214 GGGAGCTGAGGCTCTGGGGGTGG - Intronic
1050722985 9:8611982-8612004 GGGAGGGGAGGGTTTGGGAGGGG + Intronic
1051774820 9:20622086-20622108 GGGAGCGGAGGCTGAGGGAGAGG + Intronic
1053278886 9:36803969-36803991 GGGAGCTGCTGCTTTGGAGGTGG + Intergenic
1057207998 9:93184738-93184760 GGGACCAGAGGCTTGGGTTGGGG - Intergenic
1057221909 9:93262021-93262043 GGCAGCGGTGGGTTTGCTGGTGG - Exonic
1058151133 9:101464859-101464881 GGGAGGGGAGACTTTGGATGGGG - Intergenic
1058405780 9:104672683-104672705 GGCAGAGGAGGCTTTTGAGGAGG - Intergenic
1058670938 9:107359909-107359931 GGGAGGGTTGGCTTGGGTGGAGG + Intergenic
1059669160 9:116477012-116477034 GGGAGCTGAGGCTGCGCTGGAGG - Intronic
1060797865 9:126524754-126524776 GGGAGCTGAGGACTTGGTCGCGG + Intergenic
1061008504 9:127942016-127942038 GAGAGCAGAGGCTTTAGTAGGGG + Exonic
1061215241 9:129217962-129217984 ACGCGCGGAGGCTTTGATGGAGG - Intergenic
1061563217 9:131419936-131419958 GTGAGCCGTGGCTCTGGTGGAGG + Intronic
1061570570 9:131475382-131475404 GGGAGCGGCCTCTGTGGTGGGGG + Exonic
1061876212 9:133545411-133545433 GGAAGAGGAGGCTTTGCTGAAGG + Intronic
1061914292 9:133741207-133741229 AGAAGCGGAGGCGTTGGGGGAGG + Intergenic
1062270754 9:135707308-135707330 GGGTGGGGAGGCCGTGGTGGGGG - Intronic
1062463348 9:136671010-136671032 AGGAGGTGAGGCATTGGTGGGGG + Exonic
1203469867 Un_GL000220v1:111650-111672 GGGAGCGGAGTCCGCGGTGGAGG - Intergenic
1203477688 Un_GL000220v1:155622-155644 GGGAGCGGAGTCCGCGGTGGAGG - Intergenic
1185771022 X:2765698-2765720 GGGAGCAGAGGTTTTGCTGTGGG + Intronic
1187245305 X:17548430-17548452 GGGAACAGAGGCTGGGGTGGGGG + Intronic
1187482849 X:19673842-19673864 GGGTGCAGGGGCTGTGGTGGTGG - Intronic
1187701668 X:21969346-21969368 GGGAGAGGAGGGTTTGGTGGTGG - Intronic
1187934399 X:24321682-24321704 GGGGGCGGAGGCATGGTTGGAGG + Intergenic
1189085034 X:38013899-38013921 AGGAGAGGAGGAGTTGGTGGTGG - Intronic
1189475211 X:41347430-41347452 AGCAGCAGAGGATTTGGTGGAGG + Exonic
1189659913 X:43286004-43286026 GGTAGTGGCGGCATTGGTGGTGG + Intergenic
1189759008 X:44301666-44301688 GGGAGAGGGGACTTTTGTGGGGG - Intronic
1190292008 X:48999494-48999516 AGGAGCTGAGCCTTTGGGGGAGG + Exonic
1192815911 X:74591960-74591982 GGAAGAGGAGGTTCTGGTGGTGG - Exonic
1196393478 X:115233986-115234008 GGGGGCGGCGGTTGTGGTGGAGG - Exonic
1197034069 X:121853770-121853792 GGGACCAGAGGGTTTGGTGTAGG + Intergenic
1197421312 X:126238757-126238779 GAGAGAGGAGGCTTTGGAGAGGG - Intergenic
1198761069 X:140033076-140033098 GGAAGAGGAGGCTATGGTGGTGG + Intergenic
1200935741 Y:8736729-8736751 GGCAGAGGAGACTTTTGTGGAGG - Intergenic