ID: 1049004823

View in Genome Browser
Species Human (GRCh38)
Location 8:139847909-139847931
Sequence GCAGGGAGCGGAGGCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 1, 2: 1, 3: 38, 4: 399}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049004823_1049004839 25 Left 1049004823 8:139847909-139847931 CCACCAAAGCCTCCGCTCCCTGC 0: 1
1: 1
2: 1
3: 38
4: 399
Right 1049004839 8:139847957-139847979 CAGCAGCCCTGGGGCACGTGGGG No data
1049004823_1049004833 14 Left 1049004823 8:139847909-139847931 CCACCAAAGCCTCCGCTCCCTGC 0: 1
1: 1
2: 1
3: 38
4: 399
Right 1049004833 8:139847946-139847968 CCCTGTGTCAGCAGCAGCCCTGG No data
1049004823_1049004836 16 Left 1049004823 8:139847909-139847931 CCACCAAAGCCTCCGCTCCCTGC 0: 1
1: 1
2: 1
3: 38
4: 399
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004823_1049004835 15 Left 1049004823 8:139847909-139847931 CCACCAAAGCCTCCGCTCCCTGC 0: 1
1: 1
2: 1
3: 38
4: 399
Right 1049004835 8:139847947-139847969 CCTGTGTCAGCAGCAGCCCTGGG No data
1049004823_1049004838 24 Left 1049004823 8:139847909-139847931 CCACCAAAGCCTCCGCTCCCTGC 0: 1
1: 1
2: 1
3: 38
4: 399
Right 1049004838 8:139847956-139847978 GCAGCAGCCCTGGGGCACGTGGG No data
1049004823_1049004840 30 Left 1049004823 8:139847909-139847931 CCACCAAAGCCTCCGCTCCCTGC 0: 1
1: 1
2: 1
3: 38
4: 399
Right 1049004840 8:139847962-139847984 GCCCTGGGGCACGTGGGGCCTGG No data
1049004823_1049004837 23 Left 1049004823 8:139847909-139847931 CCACCAAAGCCTCCGCTCCCTGC 0: 1
1: 1
2: 1
3: 38
4: 399
Right 1049004837 8:139847955-139847977 AGCAGCAGCCCTGGGGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049004823 Original CRISPR GCAGGGAGCGGAGGCTTTGG TGG (reversed) Intronic
900346886 1:2214390-2214412 GGAGGGAGCGAAGGCCGTGGTGG + Intergenic
900473321 1:2864926-2864948 GCAGGCAGAGGAGGCTTTGTGGG - Intergenic
902615357 1:17620666-17620688 GCAGGGAGCCGGGGTTCTGGTGG + Intronic
903010250 1:20324711-20324733 GCAAGGAGAGGAGGGTTGGGTGG + Intronic
903142242 1:21345574-21345596 GCAGGGCGCGGGGGCCTGGGTGG + Intergenic
903192872 1:21666609-21666631 GGAGGAAGGGGAGGCTTTGCTGG + Intronic
903291225 1:22315466-22315488 GCAGGAAGGGGAGGCTGCGGGGG + Intergenic
904011530 1:27392950-27392972 GCAGGGACCCGAGGCCCTGGAGG + Intronic
904997204 1:34640401-34640423 GGAGGAAGAGGAGGTTTTGGGGG - Intergenic
905231072 1:36515287-36515309 CCAGGGAGAGCAGGCTCTGGGGG + Intergenic
905477452 1:38239026-38239048 GCAGGGAGAGGAGACTTGAGAGG + Intergenic
905580600 1:39081080-39081102 GCAGAGGGCGGAGAATTTGGGGG + Intergenic
906027050 1:42682665-42682687 GCAGGGAGCGGTGGCCCGGGCGG + Exonic
906225624 1:44119041-44119063 GCGGGGAGGGGAGGCCTTGGAGG + Intronic
906935152 1:50208278-50208300 GCAGGGAGAGGTGGGTTTAGTGG + Intergenic
907564936 1:55425779-55425801 GGAGGGAGGGAAGGCTTTTGAGG - Intergenic
907883014 1:58569040-58569062 GCAGGGCGTGGAAGCATTGGTGG - Intergenic
909393084 1:75137004-75137026 GAAGGGAGGGGAGGCGGTGGGGG + Intronic
911141086 1:94503302-94503324 GCAGAGAGGAGAGGCATTGGTGG + Intronic
912428693 1:109616894-109616916 GCATGGAGTGGAGGGTTGGGAGG + Exonic
912679433 1:111719846-111719868 TCAGGGAGCTGAGGCTATGCAGG + Intronic
912948614 1:114105348-114105370 GCGGTGAGCGCAGGCTCTGGAGG - Intronic
914900887 1:151710495-151710517 GCTGGGGGTGGAGGATTTGGTGG + Intronic
915960490 1:160262467-160262489 GCAGAGAGCGGAGGCGGTGGTGG - Intronic
916087694 1:161282697-161282719 ACAGGGAGAGGAGGTTTTAGGGG - Intronic
916510073 1:165465633-165465655 GCAGAGAGTGAAGGCATTGGAGG + Intergenic
917028037 1:170663323-170663345 GCATGCAGAGGAGGCTTTGTAGG - Intronic
917309894 1:173668267-173668289 GCAGGGCAAGGAGGCTTTGCAGG + Intronic
917612370 1:176701634-176701656 TGAGGGAGTGGAGGCTTTGTGGG + Intronic
917926846 1:179796541-179796563 GCAGGAGGAGGAGACTTTGGGGG - Intronic
918066827 1:181106859-181106881 GGAGGGGGCTGAGGTTTTGGTGG + Intergenic
918117157 1:181507488-181507510 GCAGGGAGCTGGGGCAGTGGAGG + Intronic
918310774 1:183283733-183283755 GGAGGGAGTGGAGGCTCTGAAGG + Intronic
918448313 1:184635693-184635715 GCAGGGAGAGGTGGCTTTGTGGG - Intergenic
919761271 1:201099629-201099651 GCAGGGAGCTCAGGCTGGGGTGG + Intronic
919978938 1:202630475-202630497 GCAGGGAGCCAAGGTTTAGGAGG + Intronic
920059538 1:203217870-203217892 GCAGGGAGGGGATGCAGTGGAGG + Intronic
920215615 1:204359877-204359899 GCAGGGAGAGGATGCTGTTGTGG + Exonic
920339930 1:205269379-205269401 GCAGGCATCAGCGGCTTTGGGGG + Exonic
920840429 1:209549466-209549488 GGAGGGAGGGTGGGCTTTGGAGG - Intergenic
921896758 1:220409897-220409919 TCAGGGAGGGGAGGGGTTGGGGG + Intergenic
923030602 1:230246484-230246506 TCACGGAGCTGAGGCTTTGTGGG + Intronic
923243002 1:232104029-232104051 GCAGGCAGAGGAGGCTTTGTTGG - Intergenic
924399524 1:243663466-243663488 GCAGGGAGGGGAGGGTGTGCAGG + Intronic
1063670475 10:8095829-8095851 GCGGGCAGCGGAAGCGTTGGGGG + Intergenic
1063971213 10:11382406-11382428 GCTGGGGGCGGGGGCTGTGGAGG + Intergenic
1065008699 10:21402692-21402714 GCAGGGAGAGGTGGGTGTGGGGG - Intergenic
1065046996 10:21753933-21753955 GCAGGGTGAGGTGGCTTGGGAGG + Intergenic
1067070080 10:43124799-43124821 GCAGGGTGCGATGGCTGTGGTGG + Intronic
1067431746 10:46249936-46249958 GCAGGGAGGGGAGGAGGTGGAGG - Intergenic
1067441674 10:46312238-46312260 GCAGGGAGGGGAGGAGGTGGAGG + Intronic
1067851164 10:49755437-49755459 GCAGTGAGCGGGGGCTAAGGGGG + Intronic
1070168589 10:73915729-73915751 TCAGGGAGGGGAGGCTTTAAAGG + Intronic
1070412851 10:76159894-76159916 GCAGAGAACAGAGGATTTGGGGG + Intronic
1070672672 10:78388901-78388923 GAAGGAAGCGGGGGCTATGGAGG - Intergenic
1070689676 10:78515340-78515362 GCAGGGAGGGGAGGCAATGTGGG + Intergenic
1070746568 10:78937235-78937257 GCAGGGAGGGGAGGCCTTAAAGG + Intergenic
1070973165 10:80584267-80584289 GGATGGAGAGGAGGCTTAGGTGG + Intronic
1071598060 10:86942374-86942396 GAAGGAAGCGGAGCCTTTGGTGG - Exonic
1072454036 10:95561035-95561057 CCAGGGTGCGGAGGATCTGGGGG - Intronic
1072620935 10:97078818-97078840 GCTGGGCGCGGAGACCTTGGAGG + Intronic
1073323014 10:102626986-102627008 GCAGGGAGGTGAGGGTGTGGGGG + Intronic
1073353711 10:102837259-102837281 GCAGGGACAGGAGGCTCTTGGGG + Exonic
1073535008 10:104268845-104268867 GCCGGCAGCCGGGGCTTTGGTGG - Intergenic
1073593333 10:104777011-104777033 GTGGGGGGTGGAGGCTTTGGGGG + Intronic
1075144649 10:119872752-119872774 TCAGGGAGCGGCGGCTGCGGTGG + Exonic
1075188571 10:120285465-120285487 GCAGTCAGAGGAGGCTTTGGTGG - Intergenic
1076527826 10:131123507-131123529 GCAGTGAGGGGAGGGTGTGGGGG + Intronic
1076591511 10:131586925-131586947 GCAGGGAGCCGAGGCTTCAAAGG + Intergenic
1076814526 10:132908259-132908281 GCAGGGAGCGCGGGCCTGGGCGG - Intronic
1076889633 10:133277275-133277297 GGAGGGGGCGCAGGCTTGGGGGG - Intergenic
1077065073 11:637400-637422 GCAGGGCGCGGCGGCGCTGGTGG + Exonic
1077154568 11:1085631-1085653 GCAGGGAGGGGTGGCTGGGGAGG - Intergenic
1077838601 11:5947541-5947563 GCAGGGAGAGGAGGCTGAGCAGG - Exonic
1077840407 11:5968281-5968303 GCAGGGAGAGGAGGCTGAGCAGG + Exonic
1077843788 11:6002779-6002801 GCAGGGAGAGGAGGCTGAGCAGG + Exonic
1077846218 11:6027479-6027501 GCAGGGAGAGGAGGCTGAGCAGG + Exonic
1077848039 11:6046534-6046556 GCAGGGAGAGGAGGCTGGGCAGG + Intergenic
1077898858 11:6474086-6474108 GCAGGAGGTGGAGGCGTTGGCGG - Exonic
1078033213 11:7774815-7774837 GCAGTCAGAGAAGGCTTTGGAGG - Intergenic
1078090287 11:8260858-8260880 GCAGGGAACGCACCCTTTGGGGG + Intronic
1078603298 11:12752393-12752415 GCAGCGTGGGGAGGCTTAGGAGG - Intronic
1079202048 11:18384717-18384739 GGAGGGAGCTCAGGCTGTGGGGG - Intergenic
1080639863 11:34152363-34152385 GCAGGGGGCGGAGGCTGCCGAGG - Exonic
1080802007 11:35618329-35618351 GCGGGGAGCGGAGGCGGAGGAGG + Intergenic
1080896796 11:36454548-36454570 GTAGGCAGCGGAGGGTGTGGGGG + Intronic
1081686980 11:45049625-45049647 GCTGGGAGCGGGGGCTGCGGTGG + Intergenic
1081754348 11:45533924-45533946 GCAGGGGGAGGAGGCTGAGGAGG + Intergenic
1083198807 11:61107114-61107136 GCTGGGACCGGAAGCCTTGGTGG + Intronic
1083282338 11:61634780-61634802 GCAGGGAGGGGAGGGTCTGTGGG + Intergenic
1083384456 11:62297189-62297211 ACAGGGAGAGGAGGCTTGAGGGG - Intronic
1083658481 11:64241498-64241520 GGACGGAGCGGAGGCGCTGGGGG + Intronic
1083815383 11:65129888-65129910 GCAGGGGGCACAGGCATTGGGGG + Exonic
1084029052 11:66470284-66470306 TCAGGGAATGGTGGCTTTGGTGG - Intronic
1085408320 11:76277170-76277192 GCAGGAAGGGGTGGCTTTGGTGG - Intergenic
1087006723 11:93478959-93478981 GCAGGGAGAGGAGGCGCGGGAGG - Exonic
1088844625 11:113654434-113654456 TCAGGGAGCGGAAGGTCTGGTGG - Intergenic
1090202287 11:124865473-124865495 GCAGCGCGCAGAGGCTGTGGAGG + Exonic
1090276195 11:125421454-125421476 GCAAGGAGCAAGGGCTTTGGAGG + Intronic
1090356030 11:126140838-126140860 CCAGGATGCGGAGGCTTGGGTGG + Intergenic
1090659667 11:128872759-128872781 GCTTGGAGCAGAGGCTGTGGAGG - Intergenic
1091054872 11:132408476-132408498 GCAGGGAGCAGAGGCTGGTGAGG - Intergenic
1091177412 11:133574237-133574259 GATGAGAGCGGAGGCTGTGGAGG - Intergenic
1091332749 11:134743514-134743536 GCAGAAAGGGGAGGCTGTGGGGG - Intergenic
1091603235 12:1930330-1930352 GAAGGGAACGGAGGCATTGAGGG - Intergenic
1091806591 12:3361381-3361403 GAAGGGAGAGGAGGCTGTTGGGG + Intergenic
1092238253 12:6822747-6822769 CCCTGGAGAGGAGGCTTTGGAGG - Intronic
1092260775 12:6952277-6952299 GCAGGGAGGGGAGGGGATGGAGG - Intronic
1096228777 12:49885967-49885989 GCTGTGAGCAGAGGTTTTGGGGG - Intronic
1097694492 12:62763290-62763312 GGAGGGAGCCGAGGCTTGGAGGG - Intronic
1101430492 12:104622938-104622960 GCAGGGTGAGATGGCTTTGGGGG - Intronic
1102053493 12:109879906-109879928 GAAGGGGCAGGAGGCTTTGGGGG + Intronic
1102192431 12:110998876-110998898 GCAGGCAGGGAGGGCTTTGGAGG - Intergenic
1102490020 12:113285048-113285070 GCAGGGAGCAGAGGCTGCTGAGG - Intronic
1102544000 12:113641652-113641674 GCAGGGAGCGGTGGAGGTGGAGG - Intergenic
1102572134 12:113833315-113833337 CCATGGAGCAGAGGCTGTGGAGG - Intronic
1104678840 12:130734795-130734817 TCAGGAAGGGGAGGCTTTGCAGG - Intergenic
1106207467 13:27613272-27613294 GCAGGGAGGGGAGGGTGAGGTGG + Intronic
1106501882 13:30336692-30336714 GCAGGCAGTGGAGGCACTGGAGG - Intergenic
1106665467 13:31846791-31846813 GCAGGGAGCGCAGGCGGTGGCGG + Intergenic
1108559163 13:51626333-51626355 GAAGGGAATGGAGGCTTAGGAGG - Intronic
1111772798 13:92621278-92621300 GATGGGAGTGGAGGCTGTGGTGG - Intronic
1112225111 13:97532032-97532054 GCAGGGGAGGGAGGCTTTGGAGG + Intergenic
1113070404 13:106414657-106414679 GCAGAGATCGGAGGCCTTGCAGG - Intergenic
1113709824 13:112455822-112455844 GCAGGGAGCAGGGGTTTTGGGGG + Intergenic
1113871509 13:113562593-113562615 GGAGGCAGCAGAGGCCTTGGAGG - Intergenic
1114460504 14:22883431-22883453 GGTGGGAGCTGAAGCTTTGGTGG + Intronic
1117546404 14:56797823-56797845 GCACTGAGCTGAGGCTTTCGGGG - Intergenic
1117790092 14:59331338-59331360 GGAGGGAGGGGAGGCGGTGGAGG - Exonic
1118348858 14:64959370-64959392 GCAGGGAGCGATGGTTTAGGAGG - Intronic
1118463883 14:66013680-66013702 GCAGGGAGCGGTGGCCCGGGCGG - Intergenic
1118770503 14:68939622-68939644 GCTGGGAACGGAGGAGTTGGGGG + Intronic
1119473224 14:74911957-74911979 GCAGGGAGGGCGGGCTTTGGTGG + Intronic
1121436429 14:93923575-93923597 GCAGGGACCAGAGGGTGTGGAGG - Intronic
1121950637 14:98167961-98167983 CCATGTGGCGGAGGCTTTGGCGG - Intergenic
1122029398 14:98901564-98901586 GCAGGGAGAGGAGGCCATGCTGG - Intergenic
1122314946 14:100820412-100820434 GCAGGCAGCGGTGGCAGTGGTGG + Intergenic
1122486694 14:102086903-102086925 GCGCGGGGCGGAGGCTGTGGGGG - Intronic
1122813036 14:104298305-104298327 GCAGGGACTGGAGGCATAGGAGG + Intergenic
1123018054 14:105384854-105384876 GCAGGGGGAGGAGGCGGTGGGGG - Intronic
1123031105 14:105451480-105451502 GGCGGGAGCAGAGGCTGTGGGGG + Intronic
1123118731 14:105907259-105907281 GCAGGGACAGGAGGATTTTGTGG - Intergenic
1123696024 15:22879881-22879903 GCGGGGAGGGGCGGCGTTGGGGG + Intronic
1124494535 15:30178363-30178385 GCAGGGAGCCAAGGTTTAGGAGG + Intergenic
1124749035 15:32360282-32360304 GCAGGGAGCCAAGGTTTAGGAGG - Intergenic
1124911137 15:33921924-33921946 GCAGGGAGCGGAGGGTGGGGAGG + Intronic
1125059477 15:35401527-35401549 GGAGGCAGAGGTGGCTTTGGTGG + Intronic
1125200716 15:37098859-37098881 GCAGGGAGCGGAGGGTGGGGGGG + Intronic
1125317036 15:38442281-38442303 GCAGGGAGCAGTGGAATTGGGGG + Intergenic
1128748692 15:70133159-70133181 TCAGTGAGTGGAGGCTTTGAAGG + Intergenic
1130938360 15:88488718-88488740 GCAGGGAGCAGAGGAGGTGGGGG - Intergenic
1131024568 15:89129189-89129211 GCAGGTAGGGGAGGTTGTGGGGG + Intronic
1131456432 15:92585882-92585904 GGAGGGAGCAGAGGCCTCGGAGG + Intergenic
1132191735 15:99867979-99868001 GGTGGGAGTGGAGGCTTTGGTGG + Intergenic
1132236298 15:100224354-100224376 ACAGGATGGGGAGGCTTTGGTGG + Intronic
1132291822 15:100709158-100709180 GCAGTGAGCTGAGGTGTTGGAGG + Intergenic
1132683567 16:1153324-1153346 GCCGGGGGCGGAGGCGCTGGGGG + Exonic
1132683586 16:1153358-1153380 GCCGGGGGCGGAGGCGCTGGGGG + Exonic
1132828944 16:1918298-1918320 GCAGGTAGCGGCGGCCTGGGCGG - Exonic
1132945236 16:2528620-2528642 GCAGAGAGGGCAGGCTCTGGGGG - Exonic
1133028029 16:2997116-2997138 GGAGGGAGCTCAGGGTTTGGGGG - Intergenic
1133825239 16:9272605-9272627 GCAGGGTGAGGAGGCTGCGGTGG + Intergenic
1134355844 16:13481512-13481534 GAAAGGAGAGGAGGCTGTGGTGG - Intergenic
1135470179 16:22723041-22723063 GCAGGGAGCGGAGCTTGTCGGGG + Intergenic
1136074691 16:27808864-27808886 GCATGGAGCAGAGGCTGTTGAGG + Intronic
1136288035 16:29255393-29255415 GCAGGAAGACGTGGCTTTGGAGG + Intergenic
1136401455 16:30021501-30021523 GCAGGGAGCGGAGTCTGCGAAGG + Intronic
1136491286 16:30610013-30610035 GCAGGGAGCGGAGCCGAAGGTGG + Exonic
1140363523 16:74364247-74364269 GCAGGGAATCCAGGCTTTGGGGG + Intergenic
1141280584 16:82627203-82627225 GCAGGGTGAGGGGGCTTTCGGGG + Intronic
1142093701 16:88228160-88228182 GCAGGAAGACGTGGCTTTGGAGG + Intergenic
1142172717 16:88631154-88631176 GCCGGGATCCGAGGCTTTGCCGG - Exonic
1142688062 17:1589236-1589258 GCAGGGAGATGAGCCTTTCGAGG + Intronic
1143102477 17:4512138-4512160 GCAGGGACAGAAGCCTTTGGGGG - Intronic
1143130478 17:4674176-4674198 GGAGGAAGCGAAGGCCTTGGAGG + Intronic
1144025889 17:11275300-11275322 GCTTGGAGAGGAGGCTTTTGGGG + Intronic
1144503177 17:15807255-15807277 GCAGAGAGCTGAGTCTTGGGAGG + Intergenic
1144639861 17:16931314-16931336 GCAGGAAGCAGAGTCTCTGGAGG + Intronic
1145165358 17:20609970-20609992 GCAGAGAGCTGAGTCTTGGGAGG + Intergenic
1146385390 17:32367847-32367869 GCAGGGAATGTAGGCTTTGGGGG - Exonic
1147454886 17:40530958-40530980 TCAGGCAGGTGAGGCTTTGGGGG + Intergenic
1147562676 17:41518733-41518755 GCTGGGGGAGGTGGCTTTGGTGG - Exonic
1147652677 17:42071376-42071398 CCAGGGAGGGGAGGCGGTGGGGG - Intergenic
1148128166 17:45247480-45247502 CGAGGGGGCGGAGGCTTTCGTGG + Intergenic
1148238254 17:45983487-45983509 GGAGGGAGGGGAGTCTTGGGGGG - Exonic
1149001310 17:51760449-51760471 GCAGGGAGCGGTGGAGATGGTGG + Intronic
1150284557 17:63947675-63947697 TCAGGGAAAGGAGGCCTTGGGGG - Intronic
1150330017 17:64286944-64286966 GCAGGGTGAGAAGGCTTTGTGGG - Intergenic
1151275980 17:73034633-73034655 GCAGGGTGGGGAGGATTTAGAGG - Intronic
1151474071 17:74335600-74335622 GCTGGGAGAGGAGGCCGTGGAGG + Intronic
1151599832 17:75099498-75099520 GCAGTGAGCTGAGGTTGTGGAGG - Intronic
1152033743 17:77859187-77859209 GCAGGCAAAGGAGGCTCTGGTGG - Intergenic
1152106111 17:78329990-78330012 CCAGGGAACTGAGCCTTTGGCGG - Intergenic
1152231849 17:79117794-79117816 GCAGGGAGCAGGGGCTGTCGGGG - Intronic
1152324491 17:79627660-79627682 GCAGGGAGCAGCGGCGTAGGTGG + Intergenic
1152469049 17:80480878-80480900 GCTGGGAGGGGAGGGTATGGTGG + Intergenic
1152639862 17:81444910-81444932 GGAGGGAGCGGTGGGCTTGGTGG + Intronic
1154053638 18:10989120-10989142 GAAGAGAGAGGAGACTTTGGAGG + Intronic
1154170438 18:12047167-12047189 GTAGGGAGCGGGGGCGTTAGGGG - Intergenic
1154172863 18:12063583-12063605 GGAGGGAGCAGAGGCTGGGGAGG - Intergenic
1154173013 18:12064122-12064144 GCAGTGAGCTGAGGCCCTGGAGG - Intergenic
1154199795 18:12291416-12291438 ACAGGGGGCAGAGGCTGTGGGGG - Intergenic
1156464017 18:37337235-37337257 GGAGGGAGAGGAGGATGTGGTGG + Intronic
1158414928 18:57241899-57241921 GGAGGGAGAGCAGGGTTTGGAGG + Intergenic
1158445667 18:57518409-57518431 GCTGGGTCCAGAGGCTTTGGAGG - Intergenic
1160510748 18:79452154-79452176 GCAGAGAGTGGACGCTTCGGGGG + Intronic
1160556669 18:79729903-79729925 GCAGGGAGGATAGGCTCTGGTGG - Intronic
1160596657 18:79980102-79980124 ACAGGGACAGGAGGCTCTGGGGG + Intronic
1160812022 19:1017063-1017085 AAGGGGAGCTGAGGCTTTGGCGG - Intronic
1160837466 19:1131630-1131652 GTAGGGAGCGGAGGCTGGGTGGG - Intronic
1161147331 19:2686693-2686715 CCAAGGAGCGGAGCCTTTGTAGG + Intronic
1161205996 19:3041817-3041839 GCTGGGAATTGAGGCTTTGGGGG + Intronic
1161226106 19:3146736-3146758 GCAGGGAGGACAGGCTGTGGGGG - Intronic
1161594489 19:5144222-5144244 GGAGGGTGCGGAGGGTGTGGGGG - Intronic
1161621808 19:5301733-5301755 GCAAGGAGGGGAGGATTGGGGGG - Intronic
1161718861 19:5892384-5892406 GCAGGGGGCGGAGGCCTGCGTGG + Exonic
1162033259 19:7926203-7926225 GCAGGGGGCGGAGGCTGCGCAGG + Intergenic
1162832941 19:13298549-13298571 ACAAGGAGCGGAGGCATCGGAGG - Exonic
1163123587 19:15232447-15232469 GTAGGGTGCGGAGGCTGGGGAGG + Intronic
1163425048 19:17236377-17236399 GCTGGGCCTGGAGGCTTTGGAGG - Intronic
1163822328 19:19503003-19503025 GCAGGTAGTGGAGGCCTTGCCGG + Intronic
1164147067 19:22518579-22518601 CCAGGGAGCTGAGGCTGAGGAGG + Intronic
1164159569 19:22617749-22617771 CCAGGGAGCTGAGGCTGAGGAGG - Intergenic
1164589792 19:29500413-29500435 ACAAGGAGCGGGGGCCTTGGAGG + Intergenic
1164756874 19:30696272-30696294 GCCGGGAGCGGAGGGGCTGGTGG - Intronic
1164988900 19:32670415-32670437 GCAGGGTGCAGTGGCTTGGGAGG + Intronic
1165351777 19:35279612-35279634 GGAAGGAGGGGAGCCTTTGGGGG + Exonic
1165776038 19:38404939-38404961 GCAGAGAGCGGAGGCACAGGAGG - Exonic
1166682450 19:44777404-44777426 GCAGGGTGGGGTGGCTTTGGTGG - Intergenic
1167007349 19:46784643-46784665 GCAGCGAGTGGAAGCTTTGGGGG + Intronic
1167224816 19:48230747-48230769 GGGGTGAGCGGAGGCTGTGGGGG - Intronic
1167476853 19:49706267-49706289 CCAGGCAGCGGAGGCCCTGGAGG + Exonic
1167619239 19:50551921-50551943 GCAGGGAAGGGAGGCTGAGGAGG - Intronic
1168257776 19:55175974-55175996 GGAGGAAGGGGAAGCTTTGGAGG - Intronic
1168573990 19:57492863-57492885 GCATGGAGCCGAGGCTGAGGAGG + Exonic
1168692741 19:58386625-58386647 GAAGGGCGCGGAGGCTGTGGGGG + Intronic
925199752 2:1958009-1958031 GCAAGGAGGGGAAGCATTGGGGG - Intronic
925379880 2:3417328-3417350 GCAGGCAGCGGGGGCGGTGGGGG - Intronic
925736789 2:6970682-6970704 TCAGAGAGCAGAGGCTGTGGTGG + Intronic
925751716 2:7095465-7095487 GCAGGGAGAGGAGGCTGGGGGGG + Intergenic
927487299 2:23497344-23497366 GCAGGGAGCCGAGGGTTTCCTGG + Intronic
929133699 2:38602884-38602906 GCAGGGAGCGGAGACGGAGGAGG - Exonic
929761346 2:44810157-44810179 TAAGGGAGCAGAGGCTGTGGAGG - Intergenic
929910495 2:46085497-46085519 GCAAGGAGCGGAACCTCTGGAGG - Intronic
931066811 2:58596826-58596848 AGAAGGAGCAGAGGCTTTGGGGG + Intergenic
931462686 2:62462248-62462270 GCAGGGAGTGGAGGGTGGGGTGG - Intergenic
931467673 2:62505851-62505873 ACAGGGAGCTGAGGCGCTGGCGG - Intronic
931748382 2:65310099-65310121 GAAGGGAGAGGAGGACTTGGAGG - Intergenic
932569196 2:72929021-72929043 GCATGGAAAGGAGGATTTGGAGG + Intronic
932576742 2:72966564-72966586 GAAGAGGGCGGAGGCTCTGGGGG - Intronic
932849635 2:75171931-75171953 GAAGTGAGCGAAGACTTTGGGGG + Intronic
933627497 2:84618251-84618273 GCAGGAAGCCGAGACTTTGGTGG - Intronic
935332706 2:101988734-101988756 GGAGGGAGAGCAGGCTCTGGAGG + Intergenic
935363943 2:102270143-102270165 GCAGAGATGGGAGCCTTTGGAGG - Intergenic
935749548 2:106219292-106219314 GCAGGGAGAGGAGGCTAGGAGGG + Intergenic
936121750 2:109752025-109752047 GCAGGGAGAGGAGGCTAGGAGGG - Intergenic
936222945 2:110619447-110619469 GCAGGGAGAGGAGGCTAGGAGGG + Intergenic
936501467 2:113070164-113070186 ATAGGGAGGGGAAGCTTTGGGGG + Intronic
938583653 2:132669665-132669687 GCGGGGAGCGGCGGGTTTGCGGG - Intronic
938789861 2:134666937-134666959 GCAAGGAGTGAAGGCTTTGATGG - Intronic
940955758 2:159725667-159725689 GCAGGGAGAGGAAAATTTGGGGG - Intronic
941264881 2:163348685-163348707 GCAGGGAGGGGAGGCTAAGGTGG + Intergenic
941750315 2:169128769-169128791 GCAGGGAGCGAAGGTGATGGAGG + Exonic
941818798 2:169825023-169825045 GCAAGTAGCGCAGGCTTTGCAGG - Intergenic
942043901 2:172088053-172088075 GCAGGGTGGGGCGGCTCTGGAGG + Exonic
942683709 2:178508785-178508807 GCAGCCAGAGGAGGATTTGGGGG - Exonic
943399188 2:187383688-187383710 TAAGGAAGCAGAGGCTTTGGGGG - Intronic
944200207 2:197098893-197098915 GTTGGGAGCCCAGGCTTTGGTGG - Intronic
945276247 2:207990271-207990293 GTAGTGAGCTGAGACTTTGGAGG - Intronic
946375012 2:219302622-219302644 GAAGGGTGGGGAGGCTGTGGGGG + Exonic
946886497 2:224227534-224227556 CCTGGGAGAGGAGGCTCTGGAGG - Intergenic
947494925 2:230628105-230628127 GCAGGGAGAGGAGGAATTGGAGG - Intergenic
947601756 2:231455463-231455485 GGAGGCAGAGGCGGCTTTGGAGG - Exonic
948028789 2:234799849-234799871 GAAGGGAGAGCAGGCATTGGGGG - Intergenic
948455928 2:238104631-238104653 GCAGGGAAGGGAGGGTTTGGAGG - Intronic
948787195 2:240358862-240358884 GCAGGCAGCGGAGGCTTCTGAGG - Intergenic
948809546 2:240467589-240467611 GCAGGGGGAGGAGGACTTGGAGG + Exonic
948850679 2:240703931-240703953 CCAGGGAGCTGAGGGTTGGGTGG - Intergenic
948902128 2:240962118-240962140 GCAGGGAGGAGGGGCTGTGGAGG - Intronic
1169419553 20:5449022-5449044 GCAGAGGGAGGAGGCCTTGGTGG + Intergenic
1169784592 20:9346016-9346038 GCAGGGCTTGGAGGCTTTGCAGG - Intronic
1170542921 20:17407072-17407094 GCAGGGAGCGGAGGTTGGTGAGG - Intronic
1170671198 20:18435184-18435206 GCAGGGAGTGGAGGCTTTCCTGG + Intronic
1171180347 20:23086615-23086637 GGAGTGAGCAGGGGCTTTGGGGG + Intergenic
1171749830 20:29038190-29038212 GGAATGAGCTGAGGCTTTGGGGG - Intergenic
1171768962 20:29306947-29306969 GCGGGGAGTGGGGGGTTTGGGGG + Intergenic
1172369437 20:34376802-34376824 GCAGGGAGACTAGGCTATGGAGG + Intronic
1173430989 20:42987101-42987123 GCAGGGAGGGGTGGATGTGGGGG - Intronic
1174173495 20:48631001-48631023 GCAGGGAGGGGTGGCATTGGAGG - Intronic
1175129187 20:56776446-56776468 GCAGGGAGCAGTGGCGCTGGAGG - Intergenic
1176341113 21:5697024-5697046 CCAGTGAGCGGGGGCTTAGGGGG - Intergenic
1176473367 21:7129177-7129199 CCAGTGAGCGGGGGCTTAGGGGG - Intergenic
1176503714 21:7627432-7627454 CCAGTGAGCGGGGGCTTAGGGGG + Intergenic
1178701090 21:34834614-34834636 GCAGGGAGGGGAGGGGATGGGGG + Intronic
1178802535 21:35809493-35809515 GCAGGGAGAGTAGGCTAAGGAGG - Intronic
1179769855 21:43606393-43606415 GGAGGGAGGGGAGGCCATGGAGG + Intronic
1179901452 21:44396506-44396528 GAAGGGTGTGGAGGCTGTGGAGG + Intronic
1180288555 22:10775773-10775795 GCAGGGAGGGGATGGTTTTGGGG - Intergenic
1180631557 22:17233620-17233642 GCAGGGAGCAGAGGCTGAGAAGG - Intergenic
1181970254 22:26684403-26684425 GCCTGGGGCGGAGGCTGTGGAGG + Intergenic
1182336762 22:29588787-29588809 GCAGGGAGAGGAGGGGTGGGTGG - Intergenic
1182349732 22:29692579-29692601 GCAGGGAGCCCAGGCTGTGGGGG - Intronic
1182358517 22:29733648-29733670 GCAGGGAGCCCAGGCTTGGCTGG - Intronic
1182423087 22:30257927-30257949 GCAGGGAGTGGTGGCCTGGGAGG - Intergenic
1184196586 22:42933676-42933698 GCAGGGTGCGGGGGCTGTGAGGG - Intronic
1184391834 22:44207381-44207403 GCGGGGAGGGGAGGGTTTGTGGG + Exonic
1185081976 22:48714480-48714502 GCAGGGAGCTGAGGCCCAGGTGG - Intronic
1185267925 22:49914352-49914374 CCTGGGAGCGGGGGCTTTGCTGG - Intronic
1203240379 22_KI270733v1_random:11482-11504 CCAGTGAGCGGGGGCTTAGGGGG - Intergenic
950124678 3:10504245-10504267 GCTTGGAGCGCAGGCCTTGGGGG - Intronic
950610868 3:14125737-14125759 GCTGGGAGCGAAGGAGTTGGGGG + Intronic
950610892 3:14125841-14125863 GCAGGGAGAAGAGGCCTTGAGGG - Intronic
953694333 3:45146098-45146120 GCAGGGTGCGGAGGGTGCGGAGG - Intronic
954363815 3:50135934-50135956 GCATGGAGCTGAGGCTTTCAGGG + Intergenic
954797831 3:53170488-53170510 GCAGGGCCCTGAGGCTATGGTGG - Intronic
955924905 3:63995234-63995256 GCAGGGAACGGGGGCGTTGGGGG + Intronic
963147458 3:142008978-142009000 GCATAGAGCAGAGGCTTTGGAGG - Intronic
964465640 3:156988646-156988668 GCTGGGTGCAGAGGCATTGGTGG - Intronic
967340626 3:188393354-188393376 GGAAGTAGAGGAGGCTTTGGGGG - Intronic
968487769 4:872200-872222 GCAGGGAGAGGATGTTTTAGAGG - Intronic
970823911 4:20251851-20251873 TCAGGGGGCGGAGGCTCGGGCGG + Intergenic
971029426 4:22620864-22620886 GCAGGGTGAGGAGACTGTGGTGG + Intergenic
972565478 4:40265361-40265383 GCAGGGTGATGAGGCTTTGCTGG - Intergenic
973952020 4:56025458-56025480 GCAGGAAGGGCAGGCTGTGGGGG + Intronic
974149574 4:57989544-57989566 GCAGGGAGCGATGGCTATTGTGG - Intergenic
975510845 4:75192778-75192800 GCATGTAGGGGAGGCTGTGGAGG - Intergenic
979024786 4:115555398-115555420 GCAGGGTGTGGAGGATTTGCAGG - Intergenic
979466207 4:121041402-121041424 GCTGGGGTCGGAGGCTCTGGTGG - Intronic
982068049 4:151672005-151672027 GCAGGAAGACGAGGCTGTGGAGG + Intronic
982110029 4:152045602-152045624 CCAGGGAGCGGAAGCTACGGAGG - Intergenic
982619393 4:157684500-157684522 ACAGGTAGCGGAGGTGTTGGGGG - Intergenic
983074622 4:163310855-163310877 GGAAGGAGCGGAGGGTGTGGAGG - Intergenic
985295399 4:188432163-188432185 GGAGGAAGCGGAGGCTAGGGAGG + Intergenic
987035126 5:14011719-14011741 GCAGGGCGCGGCGGCTGCGGCGG - Intergenic
987132809 5:14873939-14873961 TCAGGCAGCGGGGGCTGTGGCGG - Intergenic
990376256 5:55173446-55173468 GCAGGAGGCGGAGGGGTTGGCGG + Intergenic
993836105 5:92822257-92822279 GCAGGCAGCGGGGGGTGTGGTGG + Intergenic
995042925 5:107609612-107609634 GCAGGGTGAGGCGACTTTGGTGG - Intronic
996511949 5:124326375-124326397 GAAGGGAGAGGAGGCTGGGGAGG + Intergenic
997443494 5:133925320-133925342 GCAGAGAGGAGAGGATTTGGAGG - Intergenic
997606145 5:135177001-135177023 GCAGGGAATGGAGGGTATGGGGG + Intronic
997612474 5:135224776-135224798 GCAGAGAGGAGAGGATTTGGTGG + Intronic
997642540 5:135458809-135458831 CCAGGGAGTGGCGGCTTTGGTGG + Intergenic
998849827 5:146342028-146342050 CCAGTGAGCAGAGGCATTGGAGG - Intergenic
1000726152 5:164773319-164773341 GCAGAGAGAGGAGGCTTTCAGGG + Intergenic
1001084178 5:168688317-168688339 GCAGGGAGGTGAGGGTTGGGGGG + Intronic
1001588477 5:172849574-172849596 TGAGGAAGCTGAGGCTTTGGGGG + Intronic
1001643959 5:173266118-173266140 GCAGGGAGCAAAGGGCTTGGGGG + Intergenic
1002715495 5:181224209-181224231 GGAGGAAGTGGAGGCTGTGGGGG + Exonic
1002818829 6:703450-703472 TCACGGAGCAGAGGCTTTTGGGG - Intergenic
1002870884 6:1166429-1166451 GCAGGGAGAGGAGGCTTTGGTGG + Intergenic
1002905411 6:1445059-1445081 GCAGGGAGAGGGAGTTTTGGGGG - Intergenic
1003273374 6:4626520-4626542 GCCGGGAGTGGAGGCTGAGGTGG - Intergenic
1006179879 6:32148447-32148469 GCGGGGAGCGGGGACTTGGGAGG + Exonic
1006187195 6:32188234-32188256 GTAAGGAGAGGAGGCTTGGGTGG - Intronic
1006524141 6:34589334-34589356 GCAGGGAGGCGGGGCTGTGGAGG + Exonic
1006813301 6:36834868-36834890 GCAGGGAGAGGGTGGTTTGGGGG - Intronic
1007241984 6:40432798-40432820 GCAGGGAGCGGAGGCTCTCGAGG + Exonic
1008632985 6:53381733-53381755 GCAGGGGGAGGTCGCTTTGGTGG - Intergenic
1011842291 6:91516735-91516757 GCACAGAGAGGAGGCTTTGTAGG - Intergenic
1013356531 6:109350256-109350278 GCAGGGAGAGGAGGGGTTTGAGG + Intergenic
1013426212 6:110015385-110015407 GCAGGCGGGGGAGGCTTTGTTGG - Intergenic
1015630904 6:135230929-135230951 GCAGGGAGAGGAGGAGTTGCAGG + Intergenic
1015699928 6:136024583-136024605 GAAGGGAGCAGATACTTTGGAGG + Intronic
1018058643 6:160072708-160072730 CCAGGGAGCTGAGACTTGGGAGG - Intronic
1018773468 6:166992805-166992827 GCAGGCAGAGCAGGCTCTGGTGG + Intergenic
1019164839 6:170091274-170091296 GCAGTGTATGGAGGCTTTGGAGG + Intergenic
1019187384 6:170228753-170228775 GGAGGGAGCTGAGGGTCTGGGGG - Intergenic
1019219713 6:170463941-170463963 GCAAGGAGAGGAGGCTTCTGGGG + Intergenic
1019499058 7:1355382-1355404 GGAGGGAGAAGAGGGTTTGGAGG - Intergenic
1019501126 7:1365231-1365253 GAAGGGAGCAGAGGCTTGGCAGG - Intergenic
1019864817 7:3698099-3698121 GGAGGAAGGGGAGGGTTTGGGGG - Intronic
1021916218 7:25435310-25435332 GGTGGGAGAGGGGGCTTTGGGGG - Intergenic
1022861608 7:34373179-34373201 ACAGGAAGGGGAGGATTTGGGGG + Intergenic
1022955545 7:35376902-35376924 GCAGGCAGCAGTGGCCTTGGAGG + Intergenic
1023888366 7:44376283-44376305 GTTGGGGGTGGAGGCTTTGGGGG - Intergenic
1023926318 7:44672443-44672465 GCAGTTAGAGGAGGCTTTGGGGG + Intronic
1023955763 7:44885485-44885507 GCGGGGCGCGGAGGCGATGGGGG - Intergenic
1024968776 7:55049960-55049982 GCAGGGAGATGAGGCTCTGAGGG - Intronic
1026864579 7:73815530-73815552 GCAGGGAATTGTGGCTTTGGTGG + Intronic
1030058869 7:105607309-105607331 GCAGGGAGAGGGGGCTTTGCTGG - Exonic
1030293038 7:107891168-107891190 GCAGGGAGGGGAGACCTTGGCGG + Exonic
1031145077 7:117988710-117988732 GGAGGGAGAACAGGCTTTGGTGG + Intergenic
1032383233 7:131504803-131504825 GCCTGGAGAGGAGGTTTTGGGGG - Intronic
1035642343 8:1193772-1193794 GCATGGTGCGGAGGCTCTAGAGG - Intergenic
1035754905 8:2023788-2023810 CCGGGGAGAGGAGGCTCTGGGGG + Intergenic
1036663061 8:10720887-10720909 GCAGGGGGCGGGGGCGTTGGGGG - Intergenic
1036742505 8:11377181-11377203 GCGGGGAGAGGAGGTTTTGTGGG - Intergenic
1036812986 8:11880306-11880328 GGAGGGAGAACAGGCTTTGGGGG + Intergenic
1037571766 8:20164145-20164167 GCAGGGAGGAGAGGCTTACGGGG - Intronic
1037952863 8:23030040-23030062 GCAAGGAGAGGAGCCCTTGGGGG + Intronic
1038163574 8:25063451-25063473 GCATGGAGGCGAGGCTTTGCAGG - Intergenic
1038415110 8:27389461-27389483 GCAGGGATCAAAGGCTTTGAGGG + Intronic
1039554954 8:38468684-38468706 GCAGGGGGCGGAGGCGGAGGAGG - Intronic
1039723918 8:40194647-40194669 GAAGGGAGGGGAGGGGTTGGAGG - Intergenic
1040338040 8:46426127-46426149 GCAGCCAGCAGAGGCTTAGGAGG + Intergenic
1041040087 8:53838043-53838065 GCAGGGAGCTGAGGCCTGGGAGG - Intronic
1043021220 8:75002567-75002589 GCAGGGTGCCCAGGCTTTTGTGG + Intronic
1043484512 8:80685814-80685836 GCAGGGAGGGAAGGCATTGTTGG + Intronic
1043970967 8:86527737-86527759 GGAGGGAAAGGGGGCTTTGGGGG + Intronic
1045642017 8:104261508-104261530 ACAGGGAGCCCAGCCTTTGGAGG - Intergenic
1045953693 8:107882256-107882278 GCAGGGAGTAGAGCATTTGGAGG + Intergenic
1048179255 8:132180237-132180259 GCAGGAAGCGCAGGCTTCGCAGG + Exonic
1048209731 8:132444742-132444764 GCAGAGAGCGTGGGATTTGGTGG + Intronic
1049004823 8:139847909-139847931 GCAGGGAGCGGAGGCTTTGGTGG - Intronic
1049272622 8:141703974-141703996 GGAGGGAGTGGGGGCTCTGGGGG - Intergenic
1049276543 8:141722900-141722922 CCAGGGAGCAGAGGCCGTGGAGG + Intergenic
1049830757 8:144699590-144699612 GCACGGAGGGGAGGCTGTGTGGG + Intergenic
1050271429 9:3950028-3950050 GCAGGCAGTGAAGGCTCTGGGGG - Intronic
1050287465 9:4118126-4118148 GGAGGGAGCGGAGGCGCGGGGGG + Exonic
1056855060 9:90120194-90120216 GCAGTTAGGGGAAGCTTTGGAGG - Intergenic
1056940343 9:90950089-90950111 GCAGGGATCAGAGACTGTGGTGG - Intergenic
1057955149 9:99401392-99401414 GAAGGGAGGGGTGGTTTTGGAGG - Intergenic
1058671577 9:107364860-107364882 GCAAGGACCAGAGGCCTTGGAGG + Intergenic
1058687266 9:107489705-107489727 GCGGGGAGCAGAGGCGGTGGCGG - Intronic
1058967379 9:110049802-110049824 GCAGGGAGCTGTGGCGCTGGTGG + Intronic
1059338151 9:113581941-113581963 CAAGGGAGGGGAGGCCTTGGAGG - Intronic
1059345493 9:113625336-113625358 GGAGGGAGAAGAGACTTTGGAGG - Intergenic
1059346504 9:113632569-113632591 GCAGGGGGAGGAGGCGTGGGAGG + Intergenic
1060198549 9:121638711-121638733 GGAGGCAGCGGAGGATTTGGGGG + Intronic
1060598607 9:124862920-124862942 CCGGGAAGCGGAGGTTTTGGTGG - Intronic
1061211901 9:129198462-129198484 GCAGGGGACGGAAGCTTCGGTGG + Intergenic
1061493082 9:130956977-130956999 GAAGGGGGCTGAGGCTCTGGGGG - Intergenic
1061550523 9:131331922-131331944 GCAGGGAGCACAGCCTTGGGCGG + Intergenic
1061595950 9:131629123-131629145 CCAGGCAGAGGAGGCTTGGGGGG + Exonic
1061865044 9:133487817-133487839 GAAGCGAGCGGTGGCTTTAGAGG + Intergenic
1061914291 9:133741204-133741226 GGAAGAAGCGGAGGCGTTGGGGG + Intergenic
1061964981 9:134008332-134008354 GCTGGGTGCGGTGGCTTGGGAGG - Intergenic
1062358550 9:136176704-136176726 GCAGGGGGCTGCGGCTTTGCTGG + Intergenic
1062492449 9:136812885-136812907 GGAGGTAGAGGAAGCTTTGGAGG - Intronic
1062560883 9:137141407-137141429 GAAGGGAAGGGAGGCATTGGGGG - Intronic
1203421954 Un_GL000195v1:969-991 CCAGTGAGCGGGGGCTTAGGGGG + Intergenic
1186410703 X:9342558-9342580 GCAGGGAGAGGAGGCTAGGAGGG - Intergenic
1189297489 X:39929244-39929266 GCAGGGTGCAGAGGCATGGGCGG + Intergenic
1190984650 X:55489694-55489716 AAAGGGAGCGGAGACTTCGGGGG - Intergenic
1198020103 X:132649230-132649252 TCTGGGAGTGGAGGCTTTGGTGG + Intronic
1199733926 X:150666755-150666777 GCAGGAGGAGGAGGTTTTGGGGG - Intronic
1202258980 Y:22949749-22949771 GAAGGGAGTGGAGGCTTGGAAGG - Intergenic
1202411967 Y:24583506-24583528 GAAGGGAGTGGAGGCTTGGAAGG - Intergenic
1202458814 Y:25086566-25086588 GAAGGGAGTGGAGGCTTGGAAGG + Intergenic