ID: 1049004824

View in Genome Browser
Species Human (GRCh38)
Location 8:139847912-139847934
Sequence GCGGCAGGGAGCGGAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 362}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049004824_1049004840 27 Left 1049004824 8:139847912-139847934 CCAAAGCCTCCGCTCCCTGCCGC 0: 1
1: 0
2: 3
3: 25
4: 362
Right 1049004840 8:139847962-139847984 GCCCTGGGGCACGTGGGGCCTGG No data
1049004824_1049004838 21 Left 1049004824 8:139847912-139847934 CCAAAGCCTCCGCTCCCTGCCGC 0: 1
1: 0
2: 3
3: 25
4: 362
Right 1049004838 8:139847956-139847978 GCAGCAGCCCTGGGGCACGTGGG No data
1049004824_1049004839 22 Left 1049004824 8:139847912-139847934 CCAAAGCCTCCGCTCCCTGCCGC 0: 1
1: 0
2: 3
3: 25
4: 362
Right 1049004839 8:139847957-139847979 CAGCAGCCCTGGGGCACGTGGGG No data
1049004824_1049004836 13 Left 1049004824 8:139847912-139847934 CCAAAGCCTCCGCTCCCTGCCGC 0: 1
1: 0
2: 3
3: 25
4: 362
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004824_1049004837 20 Left 1049004824 8:139847912-139847934 CCAAAGCCTCCGCTCCCTGCCGC 0: 1
1: 0
2: 3
3: 25
4: 362
Right 1049004837 8:139847955-139847977 AGCAGCAGCCCTGGGGCACGTGG No data
1049004824_1049004833 11 Left 1049004824 8:139847912-139847934 CCAAAGCCTCCGCTCCCTGCCGC 0: 1
1: 0
2: 3
3: 25
4: 362
Right 1049004833 8:139847946-139847968 CCCTGTGTCAGCAGCAGCCCTGG No data
1049004824_1049004835 12 Left 1049004824 8:139847912-139847934 CCAAAGCCTCCGCTCCCTGCCGC 0: 1
1: 0
2: 3
3: 25
4: 362
Right 1049004835 8:139847947-139847969 CCTGTGTCAGCAGCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049004824 Original CRISPR GCGGCAGGGAGCGGAGGCTT TGG (reversed) Intronic
900100954 1:961820-961842 GCGGCTGGGAGCAGAGTCTACGG - Exonic
900123229 1:1058467-1058489 TCAGCAGGAAGCGGAGGCGTAGG + Intergenic
900187277 1:1338252-1338274 GCAGCAGTGAGTGGGGGCTTCGG - Exonic
900284787 1:1893940-1893962 GTAGCAGGGAGAGGAGGCTGAGG + Intergenic
900307720 1:2019262-2019284 GCTGCAGGGAGCGGCGGGCTGGG + Intergenic
900638370 1:3676448-3676470 GGGACAGGGAGGGGATGCTTGGG + Intronic
901936433 1:12630262-12630284 GCAGCAGGGAGGCGAGGCTGGGG + Intergenic
902963935 1:19984585-19984607 GCGGCGGAGAGGGGAGGCTCAGG + Intergenic
903349570 1:22710104-22710126 GGGGCAGGGAGGGGAGGCCTGGG + Intergenic
903462768 1:23530880-23530902 GCGGCATGGCGCGGAGGCCGGGG + Exonic
904475288 1:30760932-30760954 GCAGGAGGAAGCGGAGGCTCAGG - Intergenic
904916306 1:33973053-33973075 GTGGCTGGGAGCTGAGTCTTGGG - Intronic
906225623 1:44119038-44119060 GCGGCGGGGAGGGGAGGCCTTGG + Intronic
906473367 1:46149810-46149832 TTGGCCGGGTGCGGAGGCTTAGG - Intronic
907246759 1:53113914-53113936 GAGGCAGGGAGGGCAGGCCTGGG - Intronic
908977806 1:69919896-69919918 GTGGCAGGGAGTGGGGGGTTCGG - Intronic
910219057 1:84871906-84871928 GCAGCAGCGGGTGGAGGCTTGGG - Intronic
912822992 1:112882432-112882454 GTGGCAGGGAGCCCAGGCTTAGG + Intergenic
913089630 1:115467887-115467909 GGGGCAGGGAAAGGAGGCTTTGG - Intergenic
914724142 1:150313315-150313337 GAGGCAGGGGGCGGAGGTTGCGG - Intergenic
914803225 1:150974950-150974972 GGGGCCGGGAGCGGAGGGTTGGG - Exonic
915549865 1:156625551-156625573 GCGGCGGGGAGGGGAGGCGGGGG + Exonic
918142679 1:181732380-181732402 GCAGGAGGGAGCGGAGGCGCCGG + Exonic
919639841 1:200036953-200036975 GCGGGAGGGAACGGTGGCTGGGG - Intronic
919978937 1:202630472-202630494 GCAGCAGGGAGCCAAGGTTTAGG + Intronic
920002191 1:202807822-202807844 GCGGCCGGGTGCGGAGGTTCGGG - Intronic
920029859 1:203030352-203030374 GCTGCTGGGAGTGGAGGCCTGGG + Intronic
920508024 1:206530776-206530798 GCTGCAGGGAGCTGAGCCCTGGG + Intronic
921016885 1:211200152-211200174 GCGGCTGGGCGCGGTGGCTCAGG - Intergenic
922463283 1:225828993-225829015 GCGGGAGGGGACGGGGGCTTGGG + Intronic
922468735 1:225862416-225862438 CCGGCTGGGAGCAGAGGCATTGG - Intronic
922808925 1:228405469-228405491 GCGGGAGGGAGCGCAGGCCAGGG + Intronic
923512734 1:234666468-234666490 GCAGCAGGGAGCTGAGGCAGGGG + Intergenic
924659441 1:246002894-246002916 GTGGCCGGGCGCGGAGGCTCAGG - Intronic
1062997512 10:1880881-1880903 GAGGTAGGGAGCAGAGGCTGGGG + Intergenic
1064026134 10:11850213-11850235 GTGGCAGGGAGGGGAGGAGTCGG + Intronic
1068472210 10:57479808-57479830 GCGGCCGGGCGCGGTGGCTCAGG + Intergenic
1069856217 10:71442653-71442675 GAGGCAGGAAGCGAAGGCCTGGG + Intronic
1070963887 10:80517831-80517853 AGGGCAGGGAGCGGAGGGTGGGG - Intronic
1073353336 10:102835182-102835204 GCTGGAGGGAGAGGAGGGTTGGG - Intronic
1075144647 10:119872749-119872771 GCCTCAGGGAGCGGCGGCTGCGG + Exonic
1076187038 10:128458210-128458232 TAGGCAGGGAGGGGAGGCTCAGG + Intergenic
1076463000 10:130659118-130659140 GCGACTGGGAGGGGAGGCCTAGG + Intergenic
1076814567 10:132908408-132908430 CGGGCAGGGAGCGCAGGCCTGGG - Intronic
1077341089 11:2026680-2026702 GGGGCCGGGAGCAGAGGCTTGGG - Intergenic
1077476139 11:2791526-2791548 CCGGGAGGGAGGGGAGGCTCGGG - Intronic
1080802006 11:35618326-35618348 GGGGCGGGGAGCGGAGGCGGAGG + Intergenic
1081597135 11:44467154-44467176 GGGGCAGGGAGGGGAGGGATAGG + Intergenic
1081700027 11:45146969-45146991 GGGGCCGGGAGCGGCGGCTGGGG + Intronic
1082278656 11:50247003-50247025 GCGGCTGGGAGGGGAGGGGTGGG + Intergenic
1083630006 11:64090575-64090597 GAGGCAGGAAGTGGAGGCTGTGG + Intronic
1084066579 11:66707827-66707849 GGGGCAGGGAGAGGAGGTGTGGG + Intronic
1084151383 11:67289383-67289405 GCGGCTCGGAGGGGAGGCTAGGG + Exonic
1084612535 11:70212684-70212706 GGGGCGGGGAGCAGAGGCTCAGG - Intergenic
1084968477 11:72756579-72756601 GGGGCGAGGAGGGGAGGCTTCGG + Intronic
1085327245 11:75615956-75615978 GCGGCAGGGGGCGGGGGGTGGGG + Intronic
1085410785 11:76289157-76289179 GAGGCAGGAAGGGGAGGCTATGG + Intergenic
1087006724 11:93478962-93478984 TCGGCAGGGAGAGGAGGCGCGGG - Exonic
1088704415 11:112448427-112448449 GCAGCAGGGAGGGGCGGCTGGGG - Intergenic
1090021960 11:123136448-123136470 GCGCCAGGGAGAGGAGGGTGGGG - Intronic
1090508480 11:127345610-127345632 GCTGCAGCGAGAGGTGGCTTGGG + Intergenic
1091269231 11:134293900-134293922 GGGGCTGGGAGCGGAGGCAGAGG - Intronic
1202824074 11_KI270721v1_random:81869-81891 GGGGCCGGGAGCAGAGGCTTGGG - Intergenic
1091558681 12:1594450-1594472 GCGGCAGGAGGCGGAGGATGCGG - Intronic
1091792917 12:3281677-3281699 GCTGCAGGGAGCGCATGCTTGGG + Intronic
1096560743 12:52434162-52434184 GCAGCAGGGAGTGGGGGCCTGGG - Exonic
1101122548 12:101598079-101598101 GCTGCAGTGAGCGGAGACTGTGG - Intronic
1101997930 12:109538424-109538446 GGGGCAGGAAGTGGAGGGTTGGG - Intergenic
1102904043 12:116660951-116660973 ACGGCCGGGAGGGGAGGCTCAGG - Intergenic
1103331203 12:120155276-120155298 GCGGCAGGCGGCGGAGGTTATGG - Exonic
1104833572 12:131771940-131771962 GTGGCCGGGAGCGGTGGCTCAGG - Intronic
1106207466 13:27613269-27613291 GCAGCAGGGAGGGGAGGGTGAGG + Intronic
1107448698 13:40489721-40489743 GTGGCAGGGAGAGGAGACGTGGG - Intergenic
1107945847 13:45417290-45417312 ACGGCTGGGAGCGGTGGCTCAGG - Intronic
1110390691 13:74970159-74970181 GCCTCAGGGAGGGGAAGCTTTGG + Intergenic
1111940483 13:94601886-94601908 GCGGCTGGGAGCCGAGGCGTCGG + Exonic
1112225110 13:97532029-97532051 GTGGCAGGGGAGGGAGGCTTTGG + Intergenic
1113634130 13:111908498-111908520 GGGGCAGGGAAGGCAGGCTTAGG - Intergenic
1113902950 13:113806676-113806698 GGGGCAGGGGCAGGAGGCTTGGG - Intronic
1118019580 14:61696244-61696266 GCGGGAAGGAGCGGAAGCTCCGG - Intronic
1118836322 14:69480465-69480487 GGGGCAGGGAGCTGAGGAGTTGG + Intergenic
1119476922 14:74935604-74935626 GGGGCAGTGAGCACAGGCTTCGG + Intergenic
1121218710 14:92268712-92268734 GCGGCCGGGCGCGGTGGCTGAGG - Intergenic
1121960141 14:98252063-98252085 GCGGGAGGGAGCTGAGGATGTGG + Intergenic
1122210897 14:100173446-100173468 GAGGCAGGGTGAGCAGGCTTGGG - Intergenic
1124494534 15:30178360-30178382 GCAGCAGGGAGCCAAGGTTTAGG + Intergenic
1124749036 15:32360285-32360307 GCAGCAGGGAGCCAAGGTTTAGG - Intergenic
1125174838 15:36808848-36808870 GAGACAGTGAACGGAGGCTTAGG - Exonic
1125200713 15:37098856-37098878 GGGGCAGGGAGCGGAGGGTGGGG + Intronic
1125429531 15:39581187-39581209 GCGGCCGGGAGCGGTGGCGAGGG - Exonic
1127287806 15:57546102-57546124 GCGGCAGGTGGAGGAGGCTGAGG + Exonic
1128019350 15:64376758-64376780 GAGGCAGGAAGCAGTGGCTTAGG - Exonic
1128061978 15:64741019-64741041 GCGGCCGTGAGCAGAGGCGTGGG + Intronic
1128344385 15:66844309-66844331 GAGGCAGGGAGGGGAAGCCTGGG - Intergenic
1128760257 15:70212014-70212036 GCAGCAGGGAGCGCAGGACTGGG - Intergenic
1128859232 15:71051680-71051702 GCAGCAGGGATGGGAGGGTTAGG - Intronic
1128866140 15:71116102-71116124 GCGGGAGGGAGGCGAGGCTGAGG - Intronic
1129220399 15:74128844-74128866 GGGGCGGGGAGCGGCGTCTTGGG - Intronic
1130213154 15:81944792-81944814 GAGGCTGGGAGCGGTGGCTCAGG - Intergenic
1131110452 15:89761482-89761504 CAGGCAGGAAGTGGAGGCTTTGG + Intronic
1131456431 15:92585879-92585901 GCAGGAGGGAGCAGAGGCCTCGG + Intergenic
1131472804 15:92711152-92711174 ACCGCAGGGAGGGGAGGCTCAGG + Intronic
1132191734 15:99867976-99867998 GAGGGTGGGAGTGGAGGCTTTGG + Intergenic
1132682029 16:1146361-1146383 GGGGCAGGGAGCTGAGTCTGGGG - Intergenic
1133109097 16:3535044-3535066 GGGGCAGGCAGAGGAGGCTGAGG + Intronic
1133908061 16:10039592-10039614 GCGGGAGGGACCGGTGGCGTTGG + Intronic
1134588625 16:15434430-15434452 GAGGCTTGGAGGGGAGGCTTGGG - Exonic
1136005698 16:27327299-27327321 GGGGCAGGGGGCGGAGGACTGGG - Intronic
1136039158 16:27564361-27564383 GCGGCTGAGAGGGGAGGCTCTGG - Intronic
1136403598 16:30031047-30031069 GCGGCAGCGAGAGGAGGCAGTGG - Exonic
1136529873 16:30860893-30860915 GGGTCAGGGAGCGGAGGCTGAGG - Intronic
1136533924 16:30888062-30888084 GGGGAGGGGAGTGGAGGCTTTGG - Intronic
1136585361 16:31180795-31180817 GCGGCTGGGGGCGGAGGCTCGGG + Intronic
1137231440 16:46570744-46570766 TCGGCAGGGCACGGTGGCTTAGG - Intergenic
1137426314 16:48384657-48384679 GGGGCAGAGAGCGGAGGCCGAGG + Intronic
1138556066 16:57771917-57771939 GCAGCAGGGAGAGCAGGCTCTGG - Intronic
1139304643 16:65974534-65974556 GGGGCATGGAAAGGAGGCTTTGG - Intergenic
1139359369 16:66388054-66388076 GAGGGAGGGGGCGGAGGGTTGGG - Intronic
1139383793 16:66550905-66550927 GCGGCTGGGCGCGGTGGCTCGGG + Intronic
1139636894 16:68263639-68263661 GTGGCAGGGAGCAGGGTCTTGGG + Intergenic
1141382412 16:83588212-83588234 GTGGCAGGGTGATGAGGCTTTGG - Intronic
1141658496 16:85429062-85429084 GATGCAGCGTGCGGAGGCTTCGG - Intergenic
1141690457 16:85593587-85593609 CCGGGAGGGAGGGGAGGCTAAGG - Intergenic
1141705237 16:85661222-85661244 GCAGCATGGAGCTGGGGCTTGGG - Exonic
1142331730 16:89458799-89458821 GCAGCAGGAAGCTGAGGCCTAGG - Intronic
1142672057 17:1491860-1491882 GCGGCGGGGAGCCGGGTCTTCGG - Intronic
1143241669 17:5448115-5448137 GTTGCAGTGAGCGGAGGCTGTGG + Intronic
1143578169 17:7807345-7807367 GCGGTAGGGAGGGCAGGCCTGGG + Intronic
1143579866 17:7819146-7819168 GTGGCAGGGAGCAGGGGCTCAGG - Intronic
1143591415 17:7887672-7887694 GCGGGCGGGAGGCGAGGCTTCGG + Intronic
1144503176 17:15807252-15807274 GCTGCAGAGAGCTGAGTCTTGGG + Intergenic
1144657327 17:17045101-17045123 GCAGCAGGAAGCAGGGGCTTGGG - Intronic
1144950828 17:18992550-18992572 GAGGCAGGGAGCACAGGCGTGGG + Intronic
1145165357 17:20609967-20609989 GCTGCAGAGAGCTGAGTCTTGGG + Intergenic
1145258577 17:21341426-21341448 GAGGCAGGTGGCTGAGGCTTGGG + Intergenic
1145318048 17:21746579-21746601 GAGGCAGGTGGCTGAGGCTTGGG - Intergenic
1146229461 17:31095226-31095248 AGGGCGGGGAGCGGAGGCTGAGG - Exonic
1146278625 17:31530970-31530992 GTGGCAGGAAGGGTAGGCTTTGG - Intronic
1146771076 17:35569121-35569143 AAGGCCGGGAGCGGTGGCTTTGG - Intergenic
1146884118 17:36459543-36459565 TAGGGAGGGAGCTGAGGCTTGGG - Intergenic
1147015791 17:37490192-37490214 GCGGCAGGGGGCGCACGCTCAGG - Intronic
1147918485 17:43902257-43902279 GGGACAGGGAGTGGAGCCTTGGG - Intronic
1149376320 17:56047656-56047678 GGGGCAGGGAGGGGAAGCGTGGG - Intergenic
1150290813 17:63980522-63980544 TGGGCAGGGAGCCGAGGCTGAGG + Intergenic
1150293321 17:63993854-63993876 GGGGCTGGGAGGGGAGGCTCTGG + Intergenic
1151318468 17:73338251-73338273 GAGAGAGGGAGCGGAGGCTAAGG - Exonic
1151933341 17:77247012-77247034 GCGGCCGGGAGCGGGGGCAGGGG + Intergenic
1152141990 17:78541902-78541924 GTGGCAGGGAGGGGAGGGATGGG + Intronic
1152595172 17:81234334-81234356 GGGGCAGGGAGAGTGGGCTTCGG - Intronic
1152795614 17:82304668-82304690 GGGGCAAGGAGCGGAGGGGTGGG - Intergenic
1152830808 17:82496056-82496078 ACGGGAGGGAGGGGAGGCTGAGG + Intergenic
1152924343 17:83080387-83080409 GCGGGAGGGAGCGGCGGTTTCGG + Intronic
1152932262 17:83115919-83115941 GCTGCAGGGAGAGGAAGCTCAGG - Intergenic
1154494582 18:14946129-14946151 GGGGCAAGGAGCGGAGCCTCAGG - Intergenic
1156920895 18:42521597-42521619 GGGGCAGGGAGCGGAGGGGAGGG - Intergenic
1157473604 18:48007990-48008012 GGGCTAGGGAGCGGAAGCTTCGG - Intergenic
1159910106 18:74138027-74138049 GAGGCAGGAACCGGAGGCTGAGG - Intronic
1160557654 18:79736452-79736474 CCCGCAGGGAGCGGACGCTCGGG + Exonic
1160843106 19:1155168-1155190 GCGGCAGGAAGGGGAGGCGGCGG + Intronic
1161140497 19:2644651-2644673 GAGGCAGGGAGGGGATGCGTGGG - Intronic
1161161085 19:2762210-2762232 GAGGCCGGGTGAGGAGGCTTCGG - Intronic
1161611183 19:5243889-5243911 GCAGCAGGGAGGTGAGGCGTGGG - Exonic
1161821655 19:6533824-6533846 ATGGCAGGGAGGGGAGTCTTAGG - Intronic
1162032630 19:7924035-7924057 TGGGCAGGGGGAGGAGGCTTAGG + Intergenic
1162094853 19:8304211-8304233 GTTGCAGGGGGCGGAGCCTTAGG - Intronic
1162301918 19:9849280-9849302 GTGGCAGGGAGTGGGGGGTTCGG - Exonic
1162788976 19:13053461-13053483 GCGGAAGGGAGGGAAGGCCTTGG - Intronic
1163501620 19:17679842-17679864 GCAGGAAGGAGCTGAGGCTTAGG - Intronic
1164147065 19:22518576-22518598 GGGCCAGGGAGCTGAGGCTGAGG + Intronic
1164159571 19:22617752-22617774 GGGCCAGGGAGCTGAGGCTGAGG - Intergenic
1164411441 19:28009198-28009220 GAGGCTGGGAGAGGAGGCTGAGG + Intergenic
1164434831 19:28220097-28220119 GAGGCTGGGAGCGGATGCTGTGG + Intergenic
1164562206 19:29300100-29300122 CCGCCAAGGAGTGGAGGCTTTGG - Intergenic
1164947899 19:32311635-32311657 GCAGCATGCAGAGGAGGCTTGGG + Intergenic
1165080504 19:33303488-33303510 GGGGGAGGAAGCGGTGGCTTCGG - Intergenic
1165242940 19:34481924-34481946 GCGGCGGGAAGCGGAGGCGGAGG + Exonic
1165340141 19:35205519-35205541 GGGGCAGGGAATGGAGGCTGTGG + Intergenic
1166013433 19:39961070-39961092 GTGGCAGGGAGTGGGGGATTGGG - Intergenic
1166046209 19:40232562-40232584 GCTACAGGGAGGGGAGGCGTGGG + Exonic
1166720403 19:44992956-44992978 GCGACAGGGAGGGGAGGCGAGGG - Exonic
1166802852 19:45468914-45468936 GCGGCAGGGAGGGTAGGCTTTGG + Intronic
1166837563 19:45676944-45676966 GCGGCAGGCAGCGAGGGCCTAGG - Exonic
1167290817 19:48624451-48624473 GGGGCAGGGACCGGAGTCTAGGG + Intronic
1167368338 19:49066050-49066072 GCGGAGGGGAGCGGAGTCTCAGG - Intergenic
1167571393 19:50291065-50291087 GCTGCAGGGAGGGGAGGCTTTGG + Intronic
1168315556 19:55483384-55483406 GCGGGAGGGGGCGGAGGTGTAGG - Exonic
925751713 2:7095462-7095484 GCTGCAGGGAGAGGAGGCTGGGG + Intergenic
925915814 2:8604971-8604993 GAGGCAGGGTGCGGTGGCTCAGG - Intergenic
926058551 2:9790850-9790872 GGTGCAGGGAGCGGGGGCTACGG - Intergenic
928124584 2:28606778-28606800 GCAGCAGGGAGAGGAGGCCTGGG + Intronic
929623998 2:43387650-43387672 GAGGCAGGGGGCGGAGGCGGGGG - Intronic
929714575 2:44297314-44297336 GAGGCAGGTAGCTGAGGCTCAGG + Intronic
930096435 2:47570277-47570299 GCGGCAGGCGGCGGCGGCTACGG + Exonic
931614610 2:64143918-64143940 GCGGCGGGGAGCGGAGTTTGCGG - Intronic
932343088 2:70978894-70978916 GCGGGCGGGGGCGGAGGCTGCGG + Intronic
932565770 2:72907594-72907616 TCGGCCGGGCGCGGTGGCTTTGG - Intergenic
934554370 2:95279574-95279596 GCGGCCGGGCGCGGTGGCTAAGG - Intronic
934562667 2:95321059-95321081 GGGCCAGGGAGGAGAGGCTTGGG - Intronic
934665039 2:96163976-96163998 GCAGCTGGGGGCGGAGGCTGGGG - Intergenic
935462333 2:103352970-103352992 GAGGCAGTTAGAGGAGGCTTAGG + Intergenic
938796104 2:134719132-134719154 GCGGCCGGTGGCGGAGGCTGGGG + Intergenic
941026677 2:160463500-160463522 GCGGCCGGGCGCGGTGGCTCAGG + Intronic
941264880 2:163348682-163348704 GGTGCAGGGAGGGGAGGCTAAGG + Intergenic
941742358 2:169048004-169048026 GCTGCAGGGACCAGAAGCTTAGG + Intergenic
943736608 2:191363486-191363508 GAGGCTGGGAGCAGAGCCTTGGG - Intronic
945152227 2:206803398-206803420 GCAGCAGGGGGAGGAGGCTGTGG - Intergenic
945451465 2:210000705-210000727 ACGGCATGGAGGGGAGGCTCAGG + Intergenic
947403538 2:229751904-229751926 TCGGCCGGGCGCGGTGGCTTAGG + Intergenic
947715025 2:232334987-232335009 TCGGCAGGGTGTGCAGGCTTTGG + Intronic
948302908 2:236921759-236921781 TCGGCAGGGCGCGGTGGCTCAGG + Intergenic
948455929 2:238104634-238104656 GCTGCAGGGAAGGGAGGGTTTGG - Exonic
948617470 2:239209972-239209994 GAGGCAGGGAGCGGGGGCGTGGG + Intronic
948908558 2:240991639-240991661 CCGGCAGAGAGCAGGGGCTTGGG + Intronic
949051461 2:241899784-241899806 GCGGCCGGGCGCGGTGGCTCAGG + Intronic
1169009490 20:2238335-2238357 GAGGCTGGGAGTGGTGGCTTAGG - Intergenic
1170781770 20:19431564-19431586 GCAGCTGGGAGGGGAGGCTCTGG - Intronic
1172295944 20:33811361-33811383 GCGGCAGGGAGCGGCGGGACTGG + Exonic
1173530817 20:43768109-43768131 GCAGCAGGAAGTGGAGGATTGGG - Intergenic
1174380746 20:50153881-50153903 GCAGCTGGGCGCGGAAGCTTGGG + Intergenic
1175429276 20:58890989-58891011 GCGGGAGGGGGAGGAGGCCTCGG + Intronic
1175521840 20:59606734-59606756 GTGGGTGGGAGCGGAGGGTTGGG + Intronic
1175920076 20:62446543-62446565 GCAGCAGGGAGTGGAGACTCAGG - Intergenic
1176295380 21:5069450-5069472 CAGGCAGGGAGGGGAAGCTTCGG - Intergenic
1176388377 21:6151046-6151068 GCGTCAGGGACAGGAGGCTCAGG - Intergenic
1178269165 21:31174135-31174157 GCGGCAGGGAGGGGCGGCAAAGG - Intronic
1178544031 21:33478997-33479019 GGGGCAGGGGGCGGAGGCCTCGG - Intronic
1179225097 21:39445863-39445885 GCGGCGGGGAGGGGCGTCTTGGG + Intronic
1179735095 21:43387202-43387224 GCGTCAGGGACAGGAGGCTCAGG + Intergenic
1179861669 21:44192674-44192696 CAGGCAGGGAGGGGAAGCTTCGG + Intergenic
1179953533 21:44724987-44725009 GTCGCAGGGATCTGAGGCTTGGG + Intergenic
1179955777 21:44737361-44737383 GCACCAGGGAGAGGAGACTTGGG + Intergenic
1180118455 21:45727576-45727598 GAGGCAGGGGGAGCAGGCTTAGG + Intronic
1180748695 22:18110293-18110315 GCGGCAGGAGGCACAGGCTTTGG + Intronic
1180782661 22:18529611-18529633 GCTGCAGACAGCGGAGGCCTGGG + Exonic
1181126221 22:20703638-20703660 GCTGCAGACAGCGGAGGCCTGGG + Intergenic
1181239551 22:21468949-21468971 GCTGCAGACAGCGGAGGCCTGGG + Intergenic
1181396347 22:22625536-22625558 GAGGCTGGGAGTGGTGGCTTAGG - Intergenic
1181652765 22:24269989-24270011 CCGGCCGGGCGCGGTGGCTTAGG - Intergenic
1181813766 22:25421361-25421383 GCCGCAGGGGGCGGCGGCGTCGG - Intergenic
1181831724 22:25565181-25565203 GCCGCAGGGGGCGGCGGCTTGGG - Intronic
1182271185 22:29154551-29154573 GCGGCAGGAGGCGGCGGCTGGGG - Intronic
1182423088 22:30257930-30257952 GGGGCAGGGAGTGGTGGCCTGGG - Intergenic
1182549690 22:31094091-31094113 GCGGCAGGGAGCTGGGGGCTGGG - Intronic
1183160552 22:36110371-36110393 GCGGCAGGGAGCAGAAGCTTGGG + Intergenic
1184239447 22:43204166-43204188 GTGGGAGGCAGGGGAGGCTTGGG + Intronic
1184455531 22:44607668-44607690 GCGGCAGGGAAGGGAGGTGTGGG + Intergenic
1184694419 22:46131600-46131622 GAGGGAGGCAGCGGAGGCTGGGG + Intergenic
1184723674 22:46330603-46330625 GCGGCGGGAAGCAGAGGCCTTGG - Exonic
1184981724 22:48100251-48100273 GCGGCAGACAGAGGAGGCTCTGG - Intergenic
1185008217 22:48298286-48298308 GAGGCAGGCAGCGCAGCCTTCGG + Intergenic
950194484 3:10999604-10999626 GCTGCAGGGCTCCGAGGCTTGGG + Intronic
950333481 3:12175693-12175715 GGGACAGGGAGCTGGGGCTTGGG + Intronic
950632669 3:14293440-14293462 ACGGCAGGGAGGGGAGGCTCAGG - Intergenic
950749633 3:15118654-15118676 GCGGCTGGGAGCATAGGCTCAGG - Intergenic
951734817 3:25851990-25852012 ACGGCAGGGAGGGCAGGCTCAGG - Intergenic
952190567 3:31018749-31018771 GGGGCAGGGAGCTGAGCCTTTGG + Intergenic
952856282 3:37773143-37773165 TAGGCAGGGAGAGGAAGCTTGGG - Intronic
954146207 3:48635511-48635533 GGGGCAGGACGGGGAGGCTTGGG + Intergenic
955486629 3:59440501-59440523 GAGGGAGGGAGTGGAGGCTGTGG + Intergenic
955890349 3:63643982-63644004 GCTGCAGGCAGCGGAAGATTAGG - Intergenic
956647500 3:71470932-71470954 GAGGTAGGAAGCTGAGGCTTAGG - Intronic
957711054 3:83860009-83860031 GAGGGAGAGAGCTGAGGCTTGGG - Intergenic
957865046 3:86012517-86012539 GAGGCCGGGAGCGGAGGGCTGGG + Intronic
960582627 3:119294102-119294124 GGGGCAGGAAGCGGCGGCTGCGG + Intergenic
961479011 3:127167540-127167562 GAGGCAGGGCACGTAGGCTTAGG - Intergenic
963111926 3:141695290-141695312 GGGTCAGGGAGTGGAGGCTGAGG + Intergenic
963887392 3:150597767-150597789 GTGGCTGGGAGCGGTGGCTCAGG - Intronic
968148394 3:196318466-196318488 GCGGCCGGGTGCGGGGGCTCAGG + Intronic
968831300 4:2934115-2934137 GCAGCAGGAAACGCAGGCTTCGG + Exonic
968964137 4:3761022-3761044 GTGGCAGGGAGCCGTGGCCTGGG - Intergenic
969499131 4:7542509-7542531 GCTGCAGGAAGGGGAGGCCTTGG + Intronic
969525786 4:7703393-7703415 GGGGCAGGGAGGGCAGGCTGGGG + Intronic
970823910 4:20251848-20251870 GGGTCAGGGGGCGGAGGCTCGGG + Intergenic
974680140 4:65149955-65149977 TCGGCCGGGAGCAGAGGCTAAGG + Intergenic
980703016 4:136457201-136457223 GCAGAAGGGAGCTGAGGCTGGGG + Intergenic
984702262 4:182825922-182825944 GCAGCAGGGAGGGGAGGGTGAGG - Intergenic
985334986 4:188882960-188882982 GCGGCCGGGTGCGGTGGCTCAGG + Intergenic
985764710 5:1770900-1770922 GCGTCATGGAGCCGATGCTTTGG - Intergenic
985830611 5:2226597-2226619 GCAGCAGGGAGGGGAGGATATGG + Intergenic
985830692 5:2227367-2227389 GCAGCAGGGAGGGGAGGATATGG - Intergenic
985975936 5:3419132-3419154 GCGGCTGGGTGCTGAGACTTTGG + Intergenic
986661778 5:10065760-10065782 GGGGCGGGGAGGGGAGGCTCAGG - Intergenic
988949388 5:36241836-36241858 GCGGTAGGGAGCTGAGGCAAGGG - Intronic
990376255 5:55173443-55173465 GCGGCAGGAGGCGGAGGGGTTGG + Intergenic
990495696 5:56345638-56345660 GAGGGAGGGAGTGGAGGATTGGG + Intergenic
992098179 5:73381603-73381625 GGGGCGGGGACCGGAGGCTGAGG - Intergenic
993584792 5:89710995-89711017 GGGGCTGGGCGCGGTGGCTTAGG + Intergenic
993836104 5:92822254-92822276 GCGGCAGGCAGCGGGGGGTGTGG + Intergenic
995390158 5:111632063-111632085 GAGGAAGGCAGGGGAGGCTTGGG - Intergenic
995551717 5:113288216-113288238 GCTGCAGAGTGCCGAGGCTTGGG - Intronic
997714013 5:136028926-136028948 GCGGGAGGGAGCGGACGCCAGGG - Exonic
998237908 5:140415717-140415739 GCGGCTGGGTGCGGTGGCTGAGG - Intronic
998403700 5:141862044-141862066 GCTGCAGGGAGCGGGGCCCTGGG - Intronic
1000020016 5:157310671-157310693 CTGGCTGGGAGCGGAGGCTAGGG + Intronic
1002069766 5:176672247-176672269 GCGGCAGGAAGGGGAGGGTGGGG + Intergenic
1002133715 5:177096035-177096057 ACTGCAGGGAGCGGGGGCTTGGG - Exonic
1002189723 5:177472356-177472378 CCAGCAGGGAGAGGAGGCCTAGG + Exonic
1002648985 5:180677802-180677824 GCTGCAGGGAGGGATGGCTTGGG - Intergenic
1002685046 5:181003576-181003598 GCGGCTGGGAGGGGAGGCGGGGG - Intronic
1002870883 6:1166426-1166448 TGAGCAGGGAGAGGAGGCTTTGG + Intergenic
1002916766 6:1535407-1535429 GGGGCAGGAAGCGGAGGGTGGGG + Intergenic
1002926687 6:1609425-1609447 GCGGCGGGGAGGAGAGGCTGGGG + Intergenic
1004605218 6:17188490-17188512 GCGGCCGGGCGCGGTGGCTCAGG + Intergenic
1005048766 6:21665500-21665522 GCGGCAGGGGGTGGAGGATGAGG + Intergenic
1005952473 6:30642073-30642095 GTGTCAGGGAGCAGAGGTTTGGG + Intronic
1006851559 6:37102479-37102501 GGGGAAGGGAGTGGTGGCTTGGG - Intergenic
1007084677 6:39135033-39135055 GGGTCAGGGAGTGGAGGCTGAGG + Intergenic
1007345049 6:41222943-41222965 ACGGCAGGGAGGGCAGGCTTAGG + Intergenic
1007429979 6:41771065-41771087 GCAGCTGGGAGGGGAGGCTGGGG - Exonic
1011418861 6:87151858-87151880 GCGGCGGGGAGCGGGGCCTCCGG - Intergenic
1011430024 6:87275447-87275469 GCGGCCGGGTGCGGTGGCTCAGG - Intergenic
1013330329 6:109094626-109094648 GCCGCAGCGGCCGGAGGCTTGGG + Exonic
1015314920 6:131807568-131807590 GCGGGAGAGAGTGGAGTCTTGGG - Intergenic
1016007727 6:139106345-139106367 GCAGTAGGGAGGGAAGGCTTGGG - Intergenic
1016391083 6:143576593-143576615 GGGGCTGGGAGCGGTGGCTCAGG + Intronic
1017435806 6:154414633-154414655 GTGGCAAGAAGCAGAGGCTTAGG + Intronic
1017527287 6:155252682-155252704 GCGTCAGGGCGTGGAAGCTTTGG + Intronic
1019336625 7:485876-485898 GGGGCAGGGAGGGGACGCTGTGG + Intergenic
1019519945 7:1456063-1456085 ACGGCAGGGAGCAGAGGCTGAGG + Intronic
1019644905 7:2123958-2123980 GCAGCAAGGGGCGGGGGCTTAGG + Intronic
1019736229 7:2651031-2651053 GGGGCAGGGAGCTGGGGCATCGG + Intronic
1020088137 7:5322680-5322702 GAGGGAGGGAGCAGAGGGTTGGG - Intronic
1022390519 7:29939866-29939888 GGGGCTGGGTGCGGTGGCTTAGG + Intronic
1022669521 7:32442794-32442816 GCGGCCGGGCGCGGTGGCTCAGG + Intergenic
1023253678 7:38291480-38291502 GCTGCAGGGAGGGCAGGCTCCGG + Intergenic
1024254640 7:47531718-47531740 GCAGCAGGGAGGTGAGGCTGGGG + Intronic
1024290123 7:47797149-47797171 GCAGCATGGAGGGGAGGCTCTGG - Intronic
1025216563 7:57061040-57061062 GCGGCTGGGAGGGGAGGGGTGGG + Intergenic
1025627314 7:63233490-63233512 GCGGCTGGGAGGGGAGGGGTGGG + Intergenic
1025654817 7:63509690-63509712 GCGGCTGGGAGGGGAGGGGTGGG - Intergenic
1026682161 7:72475180-72475202 GTGGCAGGGTGCGGTGGCTCAGG + Intergenic
1027730595 7:81867244-81867266 GGGGCTGGGAGATGAGGCTTAGG + Intergenic
1029239057 7:99145531-99145553 GGGTCTGGGAGCGGTGGCTTAGG - Intergenic
1029272234 7:99384165-99384187 GCGGCAGGTGGAGGAGGCTAGGG + Intronic
1029367704 7:100127264-100127286 GTGGCAGAGAACCGAGGCTTAGG + Intronic
1029443987 7:100602900-100602922 GGGGCAGTGAGTGGAGACTTGGG + Intronic
1029450574 7:100640063-100640085 ACGGCAGGGTGCGGTGGCTCAGG - Intronic
1029456271 7:100674035-100674057 GGGGAAGGGAGCGGAGGTCTGGG - Intronic
1029716964 7:102334163-102334185 GCGGCCGGGCGCGGTGGCTCAGG + Intergenic
1031817854 7:126461383-126461405 GAGGCAGGGAGAAGAGGCTGGGG - Intronic
1032268022 7:130381874-130381896 GCTGCAGGGAGCGGCCGCTAGGG - Intronic
1033207367 7:139434484-139434506 GAGGGAGGGAGGGCAGGCTTTGG - Intergenic
1035471427 7:159112312-159112334 GCGTCAGGGCGCCGAGGCTGAGG + Intronic
1036434802 8:8723428-8723450 GCGGCAGGGGCCGGCGGCTGGGG - Intergenic
1037018660 8:13940889-13940911 GCAGCTGGGAGCAGAGGCTCAGG + Intergenic
1037273723 8:17156486-17156508 GCGGCTGCGAGCGGAGGCCGAGG - Exonic
1038845218 8:31222693-31222715 CAGGCAGGGCGCGGTGGCTTAGG + Intergenic
1039554955 8:38468687-38468709 GCTGCAGGGGGCGGAGGCGGAGG - Intronic
1040338749 8:46429350-46429372 GCGGCAGGTTGCAGAGACTTAGG + Intergenic
1040764014 8:50884749-50884771 TTGGCAGGGAGCGGTGGCTCAGG - Intergenic
1040954889 8:52969932-52969954 GTGGAGGGGAGCGGAGGCTCAGG + Intergenic
1041024746 8:53672562-53672584 GAGGCAGGGGGAGCAGGCTTAGG + Intergenic
1041040088 8:53838046-53838068 CAGGCAGGGAGCTGAGGCCTGGG - Intronic
1042918004 8:73894145-73894167 GCAGCTGGGAGGGGAGGATTGGG + Intergenic
1045178551 8:99754886-99754908 GTGGCAGGGAGTGGGGGCATGGG - Intronic
1047393718 8:124475024-124475046 GCGGCCGGGGGCGGGGGCTAAGG - Exonic
1048570342 8:135648797-135648819 GCGGCAGAGATTGGAGGCTCAGG + Intronic
1049004824 8:139847912-139847934 GCGGCAGGGAGCGGAGGCTTTGG - Intronic
1049091058 8:140513726-140513748 GCGGCCGGGAGCTGTGGCTCAGG - Intronic
1049414073 8:142487525-142487547 GCGGCAGGGAGAGGAGGAGAGGG - Intronic
1049812039 8:144579962-144579984 GAGGCAGGGACAGGAGGCTGGGG - Intronic
1049989414 9:977353-977375 GCAGCAGGGCGCGGCGGCTGCGG - Exonic
1050845206 9:10208231-10208253 GCGGCGGGGCGCGGTGGCTCAGG + Intronic
1051774818 9:20622080-20622102 GAGGAGGGGAGCGGAGGCTGAGG + Intronic
1052824823 9:33167158-33167180 GCGGCGGGAAGATGAGGCTTCGG - Exonic
1055503957 9:76929571-76929593 GTGGCAGGAAGCGGAAGCTCAGG + Intergenic
1058843502 9:108933771-108933793 GCAGCAGGCAGAGGAGGCTCCGG + Intronic
1059145174 9:111893498-111893520 GCGGCTGGGCGCGGTGGCTCAGG - Intergenic
1059327829 9:113514974-113514996 GAGCCAGGGAGCGGGAGCTTTGG - Intronic
1060382756 9:123192097-123192119 GTGCCAGGGAGAGGAGGTTTTGG + Intronic
1060389975 9:123268886-123268908 GCTGCAGCGAGCGGGGGCCTGGG - Intergenic
1061078189 9:128354460-128354482 CCGGCATGGAGCAGAGGCTTGGG + Intronic
1061480005 9:130893122-130893144 GGGGCACGGAGCTGAGGCTGTGG - Intergenic
1061753780 9:132798851-132798873 GCGGTGGGGAGTGGAGGCCTGGG - Intronic
1061820135 9:133222903-133222925 GCGGGAGGGAGTGGGGGCTCCGG - Intergenic
1062382382 9:136292699-136292721 GCAGCACGGAGCGGAGGGTGGGG - Intronic
1062728721 9:138096424-138096446 GCGGCGGGGAGGGCAGGCTGAGG + Intronic
1185697738 X:2207910-2207932 GCGGCCGGGTGCGGTGGCTCAGG + Intergenic
1185697893 X:2209131-2209153 GCGTTAGGAAGTGGAGGCTTTGG - Intergenic
1185717496 X:2354433-2354455 TGGGCAGGGAGTGGAGGCTGTGG - Intronic
1186771453 X:12821924-12821946 GCTGATGGGAGCCGAGGCTTTGG - Intronic
1187098140 X:16167927-16167949 GCACCAGGGAGGGGAGGGTTTGG + Intronic
1187719883 X:22139270-22139292 GCCTCTGGGAGGGGAGGCTTTGG + Intronic
1190066932 X:47247872-47247894 GCTGCAGGCAGGGGAGGCTGGGG - Exonic
1191211801 X:57892389-57892411 GCGGCAGGGGGCGGTGGGTGGGG + Intergenic
1192251415 X:69416994-69417016 GCGGCAGGGGGAGGAGGCTCAGG - Intergenic
1195916792 X:109943846-109943868 TCAGCAGGGAGAGGAGGCTGAGG - Intergenic
1195958920 X:110364903-110364925 GATGCAGGGAGCTGAGGCTCAGG - Intronic
1198615094 X:138448577-138448599 GGGGCAGGGTGGAGAGGCTTAGG + Intergenic
1199612740 X:149631790-149631812 GGGGCAGGGGGCGGTGGCTCAGG - Exonic
1200812724 Y:7502066-7502088 GGGTCAGGGAGCAGAGGCTGAGG - Intergenic