ID: 1049004825

View in Genome Browser
Species Human (GRCh38)
Location 8:139847918-139847940
Sequence GCAGAGGCGGCAGGGAGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3468
Summary {0: 1, 1: 1, 2: 8, 3: 281, 4: 3177}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049004825_1049004835 6 Left 1049004825 8:139847918-139847940 CCTCCGCTCCCTGCCGCCTCTGC 0: 1
1: 1
2: 8
3: 281
4: 3177
Right 1049004835 8:139847947-139847969 CCTGTGTCAGCAGCAGCCCTGGG No data
1049004825_1049004838 15 Left 1049004825 8:139847918-139847940 CCTCCGCTCCCTGCCGCCTCTGC 0: 1
1: 1
2: 8
3: 281
4: 3177
Right 1049004838 8:139847956-139847978 GCAGCAGCCCTGGGGCACGTGGG No data
1049004825_1049004837 14 Left 1049004825 8:139847918-139847940 CCTCCGCTCCCTGCCGCCTCTGC 0: 1
1: 1
2: 8
3: 281
4: 3177
Right 1049004837 8:139847955-139847977 AGCAGCAGCCCTGGGGCACGTGG No data
1049004825_1049004833 5 Left 1049004825 8:139847918-139847940 CCTCCGCTCCCTGCCGCCTCTGC 0: 1
1: 1
2: 8
3: 281
4: 3177
Right 1049004833 8:139847946-139847968 CCCTGTGTCAGCAGCAGCCCTGG No data
1049004825_1049004840 21 Left 1049004825 8:139847918-139847940 CCTCCGCTCCCTGCCGCCTCTGC 0: 1
1: 1
2: 8
3: 281
4: 3177
Right 1049004840 8:139847962-139847984 GCCCTGGGGCACGTGGGGCCTGG No data
1049004825_1049004836 7 Left 1049004825 8:139847918-139847940 CCTCCGCTCCCTGCCGCCTCTGC 0: 1
1: 1
2: 8
3: 281
4: 3177
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004825_1049004839 16 Left 1049004825 8:139847918-139847940 CCTCCGCTCCCTGCCGCCTCTGC 0: 1
1: 1
2: 8
3: 281
4: 3177
Right 1049004839 8:139847957-139847979 CAGCAGCCCTGGGGCACGTGGGG No data
1049004825_1049004843 27 Left 1049004825 8:139847918-139847940 CCTCCGCTCCCTGCCGCCTCTGC 0: 1
1: 1
2: 8
3: 281
4: 3177
Right 1049004843 8:139847968-139847990 GGGCACGTGGGGCCTGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049004825 Original CRISPR GCAGAGGCGGCAGGGAGCGG AGG (reversed) Intronic
Too many off-targets to display for this crispr