ID: 1049004826

View in Genome Browser
Species Human (GRCh38)
Location 8:139847921-139847943
Sequence CAGGCAGAGGCGGCAGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3064
Summary {0: 1, 1: 1, 2: 12, 3: 249, 4: 2801}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049004826_1049004838 12 Left 1049004826 8:139847921-139847943 CCGCTCCCTGCCGCCTCTGCCTG 0: 1
1: 1
2: 12
3: 249
4: 2801
Right 1049004838 8:139847956-139847978 GCAGCAGCCCTGGGGCACGTGGG No data
1049004826_1049004839 13 Left 1049004826 8:139847921-139847943 CCGCTCCCTGCCGCCTCTGCCTG 0: 1
1: 1
2: 12
3: 249
4: 2801
Right 1049004839 8:139847957-139847979 CAGCAGCCCTGGGGCACGTGGGG No data
1049004826_1049004836 4 Left 1049004826 8:139847921-139847943 CCGCTCCCTGCCGCCTCTGCCTG 0: 1
1: 1
2: 12
3: 249
4: 2801
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004826_1049004840 18 Left 1049004826 8:139847921-139847943 CCGCTCCCTGCCGCCTCTGCCTG 0: 1
1: 1
2: 12
3: 249
4: 2801
Right 1049004840 8:139847962-139847984 GCCCTGGGGCACGTGGGGCCTGG No data
1049004826_1049004835 3 Left 1049004826 8:139847921-139847943 CCGCTCCCTGCCGCCTCTGCCTG 0: 1
1: 1
2: 12
3: 249
4: 2801
Right 1049004835 8:139847947-139847969 CCTGTGTCAGCAGCAGCCCTGGG No data
1049004826_1049004843 24 Left 1049004826 8:139847921-139847943 CCGCTCCCTGCCGCCTCTGCCTG 0: 1
1: 1
2: 12
3: 249
4: 2801
Right 1049004843 8:139847968-139847990 GGGCACGTGGGGCCTGGACTTGG No data
1049004826_1049004833 2 Left 1049004826 8:139847921-139847943 CCGCTCCCTGCCGCCTCTGCCTG 0: 1
1: 1
2: 12
3: 249
4: 2801
Right 1049004833 8:139847946-139847968 CCCTGTGTCAGCAGCAGCCCTGG No data
1049004826_1049004837 11 Left 1049004826 8:139847921-139847943 CCGCTCCCTGCCGCCTCTGCCTG 0: 1
1: 1
2: 12
3: 249
4: 2801
Right 1049004837 8:139847955-139847977 AGCAGCAGCCCTGGGGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049004826 Original CRISPR CAGGCAGAGGCGGCAGGGAG CGG (reversed) Intronic
Too many off-targets to display for this crispr