ID: 1049004827

View in Genome Browser
Species Human (GRCh38)
Location 8:139847926-139847948
Sequence GGGCACAGGCAGAGGCGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 0, 2: 17, 3: 72, 4: 653}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049004827_1049004833 -3 Left 1049004827 8:139847926-139847948 CCCTGCCGCCTCTGCCTGTGCCC 0: 1
1: 0
2: 17
3: 72
4: 653
Right 1049004833 8:139847946-139847968 CCCTGTGTCAGCAGCAGCCCTGG No data
1049004827_1049004844 27 Left 1049004827 8:139847926-139847948 CCCTGCCGCCTCTGCCTGTGCCC 0: 1
1: 0
2: 17
3: 72
4: 653
Right 1049004844 8:139847976-139847998 GGGGCCTGGACTTGGTCTGCCGG No data
1049004827_1049004837 6 Left 1049004827 8:139847926-139847948 CCCTGCCGCCTCTGCCTGTGCCC 0: 1
1: 0
2: 17
3: 72
4: 653
Right 1049004837 8:139847955-139847977 AGCAGCAGCCCTGGGGCACGTGG No data
1049004827_1049004836 -1 Left 1049004827 8:139847926-139847948 CCCTGCCGCCTCTGCCTGTGCCC 0: 1
1: 0
2: 17
3: 72
4: 653
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004827_1049004843 19 Left 1049004827 8:139847926-139847948 CCCTGCCGCCTCTGCCTGTGCCC 0: 1
1: 0
2: 17
3: 72
4: 653
Right 1049004843 8:139847968-139847990 GGGCACGTGGGGCCTGGACTTGG No data
1049004827_1049004839 8 Left 1049004827 8:139847926-139847948 CCCTGCCGCCTCTGCCTGTGCCC 0: 1
1: 0
2: 17
3: 72
4: 653
Right 1049004839 8:139847957-139847979 CAGCAGCCCTGGGGCACGTGGGG No data
1049004827_1049004840 13 Left 1049004827 8:139847926-139847948 CCCTGCCGCCTCTGCCTGTGCCC 0: 1
1: 0
2: 17
3: 72
4: 653
Right 1049004840 8:139847962-139847984 GCCCTGGGGCACGTGGGGCCTGG No data
1049004827_1049004838 7 Left 1049004827 8:139847926-139847948 CCCTGCCGCCTCTGCCTGTGCCC 0: 1
1: 0
2: 17
3: 72
4: 653
Right 1049004838 8:139847956-139847978 GCAGCAGCCCTGGGGCACGTGGG No data
1049004827_1049004835 -2 Left 1049004827 8:139847926-139847948 CCCTGCCGCCTCTGCCTGTGCCC 0: 1
1: 0
2: 17
3: 72
4: 653
Right 1049004835 8:139847947-139847969 CCTGTGTCAGCAGCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049004827 Original CRISPR GGGCACAGGCAGAGGCGGCA GGG (reversed) Intronic
900122756 1:1055892-1055914 GGGCAGGTGCAGAGGTGGCAGGG + Exonic
900130273 1:1084426-1084448 TGGCACAGGCACACGCGGCCAGG + Intronic
900180431 1:1308755-1308777 GGGCCCGGGCGGAGGCGGGAAGG + Intronic
900189272 1:1346426-1346448 GGGCCGAGGCAGAGGAGGGAGGG - Intronic
900228281 1:1543060-1543082 AGGCAGAGGCAGAGGCGGGACGG + Intronic
900520738 1:3104420-3104442 GTGAACAGGCAGAGGCTGCCCGG + Intronic
900646945 1:3713316-3713338 GGGTGAAGGCAGAGGGGGCAGGG - Intronic
900869090 1:5289155-5289177 GAGCCCAGGAAGAGGAGGCAGGG - Intergenic
900895963 1:5483116-5483138 AGGCACAGACAGAGGGGGGATGG - Intergenic
901012038 1:6207504-6207526 GCGAGCAGGCAGGGGCGGCAGGG + Exonic
901208468 1:7510909-7510931 GTGGACAGGCAGATGGGGCAGGG - Intronic
901466021 1:9421764-9421786 GGGGGCAGGCAGAGGGGACAGGG - Intergenic
901675085 1:10878625-10878647 GGGGACAGTCAGAGGCAGGAGGG + Intergenic
901769956 1:11524966-11524988 GGGCACAGGATGGGGTGGCAGGG - Intronic
901778727 1:11578469-11578491 GGGCACAGTCAGAGGCTCCTGGG + Intergenic
902652810 1:17847502-17847524 TAGCCCAGGCAGAGGCAGCAAGG - Intergenic
902834489 1:19037874-19037896 GGGCACAGGCAGAGGCCTGTGGG + Intergenic
903271012 1:22188293-22188315 GGGGAGAGGCATAGGCAGCAGGG - Intergenic
903298398 1:22360659-22360681 GGCAACAGGCAGTGGTGGCAGGG + Intergenic
904263614 1:29305242-29305264 GGGCACAGGCAGGGCAGCCAGGG - Intronic
904299425 1:29544493-29544515 GGGCAGAAACAGAGGCTGCAAGG - Intergenic
904990210 1:34586551-34586573 GTGCACAGGCTGAGGCTTCATGG - Intergenic
905018977 1:34795434-34795456 GAGCACAGACAGAGTCAGCATGG + Exonic
905241226 1:36582769-36582791 TGGCAGAGGCAGTGGCTGCACGG + Intergenic
905402529 1:37714130-37714152 GAGCACAGGCAGTGGGGGAAGGG + Intronic
905495021 1:38378101-38378123 GGACACAGACAAAGGAGGCATGG - Intergenic
905717209 1:40161899-40161921 GGACACAGGCAACGGCGACAGGG - Intronic
905789858 1:40784109-40784131 GGACCCAGGCCGAGGCGGCGCGG - Exonic
905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG + Intergenic
905959278 1:42030104-42030126 GGTCAGAGGCAGAGGCTACAAGG + Intronic
906065636 1:42978474-42978496 GGGCTCAAGCAGTGGCTGCAGGG + Intergenic
906290568 1:44617097-44617119 GCGCACAGACGGAGGGGGCATGG - Intronic
907979985 1:59471996-59472018 GAGCCCAGGCAGAGGAGGCGCGG - Intronic
908391231 1:63685372-63685394 GGGCACAGGAAGAGGCCATAGGG - Intergenic
912385315 1:109268503-109268525 GGGCACAGGCCGGGGCTCCATGG + Intronic
912965009 1:114229789-114229811 GGGAACAGGCAGAGAGGGAACGG - Intergenic
913091060 1:115476910-115476932 GGGCACAAGCACAGGCAGAATGG - Intergenic
914244644 1:145876622-145876644 AGGCACAGCCAGAGGAGGCTGGG + Exonic
915075759 1:153307188-153307210 GGCCACAGGCAGGGTCAGCAGGG + Exonic
915083164 1:153365928-153365950 GGCCACCAGCAGGGGCGGCAGGG + Intergenic
915300199 1:154947392-154947414 GGGCACAGGCAGGAGGGGCTGGG - Intronic
915971340 1:160357262-160357284 GGGCAGGGGCATAGGTGGCAGGG + Intronic
915979416 1:160410726-160410748 GGCAACAGGCAGAGGGAGCAGGG - Intronic
916337791 1:163692699-163692721 GGGCCCAGCCAGAGACGGCCTGG - Intergenic
918092659 1:181310760-181310782 GGGCTCGGGCAGAGGCTGCTGGG + Intergenic
918405248 1:184205864-184205886 GGGCACAGTCAGAGGCAGGGAGG + Intergenic
918708281 1:187696085-187696107 GGGCCCAGGCATAGGGGTCAGGG - Intergenic
919980542 1:202640268-202640290 TGGCAAAGGCAGAGCCAGCAGGG + Intronic
920021298 1:202958342-202958364 GGGCCCAGGCAGAGCCCGCGAGG - Exonic
920285308 1:204874626-204874648 GGGCACCGGCAGAGGCGGGAAGG - Intronic
921059964 1:211577858-211577880 GGGAGCAGGCAGGGGCGGCGCGG + Intronic
922209760 1:223478421-223478443 GGGCACTGGCAGATGCTGCAGGG - Intergenic
922214254 1:223507960-223507982 GGGTACCGGCACAGGAGGCAGGG + Intergenic
922218597 1:223540658-223540680 GGGCACAGGAGCAGGCTGCATGG + Intronic
922507144 1:226133166-226133188 AGGCACCGGCAGAGGCTGCCCGG - Intergenic
922888612 1:229042116-229042138 GGGGACAGGCTGAGGCGGCCGGG + Intergenic
923125755 1:231033190-231033212 GGGCAAAGGCCAAGGCGGCCAGG + Intronic
923299696 1:232629993-232630015 GGGCTCCGGCGGAGGCGGCCCGG + Intergenic
923385259 1:233459836-233459858 GGTCAGAGGCAGAGGGGGCAGGG - Intergenic
924024260 1:239816487-239816509 AGGCACAGGCAGAAGAGGGAGGG + Intronic
924342858 1:243052074-243052096 GGGCACAGGCAGTGGTGGGGCGG - Intergenic
1063300468 10:4845411-4845433 GAGCCCAGGCAGAGGAGGCCCGG + Intronic
1065974557 10:30830943-30830965 GGCCACAGCCAGAGGCCGCTGGG - Intronic
1066336031 10:34479608-34479630 GGGCACCGGCAGTGGCTGTAGGG - Intronic
1067039142 10:42939814-42939836 AGACACAGGCAGGGGTGGCACGG + Intergenic
1067111851 10:43407164-43407186 GGCCACAGCCTCAGGCGGCAGGG - Intronic
1067227367 10:44384858-44384880 GGGCGCAGGCAGAGGAGCCGCGG + Intronic
1067407468 10:46036177-46036199 GGGCCCAGGCAGAGGCTCCCAGG - Intronic
1067724924 10:48762731-48762753 GGACACAGGCAGAGGCCAGATGG - Intronic
1067809058 10:49412912-49412934 GGGCACAGGCAAAGGGAGCTGGG - Intergenic
1067834281 10:49628576-49628598 GGGAACAGGAAGAGGGGGCATGG + Intronic
1068022776 10:51605232-51605254 GGGCACAGGATGGGGGGGCATGG + Intronic
1068941820 10:62688164-62688186 GGGGACAGGGAGAGGGGACAGGG - Intergenic
1068978061 10:63033453-63033475 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
1069919409 10:71807478-71807500 TGGCACAGGGTGAGGGGGCAGGG - Intronic
1070539975 10:77408958-77408980 GGGTGCAGGCACAGGAGGCAGGG + Intronic
1072190556 10:93073707-93073729 GCGCCGAGGCAGAGGCGGCGCGG - Intronic
1073218405 10:101849746-101849768 AGACACAGGCAGAGGCGGTGGGG + Intronic
1073289968 10:102408741-102408763 GGGCACGGGCTGGGGGGGCAGGG - Intronic
1073326630 10:102647089-102647111 GGGCACAGGCAGGGGTGGGTGGG + Intronic
1073327707 10:102651886-102651908 GGGCACAGCCAGAGGTGCAAAGG - Intronic
1073469908 10:103716097-103716119 GGGCAGAGGCAGATGCTGCTTGG - Intronic
1074088361 10:110225922-110225944 GGGCAGAGGCAGGGGCGGGAGGG + Intronic
1074110496 10:110419357-110419379 GGGCACTGGAGGAGGCTGCAGGG + Intergenic
1074290145 10:112132234-112132256 GGGCACAGGCACAGGCAGCAGGG + Intergenic
1074372142 10:112908699-112908721 GGGCCCAGGCGGAGGGGCCAGGG + Intergenic
1074538430 10:114345421-114345443 GGGGACTGGCAGTGGAGGCAGGG + Intronic
1074874465 10:117603195-117603217 GGGCACCGGCAGATGCTGGAAGG - Intergenic
1076052968 10:127349813-127349835 GGCCACAGGAAGATGGGGCAGGG - Intronic
1076313944 10:129527698-129527720 GGGGACAGGGAGAGGCGTCTGGG - Intronic
1076457767 10:130613919-130613941 GTGCACGGGAAGAGGCGCCATGG - Intergenic
1076523607 10:131096267-131096289 GGACAGAGGCGGAGGAGGCAAGG - Intronic
1076607717 10:131700339-131700361 GGGAGCAGGCAGAGGTGGCCTGG - Intergenic
1076764324 10:132624864-132624886 GGGCCCTGGCACCGGCGGCATGG - Intronic
1076834034 10:133012047-133012069 AGGCACAGGCAGCTGCTGCAAGG + Intergenic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1076930727 10:133530016-133530038 AGGCACAGTCGGAGGCAGCAGGG + Intronic
1077143991 11:1036763-1036785 GGGCGCAGGCAGGTGCGGCGGGG - Intergenic
1077145395 11:1042121-1042143 GAGCACAGGGAGAGGCTGCCGGG + Intergenic
1077170002 11:1161837-1161859 GGGCAGAGGCAGGGGGTGCAGGG + Intronic
1077216491 11:1397285-1397307 GGGCTGGGGCAGAGGCTGCAGGG + Intronic
1077317962 11:1927662-1927684 GGGCAGGAGCAGAGGAGGCAGGG + Intronic
1077338636 11:2016434-2016456 GTGGACAGGAAGAGGCTGCAGGG - Intergenic
1077453806 11:2666070-2666092 GGGCAGAGCCATAGGCTGCAGGG - Intronic
1077799601 11:5524865-5524887 GGGTACAGGCAGAGGTTGGAGGG - Intronic
1078597308 11:12698440-12698462 GAGCACAGGCAGAGCAGGAAGGG + Intronic
1078856458 11:15209410-15209432 CAGCACAGGCAGAGGCTCCAAGG - Intronic
1079191052 11:18276588-18276610 GGGCCGAGGCCGAGGAGGCACGG + Intergenic
1080836520 11:35944992-35945014 GGGCAGGGGCAGAGGAGGAAGGG - Intronic
1080844545 11:36015320-36015342 GGGGACAGGCAATGGGGGCAGGG - Intronic
1081553715 11:44138136-44138158 TGGCACAGGCACGGGAGGCAGGG + Intronic
1082808055 11:57462357-57462379 GGGCAGATGCTGAGGGGGCAGGG - Intronic
1083418393 11:62539806-62539828 GGCCACAGCCAGAGCAGGCAGGG - Intronic
1083615100 11:64022219-64022241 GGGCACAGGCAGTGGCAGGAGGG + Intronic
1083678728 11:64341735-64341757 GGGCCCAGGTAGGGGCAGCAGGG + Exonic
1083815385 11:65129893-65129915 GGGCACAGGCATTGGGGGGAAGG + Exonic
1084001989 11:66300904-66300926 GAGCAGAGGCAGAGGCCGCTGGG - Intergenic
1084181687 11:67450097-67450119 GGGCAAAGGCAAAGACGGCCGGG - Intergenic
1084345754 11:68547361-68547383 GGACAGAGGCAGAGGCAACAAGG + Intronic
1084490351 11:69475125-69475147 TGGCACAGCCAGAGGTGGCCAGG + Intergenic
1084751221 11:71205435-71205457 GGGCACAGGCAGGAGCTGGAGGG - Intronic
1085477502 11:76797381-76797403 GGGAACAGGCAAGGGCAGCAAGG - Exonic
1085623967 11:78057892-78057914 GGGCACAGGCAAAGACCACAAGG - Intronic
1085704211 11:78771348-78771370 TCGCACAGTCAGAAGCGGCAGGG + Intronic
1087935198 11:104025739-104025761 GAGCACAGGGAGATGAGGCAGGG + Intronic
1088885614 11:114004044-114004066 TGGCAAAGGCAGAGGCTGGAGGG + Intergenic
1089392497 11:118111716-118111738 GGACACAGGCAGAGGCAGGGAGG - Intronic
1089641200 11:119848264-119848286 GGGAAGAGGCAGAGGCGTGAGGG + Intergenic
1089756592 11:120692046-120692068 GGGCACAGGGAGAGATGGAAGGG - Intronic
1089760430 11:120718736-120718758 GGGCACAGGCAACAGCGGCCAGG - Intronic
1090003991 11:122984320-122984342 GGGCCCCGGCAGAGGCGGGGCGG - Intergenic
1090114697 11:123956137-123956159 AGGCACAGGGAGAAGAGGCAGGG + Intergenic
1090202741 11:124867784-124867806 GGGAACAGGGGGAGGGGGCAGGG + Intronic
1090588185 11:128236955-128236977 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
1090616871 11:128522590-128522612 GAGCCCAGGCAGGGGCGGGAAGG + Intronic
1090808401 11:130217134-130217156 GGGGACAGGAAGAGGCCGCTTGG - Intergenic
1090820595 11:130337855-130337877 GCGCCCAGGCAGAGGAGGCATGG + Intergenic
1091268289 11:134287800-134287822 GGGCAGAGGGTGAGGCGGGAAGG + Intronic
1091305096 11:134531603-134531625 GGACACAGGCAGAGGCTGTAGGG - Intergenic
1202821620 11_KI270721v1_random:71616-71638 GTGGACAGGAAGAGGCTGCAGGG - Intergenic
1091390801 12:125110-125132 GGGCACAGGCTCAGGTGGCTGGG - Intronic
1091747671 12:3003097-3003119 GGGCTCAGGGAGAGGAGGCTGGG - Intronic
1092123800 12:6062340-6062362 GGGCACAGGAAGTGGAGGGATGG - Intronic
1096494078 12:52029278-52029300 GGGCACAGGCAGGGTCTTCAGGG - Intronic
1097193270 12:57230386-57230408 GGGAAGAGGCAGAGTTGGCAAGG - Intronic
1097616108 12:61886371-61886393 GGGCAGTGGCAGTGGGGGCAGGG - Intronic
1102243347 12:111339357-111339379 GGGCTGAGGCAGAGGAGGGAGGG - Intronic
1102290488 12:111695250-111695272 TTGAACAGGCAGAGGAGGCAGGG - Intronic
1102628155 12:114252939-114252961 GGGAAGAGGCAGAGGATGCAAGG - Intergenic
1102686952 12:114732356-114732378 GGGCAGAGCCAGAGGCCTCATGG + Intergenic
1102811307 12:115826590-115826612 GGGCACAGGTGGAGGAAGCAGGG - Intergenic
1103601999 12:122060199-122060221 GGGCACAGGCTGGGGCGTCGGGG - Exonic
1103992484 12:124808436-124808458 GGGCACAGGAAGTTGGGGCAGGG - Intronic
1104568242 12:129903787-129903809 GGACGCGGGCAGAGGCGGCTCGG + Intergenic
1104749160 12:131227676-131227698 GAGCCCAGGCAGAGGAGGCGTGG - Intergenic
1104860777 12:131922314-131922336 TGCCACAGGGAGGGGCGGCAGGG - Exonic
1104914777 12:132258950-132258972 CGGCTCAGGCAGAGCCGGCATGG + Intronic
1105014200 12:132776277-132776299 GGGCACAGGCGGGAGCAGCAGGG - Intronic
1105014250 12:132776512-132776534 GGGCACAGGCGGGAGCAGCAGGG - Intronic
1105014267 12:132776591-132776613 GGGCACAGGCGGGAGCAGCAGGG - Intronic
1105280700 13:18961004-18961026 GGGCCCAGGCAGAGAGGACATGG + Intergenic
1106087800 13:26558308-26558330 GGGCACAGGCCAGGGCGGCGAGG - Intronic
1110356794 13:74576069-74576091 CTGCAGAGGCAGGGGCGGCAAGG - Intergenic
1110862057 13:80355411-80355433 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
1112043182 13:95568842-95568864 AGGAACAGGGAGAGGCAGCATGG + Intronic
1113402356 13:110005571-110005593 GGGCACATACAGGGGAGGCAGGG + Intergenic
1113680350 13:112239125-112239147 GGGCACAGGCAAAGCCAGCTGGG + Intergenic
1113794406 13:113048894-113048916 GGTCACAGGCAGGGGCAGCAGGG + Intronic
1113931850 13:113972879-113972901 GGGCACAGCCAAGGGCGGGAGGG - Intergenic
1113961870 13:114130766-114130788 GGCAGCAGGCAGAGGCGGCCTGG - Intronic
1115641250 14:35336982-35337004 GGGCAGAGGCGGAGGCTGCTTGG - Intergenic
1116114759 14:40633384-40633406 GAGCACAGGCAAAGGCAGCATGG + Intergenic
1117243529 14:53860329-53860351 GGGCATAGGGAAAGGCTGCAAGG + Intergenic
1117675595 14:58152105-58152127 GGACAGAGGCAGCGGCGGCGCGG + Exonic
1117964115 14:61189358-61189380 GGGCAAAGGCAAAGGGGGGATGG + Intronic
1117971688 14:61257299-61257321 AGGCCCAGCCAGAGGCGGCGAGG + Intronic
1118231970 14:63960515-63960537 GGTCACAGGCAGGGGCTACAAGG - Intronic
1118773880 14:68961547-68961569 GGGCACAGGGCGCGGGGGCACGG + Intronic
1119724935 14:76916461-76916483 GGTCACAGGCAGAAGCGCCGTGG + Intergenic
1120519341 14:85508421-85508443 GGGCAAAGGAAAAGGCAGCAAGG + Intergenic
1120715969 14:87840982-87841004 GGGCAGAGGCAGTGGAGGAAGGG - Intronic
1121634289 14:95443239-95443261 GGGCACAGATGGAGGCTGCAAGG - Exonic
1121840116 14:97127129-97127151 GGGCCCAGTCAGATGAGGCAGGG - Intergenic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122070185 14:99200990-99201012 TGGCACAGCCAGACGCAGCATGG + Intronic
1122124349 14:99571038-99571060 GGGCACAGGCAGGGGTGGCAGGG - Intronic
1122314056 14:100815345-100815367 TGGCACACGCAGAGTCAGCATGG + Intergenic
1122628203 14:103094898-103094920 GGCCACACGCAGAGCCGGAATGG - Intergenic
1122791641 14:104186306-104186328 GGGCGCAGGCAGACGGGGGAAGG - Intergenic
1122821172 14:104345952-104345974 GGGCACATGCAGTGGGGGTAGGG - Intergenic
1123479012 15:20613986-20614008 GTGCAGAGGCAGGGGCAGCACGG + Intergenic
1123639000 15:22386399-22386421 GTGCAGAGGCAGGGGCAGCACGG - Intergenic
1124854908 15:33378317-33378339 TGGGACAGGCAGAGGGGACATGG - Intronic
1124891502 15:33737948-33737970 GGGCACGGGGAGTGGGGGCAAGG + Intronic
1124892376 15:33745118-33745140 GGGTACAGGCAGTGGTGTCAAGG + Intronic
1126088917 15:45034699-45034721 GAGCCCAGGCAGAGGAGGCGCGG - Intronic
1126596899 15:50392127-50392149 TGGCACACGCAGAGAGGGCATGG + Intergenic
1126849790 15:52789923-52789945 GTGGCCAGGCAGAGGCGGCGAGG + Exonic
1127774179 15:62252715-62252737 GGGCAGAGACACAGGCGTCAGGG + Intergenic
1127891318 15:63254032-63254054 GGGCACAAGCTGAGGCTGAAGGG - Intronic
1128081042 15:64857033-64857055 GGTCACAGGCAGACGCTGCCAGG + Intronic
1128325649 15:66722471-66722493 GGGGATAGGCAGAGTGGGCATGG - Intronic
1128345005 15:66848081-66848103 GGGCTTAGGCTTAGGCGGCAGGG - Intergenic
1128556925 15:68638116-68638138 GGGCCCAGGGAGAGGCTGCCAGG + Intronic
1128687354 15:69696654-69696676 GGGCAGAGGCAAAGGGCGCAGGG + Intergenic
1128701941 15:69811112-69811134 GAGGAAAGGCAGAGGAGGCAGGG - Intergenic
1129116453 15:73367931-73367953 GGGCGGCGGCAGCGGCGGCACGG - Exonic
1129184892 15:73899986-73900008 GGAGACAGGCAGAGGGGGCGGGG - Intergenic
1129273894 15:74433294-74433316 GGGCGCAGGCTGGGCCGGCAAGG - Intronic
1129314260 15:74731682-74731704 GGGCACAGGCAGGAGAGGAAGGG - Intergenic
1129374080 15:75116441-75116463 GAGCCCAGGCAGAGGAGGCGCGG + Intronic
1129467994 15:75734530-75734552 TGGCCCAGGCAGAGGTGGCCTGG - Intergenic
1130056215 15:80528180-80528202 GGCCACAGGCGGGGGTGGCAAGG + Intronic
1130766562 15:86877161-86877183 GAGCACAGGAAGAGTGGGCAGGG - Intronic
1130984752 15:88837505-88837527 GGGTACAGCCAGGGGCTGCATGG - Intronic
1131264288 15:90906541-90906563 AGGCACAGGCAGGGGCTGTAAGG + Intronic
1131310478 15:91285891-91285913 GGGCACAGGGGCAGGCGGGACGG + Intronic
1131524253 15:93139973-93139995 GGAGACAGGCAGGGCCGGCAGGG + Intergenic
1132072957 15:98796014-98796036 TGGAGCAGGCAGAGACGGCACGG - Intronic
1132391083 15:101438699-101438721 AGGGACAGACAGAGTCGGCAGGG - Intronic
1132651157 16:1021974-1021996 GGGGACAGGAACAGGCGCCAGGG - Intergenic
1132667672 16:1089532-1089554 GGCGACAGGCAGAGCTGGCAGGG + Intergenic
1133116600 16:3581105-3581127 GGGCACGGGCTGAGGGGCCACGG + Intergenic
1133130965 16:3675914-3675936 GTGCACAGGCAGAGCCGTGAAGG - Intronic
1133915959 16:10110200-10110222 TGGCACACGCAGAGGCTACAGGG + Intronic
1134208947 16:12259928-12259950 GGGCAGAGGCAGAGGCAGCGGGG - Intronic
1134404581 16:13945230-13945252 GGGGAGAGGCAGAGGAGGGAAGG - Intronic
1135105580 16:19646329-19646351 AGGCACAGACAGAAGCAGCAAGG + Intronic
1135429899 16:22374346-22374368 GGGCAGCGGCTGAGGCGGGACGG - Exonic
1136512593 16:30748464-30748486 GGGGGCAGGCAGAGGAGCCAGGG - Exonic
1137270964 16:46901955-46901977 GGGGCCAGGCAGAGGGTGCAGGG - Intronic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1137708142 16:50549046-50549068 GGGGGCAGGAAGAGGGGGCAGGG - Intronic
1138097446 16:54223204-54223226 GGGCCCAGGCAGAAGTTGCAAGG - Intergenic
1138580382 16:57937233-57937255 GGGCAGAGGCAGAGGCCACCTGG + Intronic
1139387220 16:66580322-66580344 GGGCCCAGGCAGAGGCAGCTGGG + Intronic
1139442237 16:66974145-66974167 GAGCCCAGGCAGAGGCGGCAGGG - Exonic
1139916781 16:70433290-70433312 GGGGACAGGGAGAGGAGGGAGGG - Intronic
1139919666 16:70451291-70451313 GAGCCCAGGCAGAGGAGGCGCGG + Intergenic
1141206416 16:81936321-81936343 CCGCACAGCCAGAGGCGGAAGGG - Exonic
1141827983 16:86494314-86494336 GGGCGCAGGCACAGCCGGAAAGG + Intergenic
1141919350 16:87125742-87125764 GGGCACGGCCGGAGGCTGCACGG - Intronic
1141999001 16:87653313-87653335 GGGGACAGGCAGGGGCCCCAAGG - Intronic
1142005447 16:87687622-87687644 AGGCACAGGAAGAAGCTGCAGGG + Intronic
1142058502 16:88015305-88015327 GGGCACGAGCTGAGGGGGCACGG - Intronic
1142111627 16:88335049-88335071 GGGCACAGGAAGAGGCAGGGAGG + Intergenic
1142156494 16:88534783-88534805 GGGCGCCGGCGGGGGCGGCACGG - Exonic
1142299269 16:89247258-89247280 GGCCTGAGGCAGAGGCGCCAGGG + Intergenic
1142318352 16:89364186-89364208 GGGCACAGGTGGAAGTGGCAGGG - Intronic
1142549896 17:732288-732310 GGGCCCAGGCGGAGGCGGGAAGG - Intergenic
1142595670 17:1028755-1028777 GGACTCAGGCTGAGCCGGCAGGG - Intronic
1142961283 17:3553880-3553902 GGATACAGGCAGAGGAGGCAGGG + Intronic
1143184133 17:5000378-5000400 GGGCACAGGCAGGGAAGGCCGGG + Intronic
1143387447 17:6540098-6540120 GGGCAGAGGGAAAGGCTGCAGGG + Intronic
1143480843 17:7226557-7226579 GGCCCCAGGCAGAGGAGCCAGGG + Exonic
1143729412 17:8872512-8872534 GGGCAGAGGGAGAGGAAGCAGGG - Intergenic
1143812532 17:9483866-9483888 GGGCACAGGCAGGGTGGGAATGG + Intronic
1144044877 17:11446427-11446449 AGGGGCAGCCAGAGGCGGCAGGG - Intronic
1144851401 17:18245889-18245911 GGGCACACACAGAGGAGCCAGGG - Intronic
1145005233 17:19333915-19333937 GGGCAGAGGCTGAGCCGTCAGGG - Intronic
1145005857 17:19337368-19337390 AGGCCGAGGCAGAGGCGGCTGGG + Intergenic
1145121348 17:20263086-20263108 GGGCAGAGGCAGAGTGGACAGGG - Intronic
1145262655 17:21364101-21364123 GGCCCCAGGCTGAGGCAGCAAGG - Intergenic
1145366208 17:22268738-22268760 TGGTACAGGCAGAGACGGCCTGG - Intergenic
1145904733 17:28509841-28509863 GGGCCAAGGAAGAGGGGGCATGG + Intronic
1145934053 17:28704757-28704779 GGACACAGTCAGAGGCGAAAGGG + Exonic
1145934221 17:28705573-28705595 GGGCACAGGAAGAAGCTGCTGGG + Intronic
1146185981 17:30724536-30724558 GGGGACAGGCTGAGGCTGCAGGG + Intergenic
1146306172 17:31731322-31731344 GGGGACAGCCAGAGGCAGCCTGG - Intergenic
1146465132 17:33080188-33080210 GGGCCAAGGCAGAGTGGGCAGGG + Intronic
1146573289 17:33970735-33970757 GAGCACACGCAGAGCCAGCAGGG + Intronic
1147629080 17:41918597-41918619 TGGCAGAGGCAGAAGAGGCAAGG + Intronic
1148178080 17:45584879-45584901 GGGCAGCGGCAGCGGCGGCGGGG + Intergenic
1148558836 17:48594471-48594493 GCGCCCAGGCCGAGCCGGCAGGG + Intronic
1149660777 17:58332978-58333000 GAGCACACGCAGAGGAGCCAGGG - Intergenic
1149840935 17:59964567-59964589 GGGCAGAGGAGGAGGCGGCGAGG - Intronic
1150004694 17:61462530-61462552 GGGCATAGGGAGAGGGTGCAGGG + Intronic
1150322967 17:64231932-64231954 GTCCACAGGCTGAGTCGGCACGG - Intronic
1150373577 17:64662129-64662151 GGGCGCGGGCGGAGGCGGCGCGG - Intergenic
1150574300 17:66416408-66416430 GTACACAGGCAGAGGTGGCTAGG + Intronic
1150725729 17:67649925-67649947 TGGCACACCCAGAGGGGGCACGG - Intronic
1150830161 17:68511990-68512012 GAGAAAAGGCAGAGGCGTCAAGG + Intronic
1150998982 17:70351920-70351942 GGGCACAGGATGGGGGGGCATGG - Intergenic
1151235930 17:72719821-72719843 GGGCAGTGGCAGAGGAGGAAAGG + Intronic
1151378997 17:73711925-73711947 GGGCAGGGGCAGAGGCTGCCTGG + Intergenic
1151605974 17:75136177-75136199 GGGCACAGGCGCAGCAGGCACGG + Exonic
1151656793 17:75499899-75499921 AGGCACAGGAAGAGGCTCCAGGG - Exonic
1151782753 17:76258144-76258166 GAGCCCAGGCAGAGGAGGCGCGG + Intergenic
1152023555 17:77794653-77794675 GGAGACAGGCAGAGGGAGCAAGG + Intergenic
1152395558 17:80030761-80030783 GGGCAGAGGCAGAGGCAGGCAGG + Intronic
1152524569 17:80880121-80880143 GGGTGCAGGCAGGGGCTGCAGGG + Intronic
1153766411 18:8378943-8378965 GGCCAGAGGCAGAGGCGTAAGGG - Intronic
1154323494 18:13372868-13372890 GAGCAGGGGCCGAGGCGGCATGG + Intronic
1156171901 18:34494659-34494681 GGGCGCAGGGGGAGGGGGCAGGG + Intronic
1156255413 18:35391220-35391242 GGCCACATGGAGAGGCAGCATGG - Intergenic
1156463963 18:37336993-37337015 GAGCACAGCCGGAGGCGGCCAGG - Intronic
1157271581 18:46280384-46280406 GGAGACAAGCAGAGGGGGCAGGG - Intergenic
1157521326 18:48347553-48347575 GGCCCAAGGCAGAGGCAGCAGGG - Intronic
1158450210 18:57557464-57557486 GGCCACGGTCAGAGGAGGCAAGG + Intronic
1160004857 18:75062130-75062152 GGGCCCAGGCAGAGGCAGGAAGG - Intronic
1160090414 18:75821501-75821523 TGGCGCAGGCAGAGGAGCCATGG - Intergenic
1160200886 18:76794298-76794320 GGGGACAGGAAGAAGCAGCATGG - Intergenic
1160551539 18:79696609-79696631 GGGCACATGCAGGGGCGGGTTGG + Intronic
1160739371 19:678944-678966 GGGGTCAGGCAGAGGAGCCAAGG + Intronic
1160927772 19:1555439-1555461 GGGCGGAGGCCGAGGGGGCAGGG - Exonic
1160967877 19:1754466-1754488 CGGCACAGGCAGCGGCGGAGCGG + Exonic
1161179203 19:2867910-2867932 AGGCCCAGGCAGGGGCGGCTGGG - Intronic
1161485713 19:4534749-4534771 GGGCCCAGGCAGGGGCCGCAGGG - Intronic
1161566623 19:5006185-5006207 GGGGACAGGGAGAGGCTGCGGGG - Intronic
1161576474 19:5057230-5057252 GGCCACAGGCACACGCGGCCTGG - Intronic
1161683747 19:5693205-5693227 TGGCCCAGGCAGAGGTTGCATGG + Intronic
1162013937 19:7833576-7833598 GGTCACAGGCAGGCGTGGCAGGG + Intronic
1162372932 19:10289868-10289890 GGGCGGCGGCAGAGGCGGCGGGG - Intergenic
1162396633 19:10421043-10421065 TGGCACCGGCAGCGGCGGCGCGG + Exonic
1162432043 19:10634944-10634966 GGGCAAAGGCTGAGCCGGCTGGG - Intronic
1162731421 19:12721215-12721237 GGCCACAGGCGGCGGCGGCGGGG + Intronic
1162894787 19:13758791-13758813 GGAAGCAGGCAGAGGCGACAGGG + Intronic
1162972796 19:14191195-14191217 GGGGACAGGCTGAGGCTGGAGGG - Intronic
1163146178 19:15380332-15380354 GGGCGCAGGGCGAAGCGGCAGGG - Exonic
1163247731 19:16107647-16107669 AGGCAGAGGCAGAGGTGGTAGGG + Intergenic
1163332584 19:16650417-16650439 GGGCACAGGGAGATTGGGCACGG + Intronic
1163364590 19:16868947-16868969 GGGCAGAGGCAGAGAGGTCACGG + Intronic
1163699116 19:18778252-18778274 AGGTACAGGCAGAGGTGGCCAGG + Exonic
1163819018 19:19485582-19485604 GGGCTCAGGCAGAAGCTGCAAGG + Intronic
1163825225 19:19519761-19519783 GGACAGAGGGAGAGGAGGCAGGG - Intronic
1164658641 19:29942702-29942724 GAGCACAGGCAGGGGCAGCCCGG - Intronic
1165472057 19:36009539-36009561 GGGCGGAGGCCGAGGCTGCAGGG + Exonic
1165734873 19:38169829-38169851 AGGCCCAGGCAGAGGGGTCAGGG + Intronic
1165734907 19:38169929-38169951 GGGCCCAGGTAGAGGGGCCAGGG + Intronic
1165734919 19:38169961-38169983 GGGCCCAGGTAGAGGGGCCAGGG + Intronic
1165734931 19:38169993-38170015 GGGCCCAGGTAGAGGGGCCAGGG + Intronic
1165742302 19:38211397-38211419 GGGCACAGGCTGGGGCGGTCGGG + Intronic
1165746558 19:38233354-38233376 GGACACAGGCAGAGGGGTCGGGG + Intergenic
1165746570 19:38233389-38233411 GGACACAGGCAGAGGGGTCTGGG + Intergenic
1165746627 19:38233557-38233579 GGACACAGGCAGAGGGGTCCGGG + Intergenic
1165746643 19:38233591-38233613 GGGCACAGGCAGAGGGGTCGGGG + Intergenic
1165746653 19:38233626-38233648 GGACACAGGCAGAGGGGTCCGGG + Intergenic
1165746668 19:38233660-38233682 GGGCACAGGCAGAGGGGTCGGGG + Intergenic
1165792502 19:38500450-38500472 GGGCACAGGCAGAGGAACGAGGG + Intronic
1165798476 19:38532958-38532980 AGGCTCAGGCAGAGGGGTCAGGG + Intronic
1165798486 19:38532993-38533015 AGGCTCAGGCAGAGGGGTCAGGG + Intronic
1165798497 19:38533028-38533050 GGATACAGGCAGAGGGGTCAGGG + Intronic
1165804603 19:38572810-38572832 AGGCACAGGCAGGGGTGTCAGGG - Intronic
1165804612 19:38572845-38572867 GGGCACAGGCAGAGCAGTCGGGG - Intronic
1165804638 19:38572945-38572967 AGGCACAGGCAGGGGGGTCAGGG - Intronic
1165806513 19:38584242-38584264 GGGCACAGGCAGAAGGGTGAGGG - Intronic
1165806557 19:38584353-38584375 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806577 19:38584420-38584442 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806592 19:38584457-38584479 GGGTACAGGCAGAAGGGTCAGGG - Intronic
1165806603 19:38584490-38584512 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806615 19:38584524-38584546 GGGCACAGGGAGAGGGGTCAGGG - Intronic
1165806629 19:38584558-38584580 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806655 19:38584626-38584648 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806668 19:38584661-38584683 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806681 19:38584694-38584716 GGGCGCAGGCAGAGGGGTCAGGG - Intronic
1165843804 19:38805433-38805455 GGGCACAGGCAGAGGGGCAGGGG - Intronic
1165893852 19:39130133-39130155 GGACCCAGGCAGAGGGGTCAGGG + Intronic
1165906956 19:39200075-39200097 GAGCACGGGCAGAGGGGTCAGGG - Intronic
1165936750 19:39393917-39393939 AGGCACAGGCAGAGGGATCAGGG + Intronic
1165955396 19:39499156-39499178 GGGCGCAGGGTGAGGCGGCCGGG - Intronic
1165999192 19:39867795-39867817 GGGCATAGGCAGAGGGGTCAGGG + Intronic
1165999619 19:39870645-39870667 AGGCACAGGCAGAGGGGTCAGGG + Intronic
1165999630 19:39870679-39870701 GGGCAAAGGCAGAGGGGTCAGGG + Intronic
1165999708 19:39870916-39870938 GGGCACAAGCAAAGGGGTCAGGG + Intronic
1165999723 19:39870950-39870972 GGGCAAAGGCAGAGGGGTCAGGG + Intronic
1165999749 19:39871018-39871040 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1165999761 19:39871050-39871072 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1165999775 19:39871085-39871107 GGGCACAGGCAAAGGGGTCAGGG + Intronic
1166007905 19:39919718-39919740 AGGCCCAGGCAGAGGGGTCAAGG + Intronic
1166036302 19:40170636-40170658 GAGCCCAGGCAGAGGAGGCGCGG + Intergenic
1166044135 19:40219558-40219580 AGGCACAGGCAGAGGGGTCGGGG + Intergenic
1166069036 19:40377058-40377080 GAGCACAGGCAGAGGGGTCAGGG + Intronic
1166069073 19:40377158-40377180 GGGCACAGGCAGAGGGGTCGGGG + Intronic
1166069126 19:40377296-40377318 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1166069137 19:40377331-40377353 AGGTACAGGCAGAGGGGTCAGGG + Intronic
1166069151 19:40377365-40377387 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1166069162 19:40377400-40377422 AGGCCCAGGCAGAGGGGTCAGGG + Intronic
1166069178 19:40377434-40377456 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1166116973 19:40662307-40662329 GGGCACAGGCAGAGGGGTCGGGG + Intergenic
1166117395 19:40664088-40664110 AGGCACAGGCAGATGGGTCAGGG + Intergenic
1166120121 19:40681280-40681302 AGGCCCAGGCAGAGGGGTCAGGG + Intronic
1166120134 19:40681315-40681337 AGGCACAGGCAGAGGGGTCAGGG + Intronic
1166137389 19:40785980-40786002 GAACACAGGCAGAGGGGTCAGGG + Intronic
1166137432 19:40786110-40786132 GGGCCCAGGTAGAGGGGTCAAGG + Intronic
1166137785 19:40787639-40787661 GGGCACAGGCAGAGGGATCAGGG + Intronic
1166229148 19:41415466-41415488 GGACTCATGCAGAGGCAGCATGG + Intronic
1166339807 19:42130897-42130919 AGGCCCAGGCAGAGGGGTCAGGG - Intronic
1166339834 19:42130966-42130988 AGGCTCAGGCAGAGGGGTCAGGG - Intronic
1166339874 19:42131070-42131092 GGGCACAGGCAGAGGTGTCGGGG - Intronic
1166339901 19:42131138-42131160 AGGCCCAGGCAGAGGGGTCAGGG - Intronic
1166423967 19:42659570-42659592 GGGACCAGGCAGAGGTGGCCAGG + Intronic
1166945009 19:46390978-46391000 GGGCAGAGGCAGAGGCCACTTGG - Intronic
1167166440 19:47802848-47802870 GTGCGGAGGCAGAGGCTGCAGGG + Exonic
1167322553 19:48805851-48805873 GGGGACAGCCAGGGGAGGCATGG - Intronic
1167354734 19:48996395-48996417 GGAGAGAGGCAGAGGCTGCAGGG - Intronic
1167429482 19:49446388-49446410 AGGCACCGGCAGAAGCGGCATGG + Exonic
1167603545 19:50467906-50467928 GGGCAGAGGGAGGGGTGGCAAGG - Intronic
1168078740 19:53994046-53994068 GGGCACATGCAGAGTGGGCACGG - Intronic
1168520910 19:57049852-57049874 GGGCCCAGGCAAAGACAGCATGG + Intergenic
1168706706 19:58474475-58474497 GGGCACAAGCAGACGTGGAAAGG - Intronic
925261904 2:2536389-2536411 GAAGTCAGGCAGAGGCGGCAAGG - Intergenic
925379387 2:3414684-3414706 GGGCAGAGGCACAAGCGGCACGG - Intronic
925411411 2:3641939-3641961 GGGGACAGGCAGAGGCTGCTGGG + Intronic
925411771 2:3643649-3643671 AGGCACAGCCACAGGCAGCAGGG - Intronic
925971743 2:9111040-9111062 GCGCACAGGGTGAGGCAGCAAGG + Intergenic
926077393 2:9951991-9952013 GGGCAAAGGCCGTGGCGGCGTGG - Intronic
926107345 2:10160625-10160647 GGGCAGAGGCAGAGGGGAGAGGG - Intronic
926152793 2:10434269-10434291 GGGCAGAGGGAGGGGCTGCAGGG + Intergenic
926444609 2:12927005-12927027 GAGCCCAGGCAGAGGAGGCGCGG + Intergenic
926686007 2:15698073-15698095 AGGCAGAGGCAGAGGCAGAATGG + Intronic
927326594 2:21812447-21812469 GGGCACAGGCTGTGTCTGCATGG + Intergenic
927518071 2:23683390-23683412 GGGGGCAGGCAGATGAGGCAAGG + Intronic
927800479 2:26094492-26094514 GTTCAGAGGCTGAGGCGGCAGGG - Intronic
929923226 2:46188506-46188528 GGGCACAGACATGGGCTGCATGG - Intergenic
930033908 2:47073954-47073976 GGCCAGAGGGAGAGGCAGCAGGG + Exonic
930124060 2:47782943-47782965 GGGCCCAGGCGTCGGCGGCAGGG + Intronic
930239525 2:48921712-48921734 GTGCACAAGCTGAGGAGGCATGG - Intergenic
933354394 2:81195475-81195497 GGGCACAGAGGGATGCGGCAGGG + Intergenic
933712221 2:85334846-85334868 GAGCCCAGGCAGAGGAGGCACGG + Intergenic
934239003 2:90251857-90251879 GGGCACAAGCAGAGCAGGCTAGG - Intergenic
934564650 2:95331582-95331604 GGGCGCAGGCAGCGGGAGCAAGG - Intronic
936346807 2:111681715-111681737 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
937311715 2:120906891-120906913 CGGGAAGGGCAGAGGCGGCAAGG - Intronic
937523739 2:122742125-122742147 TGGCACAGGCAGAGATGGAATGG + Intergenic
938539142 2:132272314-132272336 GGCCACAGGGAAAGGTGGCAGGG + Intergenic
938697965 2:133851756-133851778 GGGCACAGGAAGAGGAGTCCTGG - Intergenic
939229679 2:139410206-139410228 GAGCCCAGGCAGAGGAGGCACGG - Intergenic
940767872 2:157809522-157809544 GGAGACAGGGAGAGGAGGCAGGG + Intronic
942042312 2:172078907-172078929 GGGGACAGGGAGAGGGGGCGAGG + Intronic
942095996 2:172537156-172537178 AGGCAGAGGCAGAGGCAGAAAGG - Intergenic
945955800 2:216084731-216084753 GGGCACAGGAAGAGGCGGGGTGG + Intronic
946410484 2:219513004-219513026 GGGGCCAGGCAGAGGCTGCGGGG + Intergenic
947533692 2:230928052-230928074 AGGCACAGGCAGGAGGGGCACGG + Intronic
947650543 2:231782493-231782515 GGGGACAGGCAGAGGAAGGAAGG - Intronic
947703532 2:232256020-232256042 GGGCAAGAGCAGAGGCTGCAAGG - Intronic
947773311 2:232687969-232687991 GTGGACAGGCAGAGTCAGCAAGG - Intergenic
948136403 2:235639428-235639450 GGGCAGAGGAAGAGGAGGCTGGG + Intronic
948159733 2:235814051-235814073 GGGCACACACACAGGCGGCTGGG - Intronic
948670150 2:239563403-239563425 GGGCTCAGGCCAAGGCAGCAAGG - Intergenic
948717391 2:239874209-239874231 GGGCCCAGGCAGAGGCAGGTGGG - Intergenic
948783334 2:240338335-240338357 GGGTCCAGGCAGAGGTGCCATGG + Intergenic
948786728 2:240356546-240356568 GGGCACAGGGAGAGGCAGCCAGG + Intergenic
948806749 2:240456359-240456381 GGGCACAGGAGGAGCCGGCGGGG + Intronic
948983609 2:241507619-241507641 CGGCCCAGGCCGAGGCCGCAGGG + Intronic
1169082276 20:2804931-2804953 GGGCCCAAGAAGAGGCGGCACGG + Intergenic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1170646697 20:18202996-18203018 GAGCACTGGCAGTGGCAGCATGG + Intergenic
1170743438 20:19077916-19077938 AGGCCCAGGCTGAGGGGGCAGGG + Intergenic
1170806926 20:19640129-19640151 GAGCCCAGGCAGAGGAGGCGCGG + Intronic
1170958570 20:21003986-21004008 GGGAACAGGGAGGGGAGGCAGGG + Intergenic
1171339062 20:24412899-24412921 TGGCAGAGGCAGAGGCAGAAGGG - Intergenic
1171387636 20:24780882-24780904 GGCCACAGGCAGAGGCAGAAGGG + Intergenic
1172010479 20:31843279-31843301 GGGCATAGGGAGAGGAGGGAGGG - Intergenic
1172749178 20:37237815-37237837 GGGCCCAGGCAGGTGCTGCAAGG - Intronic
1173000830 20:39104489-39104511 GGTCACAAGCAGAGGAGGTAGGG + Intergenic
1173092383 20:39985582-39985604 GGGAAGAGGCTGAGGAGGCAAGG - Intergenic
1173350732 20:42243024-42243046 AGGCAGAGGCAGAGGCAGAAAGG + Intronic
1173582178 20:44155031-44155053 GGGCACAGGCATTGGCAGGAAGG + Intronic
1173845111 20:46183243-46183265 GGGAAAAGGCTGAGGCAGCAGGG - Intronic
1174258692 20:49277930-49277952 GGGCAGAGGCAGTGGCGGGTCGG + Intronic
1175246087 20:57582958-57582980 GGGCACAGGCTGAGGGGTCTGGG + Intergenic
1175951796 20:62587621-62587643 GGGCACAGGCAGACAAGGCCCGG + Intergenic
1175981518 20:62741093-62741115 CAGCACAGGTAGAGGAGGCAAGG + Intronic
1176038618 20:63052524-63052546 GGGCAGAGGAAGAGGCAGAAAGG + Intergenic
1176150839 20:63590005-63590027 GGGAGCGGGCAGAGGCCGCAGGG - Exonic
1176238223 20:64063977-64063999 GGGAAGAGGCAGGGGAGGCACGG - Intronic
1176247088 20:64102472-64102494 GGGACCAGGCAGATCCGGCACGG - Intergenic
1176332351 21:5560085-5560107 GAGCCCAGGCAGAGGAGGCCCGG + Intergenic
1176395406 21:6260866-6260888 GAGCCCAGGCAGAGGAGGCCCGG - Intergenic
1176441751 21:6728238-6728260 GAGCCCAGGCAGAGGAGGCCCGG + Intergenic
1176466013 21:7055307-7055329 GAGCCCAGGCAGAGGAGGCCCGG + Intronic
1176489574 21:7437085-7437107 GAGCCCAGGCAGAGGAGGCCCGG + Intergenic
1176742379 21:10616340-10616362 GGGCTGAGGCAGAGGTGGAATGG - Intergenic
1178196317 21:30348651-30348673 GGGCACAGGCAGGGACATCAGGG - Intronic
1178437031 21:32569226-32569248 GGGCACAAGCAGAGGAGGAAAGG + Intergenic
1179502109 21:41816402-41816424 GGGCACAGGCATGTGCGGCTTGG + Intronic
1179557701 21:42191016-42191038 GAGCAGAGCCAGAGGCGGCCAGG - Intergenic
1179731351 21:43369452-43369474 GGGGAGAGGCAGGGGCTGCAGGG + Intergenic
1180012581 21:45060586-45060608 CTTCACAGGCAGAGGCGTCAGGG - Intergenic
1180054729 21:45351878-45351900 GGGCACGGGCTGAGGATGCAGGG + Intergenic
1180558975 22:16601155-16601177 GGACACACGCCGAGGCGGCGCGG - Intergenic
1180614801 22:17120297-17120319 GGGCAGATGCAGGGGCGGCGCGG + Exonic
1180741124 22:18053852-18053874 GAGCCCAGGCAGAGGAGGCACGG + Intergenic
1180934931 22:19619229-19619251 GGGTACAGGGAGAGGAGGTATGG - Intergenic
1180990595 22:19933495-19933517 GGGCACAGTGCGAGGCTGCAGGG - Intronic
1181097206 22:20513710-20513732 GGGCACAGGAGGTGGTGGCAGGG - Intronic
1181354806 22:22291557-22291579 GGGCACAAGCAGAGCAGGCTAGG + Intergenic
1181609955 22:24005619-24005641 GGGCACAGGCACACGTGGAAGGG - Intergenic
1182462042 22:30490080-30490102 GTGCACAGGTAGAGGTGGCTGGG + Exonic
1183194320 22:36343029-36343051 GGGCACAGGTGGAGGGGGCTGGG - Intronic
1183301061 22:37059444-37059466 GGACACAGGCTGAGGCGGGTGGG - Intronic
1183540084 22:38424784-38424806 GGGCAAAGGTAGAAGCTGCAAGG - Intergenic
1183630401 22:39029173-39029195 GGGTACTGGCAGGGGCAGCAGGG - Intronic
1183667453 22:39253913-39253935 AGGCACAGGCAAAGGCCCCAGGG - Intergenic
1183969991 22:41469408-41469430 GGGCCCAAGCAGCGGCGGCCGGG + Intronic
1184088211 22:42278589-42278611 GGGCACAGGAGGAGGCTGCCTGG + Intronic
1184117052 22:42428289-42428311 AGGCACAGGCAGAGGTGGGCGGG - Intronic
1184411447 22:44328691-44328713 GGGCACAGGGAGAGGCAGTTTGG - Intergenic
1184505995 22:44903005-44903027 GGGGAGAGGCAGAGGAGGCGTGG - Intronic
1184691979 22:46121603-46121625 GGGCAGAGGCAGGGGTGGCAGGG + Intergenic
1184794355 22:46722947-46722969 GGGGAGAGGCAGAGGCCGCTGGG + Intronic
1184920217 22:47600655-47600677 GTGCAGAGGCTGAGGGGGCAGGG - Intergenic
1184997813 22:48223273-48223295 GGGCAGTGGGAGAGTCGGCAGGG - Intergenic
1185058040 22:48591483-48591505 GAGCACAGACAGAGGCAGCTGGG + Intronic
1185301401 22:50083050-50083072 GGGCACTGGCAGAGGCGTGGAGG + Intronic
1185335484 22:50269370-50269392 GCGCAAAGGCAGAGGCAGCCAGG - Intronic
950305927 3:11915368-11915390 GGCCACAGGCAGAGGGGTCCTGG + Intergenic
950496528 3:13337344-13337366 GGGCACAGGCGGAGGCAAGACGG + Intronic
951146657 3:19234738-19234760 GAGCCCAGGCAGAGGAGGCGCGG + Intronic
952747166 3:36792350-36792372 GGGCATAGCCAGAGGAGGAAGGG + Intergenic
953906719 3:46872147-46872169 GGGCACAGGCTGAGGCAGTGGGG - Intronic
954365582 3:50144445-50144467 TGGCCGAGGCAGAGGCAGCAGGG - Intergenic
954752373 3:52820933-52820955 GGGGGCAGGCACAGGTGGCACGG - Intronic
954795070 3:53157158-53157180 GGGCAGGGGCAGAGGAGCCAGGG + Intronic
955952820 3:64259424-64259446 GGTCCCAGGAAGAGGCAGCAAGG - Intronic
955976975 3:64489180-64489202 GGGTATGGGCAGAGGTGGCAAGG - Intergenic
957794180 3:84981629-84981651 GGACAGAGGCAGAGGAGGAAAGG - Intronic
961042229 3:123685738-123685760 AGGCAGAGGCAGATGGGGCAGGG - Intronic
961450982 3:127002200-127002222 GGGCAGGGGAAGAGGCGGCCAGG - Intronic
961716600 3:128861801-128861823 GTGCACTGGCAGAAGCTGCAGGG - Intergenic
961805092 3:129483584-129483606 GTGCACCGGCAGAAGCTGCAGGG + Exonic
962298486 3:134215329-134215351 GGGCACAGGGAGAGGTGCAAAGG + Intronic
963590048 3:147246048-147246070 GAGCCCAGGCAGAGGAGGCGCGG + Intergenic
963674241 3:148288307-148288329 TGGCACAGGCAGGGAGGGCATGG - Intergenic
966235899 3:177701114-177701136 GGCCACAGGCCGAGGCTGGAGGG - Intergenic
966814428 3:183878259-183878281 GGGCAAAGGCAAAAGCTGCAAGG + Intronic
966852237 3:184171333-184171355 AGGCACAGGCAGGGATGGCATGG - Exonic
967190905 3:186984286-186984308 GGGAACAGGAATAGGGGGCAGGG - Intronic
967931132 3:194691095-194691117 GGGCACAGACGGAGGAGGAAGGG - Intergenic
968083559 3:195863753-195863775 GGCCACAGGGAGAGGCGGACCGG - Exonic
968462663 4:733081-733103 GGGCAGGGGCGGAGGCAGCACGG - Intronic
968516816 4:1018961-1018983 AGGCACGGGCAGAGGCAGCTGGG - Intronic
968617476 4:1584785-1584807 GAGGACAGGCAGAGGCTGCATGG + Intergenic
969455425 4:7297327-7297349 GAGGACAGGCAGAGGCAGAAGGG - Intronic
969468405 4:7371257-7371279 GGGCGCAGGCAGCTGCGGGACGG - Intronic
969529443 4:7722572-7722594 GGGCACGGACAGAGGCTGCGTGG - Intronic
969593150 4:8133258-8133280 GGTCACATGCAGAGGGGTCAGGG + Intronic
970741888 4:19249437-19249459 AGGTACAGGCAGATGCTGCAGGG + Intergenic
973827497 4:54723334-54723356 TGGCTGAGGCAGAGGTGGCAGGG - Intronic
974174131 4:58304393-58304415 GGGCACTGGCAGAAGTGGCCTGG + Intergenic
974779157 4:66528979-66529001 GGGCAGAGGCAGAGCCCTCATGG + Intergenic
975122323 4:70742488-70742510 TGGCACAGGCGGAGGGGGAAGGG - Intronic
976380710 4:84395017-84395039 GGAGACAGGCAGATGGGGCAAGG + Intergenic
976406310 4:84664583-84664605 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
976690024 4:87858972-87858994 GGGCAGAGGCAGAAGCCGCAAGG + Intergenic
977917916 4:102614202-102614224 GGGCACAGGCACAGGTGGGCTGG - Intronic
978619696 4:110626283-110626305 GTGCACAGGCATAGGCAGCATGG + Intronic
979688506 4:123537783-123537805 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
980043459 4:127964732-127964754 GAGCCCAGGCAGAGGAGGCCTGG + Intronic
980068995 4:128222810-128222832 GGCCACAGGCAGAGCCCGCAGGG + Intronic
980115145 4:128672528-128672550 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
980920899 4:139084411-139084433 CGGCAGGGGCAGGGGCGGCAGGG + Intronic
981504226 4:145482172-145482194 GGGCGCGGGCAGCGGCGGGAAGG + Intronic
982767864 4:159368651-159368673 GGCCACAGGCAGGGGCTGAAGGG + Intergenic
982868885 4:160550615-160550637 GAGTCCAGGCAGAGGAGGCACGG + Intergenic
983026020 4:162739406-162739428 GAGCATAGGCAGAGGAGGCGCGG - Intergenic
983060264 4:163152711-163152733 GAGCATAGGCAGAGGAGGCGCGG - Intronic
983064161 4:163190200-163190222 GAGCCCAGGCAGAGGAGGCGCGG + Intergenic
983230735 4:165126432-165126454 GAGCCCAGGCAGAGGAGGCGCGG + Intronic
983379117 4:166968684-166968706 CTGCACAGGCAGAGGCCTCATGG + Intronic
983554902 4:169051310-169051332 GGGCAGAGGAAGAGGCAGCTGGG - Intergenic
983700353 4:170585003-170585025 AGCCACAGGCAGAGGTGACAGGG - Intergenic
985515875 5:344257-344279 CGGCAGAGGCGGAGGCGGCGGGG + Intronic
985622929 5:965003-965025 AGGCACAGGCAGAACCAGCACGG + Intergenic
985777258 5:1851347-1851369 GGGCGCAGGAGGAGGCTGCAGGG - Intergenic
986172750 5:5327156-5327178 GGCCATTGGCAGAGGCAGCAAGG + Intergenic
987543755 5:19287610-19287632 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
988497020 5:31754171-31754193 GGCTGCAGGCAGAGGCTGCAAGG - Intronic
990041624 5:51383760-51383782 AGGCACAGGCTGAGGTGCCAAGG + Intronic
990307011 5:54503709-54503731 TGGCACAGGCAGTGGCAGGACGG - Intergenic
991405483 5:66297119-66297141 GGGCACGGGCAAAGGAGGAAAGG - Intergenic
994353774 5:98773600-98773622 GGGCACAGGGCGGGGCGGGACGG + Intronic
995528260 5:113068020-113068042 GGGCAGAAGCAAAGGAGGCAGGG + Intronic
997524567 5:134544060-134544082 GGGCAGAGACACAGGCGGAAGGG + Intronic
997596958 5:135113477-135113499 GGGCAGGGGCAGAGGCGGGCAGG - Intronic
998043501 5:138968450-138968472 GCGCTCAGGCAGAGGCGGTGGGG - Intronic
998365828 5:141630152-141630174 GGGCCCAGACAGAGGCAGGAGGG - Intronic
998465745 5:142342421-142342443 GGGCACAGTCAGTGGCTGCTTGG + Intergenic
1000329515 5:160195999-160196021 GGGTCCAGGCAGAGGGGACATGG + Intronic
1000634797 5:163631726-163631748 GGGCAAAGGTAGAGGAGGCATGG + Intergenic
1001372901 5:171224185-171224207 GGCTACAGGCAGAGGAAGCAGGG - Intronic
1001434219 5:171686839-171686861 GGGGACAGACAAAGGAGGCAGGG + Intergenic
1002043743 5:176530983-176531005 GGGCACAGGCAGCTGCTGCATGG + Exonic
1002201976 5:177534065-177534087 GGGCTGAGGCTGAGGTGGCAGGG + Intronic
1002465254 5:179405135-179405157 GGGCACAGACAGTGGCTGCCAGG - Intergenic
1002661314 5:180792672-180792694 GGTCACAGGCACACGCGGCTGGG + Exonic
1003285210 6:4728312-4728334 TGGCACAGGCAGTGGCCTCAGGG - Intronic
1003623918 6:7726406-7726428 GGGCCCAGGCTGCGGCGACAAGG - Intergenic
1004511578 6:16288120-16288142 GAGCCCAGGCAGAGGAGGCGTGG - Intronic
1004694328 6:18019923-18019945 GCGCTGAGGCAGAGGAGGCACGG - Intergenic
1005835991 6:29709990-29710012 GGGCACTGGCACATGGGGCACGG + Intergenic
1005969465 6:30749870-30749892 GGGCACTGGCGGAGGCAGAATGG + Intergenic
1006033559 6:31195327-31195349 GAGCCCAGGCAGAGGAGGCGGGG - Intergenic
1006423077 6:33947608-33947630 GGGCAGAGACAGAGGAGGCCGGG + Intergenic
1006451835 6:34109861-34109883 GGGCACAGTCAGAGTCTCCATGG - Intronic
1006909863 6:37556935-37556957 GGGCAGAGCCAGAGGAGGGAGGG + Intergenic
1007108331 6:39298358-39298380 GGTCACAGGGAGAGGCCACATGG + Intergenic
1007276231 6:40676148-40676170 GGGCACAGGCAGAGGTTGAAGGG - Intergenic
1008656548 6:53619756-53619778 TGGCACATGCAGAGAGGGCATGG - Intergenic
1009685260 6:66949082-66949104 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
1009913259 6:69960557-69960579 AGGCACAGGAAGAGGCAGCCTGG - Intronic
1010066223 6:71686031-71686053 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
1010199390 6:73269367-73269389 GAGCCCAGGCAGAGGAGGCGCGG + Intronic
1010329472 6:74606348-74606370 GGGAACAGGGAGAGACAGCAAGG - Intergenic
1010690973 6:78910705-78910727 GGGCGCAGGCGGCGGCCGCAAGG + Intronic
1012245907 6:96925141-96925163 CGACACGGGCAGAGGCTGCATGG - Intronic
1013911201 6:115278442-115278464 GGGGACAGGCAGAGAAGTCAGGG - Intergenic
1017581296 6:155867249-155867271 GAGCCCAGGCAGAGGAGGCGCGG + Intergenic
1018698841 6:166411701-166411723 GGGCAGAGGCACAGGTGGGAGGG - Exonic
1018722332 6:166581995-166582017 GGGCACAGGGAGAGGTGAGATGG + Intronic
1018722394 6:166582172-166582194 GGGCACAGGGAGAGGTGAGATGG + Intronic
1019194821 6:170274922-170274944 GGGCACAGGAAGGGAAGGCAGGG + Intergenic
1019201144 6:170316813-170316835 GGGGACAGACAGTGGCGGGAAGG - Intronic
1019493173 7:1324471-1324493 GGGCACAGGCAGGGGCTGGGAGG + Intergenic
1019631562 7:2052426-2052448 GGGCCCAGGCACAGCAGGCAGGG + Intronic
1019631574 7:2052470-2052492 GGGCCCAGGCACAGCAGGCAGGG + Intronic
1019715932 7:2539396-2539418 AGGCAGAGGCCGAGGCGACAAGG - Intronic
1019883846 7:3886371-3886393 GGACACAGGCAGCAGCAGCACGG + Intronic
1020474714 7:8581916-8581938 TAGCACAAGCAGAGGCAGCAGGG - Intronic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021847761 7:24779292-24779314 TGGCAAAGGCAGAGGCAGCCAGG + Intergenic
1022527381 7:31047084-31047106 GGGGACAGGCAGAGGGGGTACGG + Intergenic
1023841574 7:44101354-44101376 GGGGACAGGCAGGAGTGGCAGGG - Intergenic
1024527721 7:50362943-50362965 GGGCAAAGGCAGGGGCTTCATGG + Intronic
1024700706 7:51901389-51901411 GAGCCCAGGCAGAGGAGGCGTGG + Intergenic
1026280989 7:68921635-68921657 GGGCACAGGATGGGGGGGCAGGG - Intergenic
1026471965 7:70701296-70701318 AAGCTCAGGCAGAGGCAGCAGGG + Intronic
1026943127 7:74299554-74299576 GGCCCCAGCCAGAGGCGACAGGG - Intronic
1026951984 7:74353818-74353840 TGGCACAGGCAGAGATGGCAGGG - Intronic
1027878259 7:83799689-83799711 GGGCACAGGCAGAAGATGGATGG + Intergenic
1029183555 7:98721909-98721931 TGATACAAGCAGAGGCGGCAGGG + Intergenic
1029425837 7:100493653-100493675 GGGCAGAGGCAGCGGCAGCGCGG - Exonic
1029472277 7:100762135-100762157 GGGCAGTGGCAGAGAAGGCAAGG - Intronic
1029826207 7:103197635-103197657 TGGAGCAGGCAGAGGAGGCAGGG + Intergenic
1030207735 7:106967036-106967058 GGGCACAGGATGGGGGGGCATGG + Intergenic
1030356030 7:108543339-108543361 AGGCCCAGGCAGAAGCTGCAAGG + Intronic
1030682834 7:112450991-112451013 GGGCACCGGCCGTGGGGGCAGGG + Intronic
1030687842 7:112504943-112504965 GGCCAGTGGCAGAGGCGGGAGGG + Intergenic
1032087320 7:128890994-128891016 AGGCAGAGGCAGCGGCGGCAGGG + Exonic
1032089185 7:128902778-128902800 AGGCACCGGCAGATTCGGCAGGG + Exonic
1032135653 7:129274641-129274663 GGGCACAGGCAGAAGACACAAGG - Intronic
1033216297 7:139495923-139495945 GAGGACAGGCAGAGGTGGCCAGG - Intergenic
1033407517 7:141084695-141084717 GGGGACAAGCAGGGGTGGCAGGG - Intronic
1033619988 7:143053241-143053263 GGGCAGATGCAGAGGCTGAAAGG + Exonic
1034628087 7:152509487-152509509 GGGTAAAGGCAAAGGTGGCAAGG + Intergenic
1034690007 7:153006727-153006749 GGGCCCAGCTAGAGGCAGCAGGG + Intergenic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1035094795 7:156345574-156345596 CGGCCCAGGCAGAGGCCCCAAGG - Intergenic
1035249143 7:157585590-157585612 GAGCACAGGCAGAGGCCACAGGG - Intronic
1035435513 7:158856551-158856573 GCGCACTGGGAGAGGCCGCAGGG + Intergenic
1035451618 7:158980625-158980647 GGACAGAGGCAGACGCAGCAAGG + Intergenic
1035766945 8:2113890-2113912 GGGCACAGCGTGAGGCTGCAGGG + Intronic
1036439304 8:8766128-8766150 GGACTCAGGGAGAGGCAGCAGGG + Intergenic
1036502074 8:9323297-9323319 GGGCACAGGCAAAGGCACAAAGG - Intergenic
1037262874 8:17027431-17027453 GGGCTGTGGCGGAGGCGGCATGG + Exonic
1037591137 8:20313135-20313157 CAGCAGAGGCAGTGGCGGCAGGG - Intergenic
1042506426 8:69565780-69565802 GGGGACAGGCAGGGGCCGCAAGG - Intronic
1044535244 8:93350281-93350303 GGACAAGGGCAGAGGCTGCAAGG + Intergenic
1044837083 8:96306230-96306252 AGGCCCAGGGAGAGGTGGCAGGG - Intronic
1046643226 8:116755704-116755726 AGGCAAAGGCAAAGGCGGCTCGG - Exonic
1047460662 8:125061590-125061612 AGACACAGGCAGAGGCTTCAGGG + Intronic
1047497625 8:125419727-125419749 GGAACCAGGCAGAGGCTGCATGG + Intergenic
1048082643 8:131145856-131145878 GCACAGAGGAAGAGGCGGCAAGG + Intergenic
1048277449 8:133077590-133077612 GGGCCCAACCAGAGACGGCAGGG + Intronic
1048987505 8:139742606-139742628 GGCCACGGGCAGAGGCAGGATGG + Intronic
1049004827 8:139847926-139847948 GGGCACAGGCAGAGGCGGCAGGG - Intronic
1049236712 8:141515762-141515784 GGGCACAGGCAAGGGTAGCAGGG - Intronic
1049337903 8:142096259-142096281 GGGCACCTGCAGAGGCTGCCTGG - Intergenic
1049440668 8:142608109-142608131 GGGCAGGGGCAGAGGCAACATGG + Intergenic
1049507949 8:143013818-143013840 AGACACAGGCAGCGGCAGCAGGG + Intergenic
1049617105 8:143580432-143580454 GGTCACAGGCTGAGCCGGCTAGG + Intronic
1049683273 8:143929258-143929280 AGGCACAGGCAGAGGTGGAGGGG - Exonic
1049695896 8:143984139-143984161 GGGCAAGGGCAGAGGAGGCCTGG + Intronic
1049758696 8:144322138-144322160 GGGCACAGGCAGACCCTGCCTGG + Intronic
1049850378 8:144827324-144827346 GGGTACAGTCAGAGGCGGGCAGG - Intergenic
1050691709 9:8234554-8234576 GGGCACAGGCTGAGGGAGAAGGG + Intergenic
1052540469 9:29804869-29804891 GGGCACAGGAAGAAGGAGCAAGG + Intergenic
1053129986 9:35609312-35609334 GGCCACAGCCAGAGGCAGCTGGG - Exonic
1053375781 9:37605215-37605237 GGGCACAGGCTGAGTCTGCTGGG - Intronic
1055651296 9:78409863-78409885 GAGCCCAGGCAGAGGAGGCACGG - Intergenic
1055791241 9:79925231-79925253 GGGCACAGGGGGAGGTAGCAAGG + Intergenic
1056330179 9:85514538-85514560 GGGAGCAGGCAGGGGCTGCAGGG - Intergenic
1056956516 9:91086086-91086108 TGGCACACTCAGAGGGGGCATGG + Intergenic
1056982498 9:91328046-91328068 AGGCCCAGACAGAGGTGGCAGGG + Intronic
1057077887 9:92148798-92148820 GGGCAGAGGCAGAGGAGGCAAGG - Intergenic
1057218103 9:93240615-93240637 GGCCACAGGCACAGGCAGAAAGG + Intronic
1057303437 9:93899448-93899470 GGGAAGAGGCAGAGGCGGTGGGG + Intergenic
1057416037 9:94863118-94863140 GGGCACAGGTAGAGAGGCCAGGG + Intronic
1057825737 9:98371013-98371035 GGGTACAGGAAGAGGCTGGAAGG - Intronic
1057830946 9:98406511-98406533 GGGCACAGGGAGAGGAGTCAGGG - Intronic
1057957603 9:99424002-99424024 GGGCACAGAGAGAGGCGGCTGGG - Intergenic
1057957737 9:99424540-99424562 GGGCACAGTGAGAGGTGGCTGGG - Intergenic
1058830611 9:108813027-108813049 GGCCACACCCAGAGGCAGCATGG + Intergenic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1060236991 9:121871560-121871582 GGGCAAAGCCAGAGGCAGGAGGG - Intronic
1060408885 9:123386879-123386901 GGGAACAGGGAGAGGGTGCAGGG + Intronic
1060750381 9:126164879-126164901 GGGCACAGTCAGAGGAGAAAGGG + Intergenic
1061218327 9:129234882-129234904 TGGCACTGGCAGAGGCACCAAGG - Intergenic
1061313168 9:129777225-129777247 GAGCTCAGGCAGAGGCGCCTGGG - Intergenic
1061399380 9:130360085-130360107 GGGCAGAGGCTGAGGCAGCCAGG - Intronic
1061572265 9:131485090-131485112 GGCCACAGGCATGGGTGGCATGG - Exonic
1061720666 9:132549186-132549208 GTGGAGAGGCAGAGGCGGCAGGG - Intronic
1061726091 9:132582726-132582748 GGGCAGGGGCAGCGGCGGCTGGG + Exonic
1061937112 9:133863960-133863982 GGGCACAGCCAGAGGTGCCCTGG - Intronic
1061948394 9:133921542-133921564 AGGCACAGGGAGAGGCTGCAGGG - Intronic
1062197180 9:135280811-135280833 TGGCACAGCCAGAGGCAGCAAGG + Intergenic
1062332907 9:136052419-136052441 GGGAATGGGCAGAGGCGCCAGGG + Intronic
1062396474 9:136354862-136354884 GGGCACAGGGACAGGAGGCACGG + Intronic
1062532169 9:137006802-137006824 GGGCACAGGCCAAGGCCCCAGGG - Intergenic
1062614107 9:137388272-137388294 GTGTCCAGGCAGAGGCGGCCAGG + Intronic
1062659100 9:137619089-137619111 GGGCAGCGGCGGAGGCGGCGCGG + Intronic
1062678885 9:137765673-137765695 GGGGACAGGCTGGGGCGGCGGGG - Intronic
1203429744 Un_GL000195v1:80247-80269 GAGCCCAGGCAGAGGAGGCCCGG - Intergenic
1186218224 X:7322890-7322912 GGGTACCGGCAGAGGCAGGAAGG - Intronic
1187138967 X:16575319-16575341 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
1187374863 X:18742949-18742971 GGGCAAAGGCAGAAGCTGCCAGG + Intronic
1189294865 X:39910933-39910955 GGGAACCTGCAGAGGCCGCAGGG + Intergenic
1189304566 X:39977172-39977194 GGGGACAGGGAGAGGCAGCAAGG + Intergenic
1191054266 X:56226147-56226169 GGGCACAGGAGGAGGGGGCAAGG + Intergenic
1192351537 X:70360507-70360529 GGGCAGTGGCAGAGGCCACAAGG - Intronic
1193369444 X:80676941-80676963 AGGCAGAGGAAGAGGAGGCAGGG - Exonic
1195221950 X:102753119-102753141 GGGCACAGGGAGAGAGGGGAGGG - Exonic
1195676789 X:107512779-107512801 TGTCACTGGCAGAGGCAGCAAGG - Intergenic
1195996400 X:110736042-110736064 GGCCACTGGCAGAGGGTGCAAGG + Intronic
1196844978 X:119890466-119890488 GAGCCCAGGCAGAGGAGGCGCGG - Intergenic
1196885023 X:120236227-120236249 AGGCATAGACAGAGGAGGCAAGG - Intergenic
1197376881 X:125691075-125691097 GAGCCCAGGCAGAGGAGGCGCGG + Intergenic
1197776072 X:130119504-130119526 GGGGACAGAAAGAGGGGGCAGGG + Intergenic
1198006385 X:132498700-132498722 GGGCAAAGCCAGGGGCTGCACGG + Intergenic
1199850598 X:151722823-151722845 GGGCAAGGGCAGTGGCGGCCTGG - Exonic
1200081385 X:153578485-153578507 GGGCCCAGGCTGAGGGGCCAGGG + Intronic
1200213702 X:154358167-154358189 GGGCACAGGCAGGGGAGGCAGGG - Intronic
1200915095 Y:8564542-8564564 TGGTACAGGCAGAGCCGGCCTGG - Intergenic
1200915407 Y:8567028-8567050 TGGTACAGGCAGAGGTGGCCTGG - Intergenic
1200917389 Y:8583306-8583328 TGGTACAGGCAGAGCCGGCCTGG - Intergenic
1200921575 Y:8618073-8618095 TGCCACAGGCAGAGCCGGCATGG - Intergenic
1200934569 Y:8726918-8726940 TGGTACAGGCAAAGCCGGCATGG + Intergenic
1201399842 Y:13593565-13593587 GGGCACAGGATGAGGTGGAATGG - Intergenic
1202109762 Y:21407066-21407088 GAGCCCAGGCAGAGGAGGCACGG - Intergenic
1202254537 Y:22907315-22907337 GAGTCCAGGCAGAGGAGGCAAGG - Intergenic
1202407528 Y:24541064-24541086 GAGTCCAGGCAGAGGAGGCAAGG - Intergenic
1202463254 Y:25129017-25129039 GAGTCCAGGCAGAGGAGGCAAGG + Intergenic