ID: 1049004828

View in Genome Browser
Species Human (GRCh38)
Location 8:139847927-139847949
Sequence AGGGCACAGGCAGAGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 777
Summary {0: 1, 1: 0, 2: 4, 3: 114, 4: 658}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049004828_1049004839 7 Left 1049004828 8:139847927-139847949 CCTGCCGCCTCTGCCTGTGCCCT 0: 1
1: 0
2: 4
3: 114
4: 658
Right 1049004839 8:139847957-139847979 CAGCAGCCCTGGGGCACGTGGGG No data
1049004828_1049004837 5 Left 1049004828 8:139847927-139847949 CCTGCCGCCTCTGCCTGTGCCCT 0: 1
1: 0
2: 4
3: 114
4: 658
Right 1049004837 8:139847955-139847977 AGCAGCAGCCCTGGGGCACGTGG No data
1049004828_1049004835 -3 Left 1049004828 8:139847927-139847949 CCTGCCGCCTCTGCCTGTGCCCT 0: 1
1: 0
2: 4
3: 114
4: 658
Right 1049004835 8:139847947-139847969 CCTGTGTCAGCAGCAGCCCTGGG No data
1049004828_1049004836 -2 Left 1049004828 8:139847927-139847949 CCTGCCGCCTCTGCCTGTGCCCT 0: 1
1: 0
2: 4
3: 114
4: 658
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004828_1049004844 26 Left 1049004828 8:139847927-139847949 CCTGCCGCCTCTGCCTGTGCCCT 0: 1
1: 0
2: 4
3: 114
4: 658
Right 1049004844 8:139847976-139847998 GGGGCCTGGACTTGGTCTGCCGG No data
1049004828_1049004838 6 Left 1049004828 8:139847927-139847949 CCTGCCGCCTCTGCCTGTGCCCT 0: 1
1: 0
2: 4
3: 114
4: 658
Right 1049004838 8:139847956-139847978 GCAGCAGCCCTGGGGCACGTGGG No data
1049004828_1049004840 12 Left 1049004828 8:139847927-139847949 CCTGCCGCCTCTGCCTGTGCCCT 0: 1
1: 0
2: 4
3: 114
4: 658
Right 1049004840 8:139847962-139847984 GCCCTGGGGCACGTGGGGCCTGG No data
1049004828_1049004843 18 Left 1049004828 8:139847927-139847949 CCTGCCGCCTCTGCCTGTGCCCT 0: 1
1: 0
2: 4
3: 114
4: 658
Right 1049004843 8:139847968-139847990 GGGCACGTGGGGCCTGGACTTGG No data
1049004828_1049004833 -4 Left 1049004828 8:139847927-139847949 CCTGCCGCCTCTGCCTGTGCCCT 0: 1
1: 0
2: 4
3: 114
4: 658
Right 1049004833 8:139847946-139847968 CCCTGTGTCAGCAGCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049004828 Original CRISPR AGGGCACAGGCAGAGGCGGC AGG (reversed) Intronic
900223337 1:1521054-1521076 GAGGCAGAGGCAGAGGCGGGCGG + Intronic
900379757 1:2377977-2377999 AGGGCCCAGGCAGAAGGGTCCGG - Intronic
900407186 1:2497918-2497940 AGGGGCCAGGCACAGGGGGCTGG - Intronic
900566550 1:3335033-3335055 AGGGCACAGCCAGAGAGGACGGG + Intronic
900569979 1:3353426-3353448 AGGACAAACGCAGAGGCTGCAGG - Intronic
900869091 1:5289156-5289178 AGAGCCCAGGAAGAGGAGGCAGG - Intergenic
901012037 1:6207503-6207525 AGCGAGCAGGCAGGGGCGGCAGG + Exonic
901068877 1:6507576-6507598 AAGGCCCAGGCAGAGGGAGCTGG + Intronic
901158233 1:7154940-7154962 TGTGCACACGCAGAGGCTGCAGG - Intronic
901230957 1:7641515-7641537 AGGGCCCAGGCTGAGGCTACGGG + Intronic
901266178 1:7912697-7912719 AGGTCACAGGCAGAGCCAGAGGG - Intergenic
901675084 1:10878624-10878646 AGGGGACAGTCAGAGGCAGGAGG + Intergenic
901778726 1:11578468-11578490 AGGGCACAGTCAGAGGCTCCTGG + Intergenic
901800933 1:11707668-11707690 AGGGCAGAGGCAGGAGCGGTAGG - Intronic
901958562 1:12806866-12806888 GTGGCACAGGCAGATGAGGCTGG - Intergenic
902748393 1:18488953-18488975 AGGCCACAGACAGAAGCAGCCGG + Intergenic
902834488 1:19037873-19037895 AGGGCACAGGCAGAGGCCTGTGG + Intergenic
903298397 1:22360658-22360680 AGGCAACAGGCAGTGGTGGCAGG + Intergenic
903488901 1:23712681-23712703 AGGGCAAAGGCAGAAGCAGCAGG + Intergenic
903648240 1:24907397-24907419 AGGGCACCGGCAGAAGCTGGAGG - Exonic
904262977 1:29301044-29301066 AAGGCACAGGGAGTGGGGGCAGG + Intronic
904263615 1:29305243-29305265 AGGGCACAGGCAGGGCAGCCAGG - Intronic
905717210 1:40161900-40161922 AGGACACAGGCAACGGCGACAGG - Intronic
905800554 1:40839688-40839710 TGGGGACAGGCAGAGGCAGTGGG - Exonic
906518827 1:46455600-46455622 AGGGCACGGGTAGAGGAGGGGGG - Intergenic
907333450 1:53685983-53686005 AGGGCAGGGGCAGAGGGGGAGGG - Intronic
907487531 1:54787952-54787974 AGGGTAAGGGCAGAGGTGGCTGG - Intronic
908391232 1:63685373-63685395 AGGGCACAGGAAGAGGCCATAGG - Intergenic
909742319 1:79045600-79045622 AAGGCAGAGACAGAGGCAGCTGG - Intergenic
909920983 1:81379772-81379794 AAGGCACAGACAGAAGCTGCTGG - Intronic
909961638 1:81853007-81853029 AGCGAAGAGGCAGAGGCAGCTGG + Intronic
913203871 1:116517673-116517695 TGGGAAGAGGCAGAGGAGGCGGG - Intronic
913475090 1:119229521-119229543 AGGGCACAGTCAGAGCTGCCAGG - Intergenic
913971970 1:143422987-143423009 AGGGCAAAGGCGGTGGCAGCTGG + Intergenic
914066349 1:144248600-144248622 AGGGCAAAGGCGGTGGCAGCTGG + Intergenic
914112804 1:144717754-144717776 AGGGCAAAGGCGGTGGCAGCTGG - Intergenic
914244643 1:145876621-145876643 GAGGCACAGCCAGAGGAGGCTGG + Exonic
914998582 1:152566093-152566115 GGGGCACAGCCAGAGGAAGCTGG + Exonic
914999935 1:152579821-152579843 GGGGCACAGCCAGAGGAAGCTGG + Exonic
915075758 1:153307187-153307209 AGGCCACAGGCAGGGTCAGCAGG + Exonic
915300200 1:154947393-154947415 TGGGCACAGGCAGGAGGGGCTGG - Intronic
915611758 1:156999350-156999372 AAGGCACAGGGAGAGGAAGCTGG - Intronic
916586817 1:166156451-166156473 AGGGCACTGGGAGAGGAGGTGGG + Intronic
917060616 1:171033262-171033284 AGGGTGCAGGCAGCGGCAGCTGG + Intronic
917406539 1:174712900-174712922 GGGGCACAGACACAAGCGGCTGG - Intronic
917738839 1:177944281-177944303 GAGGCACAGGCCGGGGCGGCAGG + Intronic
918063959 1:181087071-181087093 AGAGCACAGGCTGAGGAGGCTGG - Intergenic
918092658 1:181310759-181310781 GGGGCTCGGGCAGAGGCTGCTGG + Intergenic
918098673 1:181354981-181355003 AGCACACAGGCAGAGCCTGCTGG + Intergenic
918708282 1:187696086-187696108 AGGGCCCAGGCATAGGGGTCAGG - Intergenic
919807187 1:201387060-201387082 GGAGCGGAGGCAGAGGCGGCAGG - Exonic
920190538 1:204190807-204190829 AGGGCACAGAAAGATGAGGCCGG + Intronic
920836269 1:209513899-209513921 AGGGCGAAGGCAGATGTGGCAGG - Intergenic
920987975 1:210908478-210908500 GGGGCACAGGCAGAAGCTACAGG - Intronic
922209761 1:223478422-223478444 TGGGCACTGGCAGATGCTGCAGG - Intergenic
922477320 1:225915567-225915589 TGGGAACAGGGAGAGGGGGCTGG + Intronic
922755193 1:228092673-228092695 AGGGAACAGGCGCAGGCGGAAGG - Intronic
922888611 1:229042115-229042137 TGGGGACAGGCTGAGGCGGCCGG + Intergenic
923228694 1:231963485-231963507 AGGGCACATGCAGAGGGGTGGGG - Intronic
923385260 1:233459837-233459859 TGGTCAGAGGCAGAGGGGGCAGG - Intergenic
924243804 1:242062602-242062624 AGGGAACAGGAGGAGGTGGCAGG + Intergenic
924514774 1:244756715-244756737 AGGGCAGAGGCAGTGGAGGGTGG - Intergenic
924697913 1:246419422-246419444 AAGGCACAGACAGAAGCAGCTGG - Intronic
1063187696 10:3665711-3665733 AGGGCACAGACACAGGCAGAGGG - Intergenic
1064092493 10:12396703-12396725 AGGGCAGAGGCACAGCCTGCAGG - Intronic
1065520516 10:26567097-26567119 AGGCCAAGGGCACAGGCGGCGGG + Exonic
1065974558 10:30830944-30830966 TGGCCACAGCCAGAGGCCGCTGG - Intronic
1066336032 10:34479609-34479631 AGGGCACCGGCAGTGGCTGTAGG - Intronic
1067809059 10:49412913-49412935 GGGGCACAGGCAAAGGGAGCTGG - Intergenic
1068941821 10:62688165-62688187 AGGGGACAGGGAGAGGGGACAGG - Intergenic
1069873462 10:71547330-71547352 ATGGCACAGGCAGCGGCTGGAGG + Intronic
1069896491 10:71683430-71683452 TGGGCAGTGGCAGAGGCTGCTGG - Intronic
1069919410 10:71807479-71807501 ATGGCACAGGGTGAGGGGGCAGG - Intronic
1070539974 10:77408957-77408979 AGGGTGCAGGCACAGGAGGCAGG + Intronic
1072306054 10:94108299-94108321 AGGGCTCAGGCTGAGGCTCCTGG - Intronic
1072885887 10:99273475-99273497 AGGCCAAAGGCAGAGGCAGAAGG - Intergenic
1073175505 10:101554051-101554073 AGGGGGCAGGCAGAGGGGGTGGG + Exonic
1073218404 10:101849745-101849767 AAGACACAGGCAGAGGCGGTGGG + Intronic
1073326629 10:102647088-102647110 AGGGCACAGGCAGGGGTGGGTGG + Intronic
1074088360 10:110225921-110225943 GGGGCAGAGGCAGGGGCGGGAGG + Intronic
1074110495 10:110419356-110419378 AGGGCACTGGAGGAGGCTGCAGG + Intergenic
1074289946 10:112130852-112130874 AGGTCACAGAAAGAGGGGGCTGG + Intergenic
1074290144 10:112132233-112132255 AGGGCACAGGCACAGGCAGCAGG + Intergenic
1074300871 10:112232350-112232372 AGGGCAGGGGCAGAAGGGGCTGG + Intergenic
1074538429 10:114345420-114345442 AGGGGACTGGCAGTGGAGGCAGG + Intronic
1074896757 10:117784110-117784132 AGGGCACGGACAGTGGCGGTGGG + Intergenic
1075442398 10:122490575-122490597 AGGGAACAATCAGAGGAGGCTGG + Intronic
1075631595 10:124003915-124003937 AGGGTGCAGGGAGAGGCAGCTGG + Intergenic
1076052969 10:127349814-127349836 AGGCCACAGGAAGATGGGGCAGG - Intronic
1076313945 10:129527699-129527721 TGGGGACAGGGAGAGGCGTCTGG - Intronic
1076343344 10:129764834-129764856 AGGGCCCAGGGAGAGGCCCCGGG + Intronic
1076639086 10:131901522-131901544 GGGGCACGGGCGGAGGCGTCGGG + Intronic
1076695084 10:132243429-132243451 AGGGGGCAGGCAGGGGCGGAGGG + Intronic
1076887490 10:133269365-133269387 AGAGCCCAGGCAGAAGCCGCGGG - Intronic
1076930726 10:133530015-133530037 AAGGCACAGTCGGAGGCAGCAGG + Intronic
1076993731 11:288803-288825 AGGACCCAGGTGGAGGCGGCCGG + Intergenic
1077015996 11:399419-399441 AGGGGACAGGCAGAGGGGGCAGG - Intronic
1077016025 11:399492-399514 GGGGGATAGGCAGAGGGGGCAGG - Intronic
1077143992 11:1036764-1036786 GGGGCGCAGGCAGGTGCGGCGGG - Intergenic
1077145394 11:1042120-1042142 TGAGCACAGGGAGAGGCTGCCGG + Intergenic
1077170001 11:1161836-1161858 AGGGCAGAGGCAGGGGGTGCAGG + Intronic
1077197658 11:1289295-1289317 AGGGCCCAGGCAGGGAGGGCTGG + Intronic
1077217412 11:1400743-1400765 AGGGCCCAGGCAGAGCCGGCAGG - Intronic
1077307886 11:1876049-1876071 AGGGCAAAGGCGGTGGCAGCTGG - Intronic
1078333178 11:10442799-10442821 AAGGAAGAGGCGGAGGCGGCCGG - Intronic
1078597307 11:12698439-12698461 AGAGCACAGGCAGAGCAGGAAGG + Intronic
1079766939 11:24406042-24406064 AGGGCACAGACACAAGTGGCTGG + Intergenic
1081787123 11:45755648-45755670 GAGGCAGAGGCAGAGGCGGAGGG + Intergenic
1083320435 11:61842661-61842683 AGGACACAGCCAGTGGGGGCTGG - Intronic
1083401227 11:62424798-62424820 AGGGCACGGAAGGAGGCGGCGGG + Intergenic
1083609523 11:63998420-63998442 CGGGCAGAGGCACAGGCGGACGG - Intronic
1083615099 11:64022218-64022240 GGGGCACAGGCAGTGGCAGGAGG + Intronic
1083626703 11:64075523-64075545 AGGGAACAGGCAGAGGTGGAGGG + Intronic
1084001990 11:66300905-66300927 AGAGCAGAGGCAGAGGCCGCTGG - Intergenic
1084181688 11:67450098-67450120 AGGGCAAAGGCAAAGACGGCCGG - Intergenic
1084199126 11:67543608-67543630 AGGGAACAAGCAGGGGAGGCAGG - Intergenic
1084269429 11:68021191-68021213 GGGTCACAAGCAGAGGCGGGAGG + Intronic
1084414151 11:69021177-69021199 ACGGCACCGGCTGAGGTGGCTGG - Intergenic
1084419505 11:69053270-69053292 AAGGCACCGGCAGAGGCTGGGGG + Intronic
1084468928 11:69343840-69343862 AGGCCACAGCCAGAGGGGCCTGG - Intronic
1084960797 11:72715311-72715333 AGGGCACTGGCAGAGACAGCTGG - Intronic
1085050813 11:73379305-73379327 AGGGCACAGGCTGAGGCTGGGGG - Intronic
1085309517 11:75507880-75507902 AGGGCTCAGGCAGCTGAGGCTGG - Intronic
1087064124 11:94011478-94011500 AGGCTACAGGCAGGGGAGGCTGG + Intergenic
1087140037 11:94756176-94756198 CGGGCACAGACACAAGCGGCTGG - Intronic
1088807629 11:113366782-113366804 ACGGCACATGCAGTGGCTGCAGG - Intronic
1088885613 11:114004043-114004065 ATGGCAAAGGCAGAGGCTGGAGG + Intergenic
1089414306 11:118274213-118274235 AGGGCAGAGACAGAGGCAGCTGG + Intergenic
1089641199 11:119848263-119848285 AGGGAAGAGGCAGAGGCGTGAGG + Intergenic
1089764214 11:120751276-120751298 AGGGCAGAGGAAGAGGCAGGAGG + Intronic
1089794160 11:120967060-120967082 AGGGGACAGACAGATGCAGCGGG - Intronic
1090242206 11:125192118-125192140 AGGGCAGAGGTAGAGGGAGCAGG + Intronic
1090257812 11:125298168-125298190 AGGAAACAGGCAGAGGCTGTTGG + Intronic
1090944112 11:131414337-131414359 AGGCCAGAGGCAAAGGCAGCAGG - Intronic
1090995259 11:131860334-131860356 AAGGCACAGGCAGAGTCTGAAGG + Intronic
1091040575 11:132276784-132276806 AAGGCACAGGTAGAGGCTGCAGG - Intronic
1091305097 11:134531604-134531626 AGGACACAGGCAGAGGCTGTAGG - Intergenic
1091381832 12:66859-66881 AGGGCGCAGGCGGCGGCGGGCGG + Exonic
1091390802 12:125111-125133 TGGGCACAGGCTCAGGTGGCTGG - Intronic
1091407500 12:218505-218527 AGAGCAGAAGCAGAGGTGGCGGG - Intergenic
1091747672 12:3003098-3003120 GGGGCTCAGGGAGAGGAGGCTGG - Intronic
1091965057 12:4733687-4733709 AAAGCACAGGCAGAGGAGCCTGG - Intronic
1092283276 12:7113624-7113646 AGAGCCCAGGCAGAGGAGTCTGG + Intergenic
1094849402 12:34375664-34375686 AGGGGCCAGCCAAAGGCGGCAGG - Intergenic
1094852436 12:34388335-34388357 AGGGGTCAGTCAAAGGCGGCAGG - Intergenic
1094856746 12:34406228-34406250 AGGGGCCAGCCAAAGGCGGCAGG + Intergenic
1094872913 12:34607879-34607901 AGAGGACAGCCAAAGGCGGCAGG + Intergenic
1096209070 12:49748489-49748511 ATGGCTCTGGCAGAGGAGGCTGG + Intronic
1097019417 12:56009090-56009112 AGGGCACAGGCTGGGGAGACAGG - Intronic
1097175735 12:57141936-57141958 AGGGCACCCGTAGGGGCGGCAGG - Intronic
1099115531 12:78619694-78619716 AGGGCACAGGTACAGGGTGCTGG - Intergenic
1101640139 12:106581652-106581674 TGGACAGAGGCAGAGCCGGCGGG - Intronic
1102043792 12:109817218-109817240 GGGGCACAGGCATTGGCGGGAGG + Intronic
1102472619 12:113168103-113168125 AGGGCACAGGAAAGGGCTGCGGG - Intronic
1102602227 12:114040060-114040082 AGCTCACAGGCAGAGGGGGAAGG + Intergenic
1102811308 12:115826591-115826613 AGGGCACAGGTGGAGGAAGCAGG - Intergenic
1103602000 12:122060200-122060222 GGGGCACAGGCTGGGGCGTCGGG - Exonic
1103611915 12:122129288-122129310 AGGGCCCTGGCCGAGGCGGTAGG + Intronic
1104031673 12:125069342-125069364 CGGGCTCACGGAGAGGCGGCCGG - Intronic
1104633721 12:130425073-130425095 AGAGCACACGCAGAGCCAGCGGG + Intronic
1104716082 12:131017089-131017111 AGGGCACGGGCAGAGAGGGGAGG + Intronic
1104720324 12:131041759-131041781 CGGGTGCAGGCAGAGGCGCCAGG - Intronic
1104747552 12:131219719-131219741 AGGGCACAGGCAGGAGCAGGAGG - Intergenic
1105013503 12:132771862-132771884 GGGGCACAGGGAGAGGCCGGTGG - Exonic
1111964638 13:94848379-94848401 AGGACACTGGCAGAGGCTGCTGG - Intergenic
1112128436 13:96496008-96496030 AGGGCAATGGCAGAGGCCCCAGG + Intronic
1112354124 13:98660329-98660351 AGGGGCCAGGAAGAGGTGGCAGG + Intergenic
1113513343 13:110872774-110872796 AGGGCTCAGGGAGGGGCTGCGGG - Intergenic
1113612371 13:111656477-111656499 AGGGCACGGGGTGAGGCTGCAGG - Intronic
1113680349 13:112239124-112239146 GGGGCACAGGCAAAGCCAGCTGG + Intergenic
1113715184 13:112499996-112500018 GGGGTACAGGCAGAGGAGGGTGG + Intronic
1113794405 13:113048893-113048915 GGGTCACAGGCAGGGGCAGCAGG + Intronic
1113827450 13:113267848-113267870 AGGGCACAGGGAGTGGGGGCAGG + Intergenic
1113923348 13:113927027-113927049 AAGGCACAGCTAGAGGCGGCAGG - Intergenic
1114231870 14:20790507-20790529 TGGGCACAGACAGAAGTGGCTGG + Intergenic
1114556845 14:23567161-23567183 AGTGCACAGGCACCGGCAGCTGG - Exonic
1115235874 14:31207923-31207945 ACGACACAGCCCGAGGCGGCGGG - Intergenic
1115409883 14:33061998-33062020 AGGACACAGGCAGAAGTGGAGGG + Intronic
1116837526 14:49785642-49785664 AAGGCTCAGGCTGAGGCGGGTGG + Exonic
1117723205 14:58646738-58646760 AGGGCAGAGGCACAGGCGCGGGG - Exonic
1119264214 14:73254611-73254633 AGGGCTCAGTCAGAGGTGGCCGG - Exonic
1119329385 14:73782879-73782901 AGCTAACAGGCAGAGGAGGCAGG + Intronic
1119731940 14:76956651-76956673 AGGGGGCAGGGAGCGGCGGCCGG - Intergenic
1120715970 14:87840983-87841005 AGGGCAGAGGCAGTGGAGGAAGG - Intronic
1121733289 14:96201362-96201384 AGGCCAGAGGCAGAGAAGGCAGG + Intergenic
1122043628 14:99008160-99008182 AGGGGAGAGGCAGAGGCAGGAGG - Intergenic
1122098468 14:99388531-99388553 AGGCCAGGGGCAGAGGAGGCAGG + Intergenic
1122124350 14:99571039-99571061 TGGGCACAGGCAGGGGTGGCAGG - Intronic
1122157142 14:99756419-99756441 AAGGCCCAGGCAAAGGCCGCGGG + Intronic
1122409366 14:101518139-101518161 AGGGCACCGGCTGAGAAGGCGGG - Intergenic
1122534911 14:102455339-102455361 AGGTCACAGGCAGAGGTGTGGGG + Intronic
1122826688 14:104374115-104374137 AGGACAGAGGCAGAGTCGGGGGG - Intergenic
1122895023 14:104752620-104752642 AGGGCAAAGTCTGGGGCGGCTGG - Intergenic
1122983689 14:105202724-105202746 AGACCCCAGGCAGAGGAGGCTGG + Intergenic
1123964130 15:25438688-25438710 TGTGGACAGGCAGCGGCGGCTGG - Exonic
1124371217 15:29105881-29105903 GGGGCTCTGGCAGAGGAGGCTGG + Intronic
1124453739 15:29822137-29822159 GGGGCACGGGCGGGGGCGGCCGG + Exonic
1124612276 15:31216358-31216380 AGGGCTGAGGGAGAGGCGGAGGG + Intergenic
1125485609 15:40108821-40108843 CGGGCACAGGCCGGGGCGGGAGG + Exonic
1125954380 15:43779161-43779183 AGGCCACAGGCAGAGAAGGTGGG + Intronic
1127259817 15:57319609-57319631 CTGGCACAGGCTCAGGCGGCAGG + Intergenic
1127774178 15:62252714-62252736 AGGGCAGAGACACAGGCGTCAGG + Intergenic
1127798564 15:62458297-62458319 AGGAATCAGGGAGAGGCGGCGGG - Intronic
1127891319 15:63254033-63254055 AGGGCACAAGCTGAGGCTGAAGG - Intronic
1128392549 15:67192302-67192324 AGGACACAGGAAGAGACGGAAGG + Exonic
1128495572 15:68196599-68196621 CGGGCAGAGGCAGAGCTGGCTGG + Intronic
1128516379 15:68344507-68344529 TGGGCACAGGCTGAAGAGGCAGG + Intronic
1128539645 15:68517703-68517725 AGGGCCCAGGGAGAGGAGGATGG + Intergenic
1128687353 15:69696653-69696675 AGGGCAGAGGCAAAGGGCGCAGG + Intergenic
1128708525 15:69855082-69855104 AGGGCAGAGCCAGTGGGGGCAGG - Intergenic
1128768947 15:70267552-70267574 AGAGCCCAGGCAGAGGGGACAGG - Intergenic
1129177077 15:73847947-73847969 GGGGGAGAGGCAGAGGCTGCTGG + Intergenic
1129184893 15:73899987-73900009 TGGAGACAGGCAGAGGGGGCGGG - Intergenic
1129199880 15:73992348-73992370 CGGGCGCAGGAAGAGGAGGCCGG + Exonic
1129388580 15:75209099-75209121 AAGGCACAGGCAGAGGAGGAGGG - Intronic
1129605451 15:77022829-77022851 AGGGGACAGGAAGAGGGGCCTGG + Intronic
1131098893 15:89672826-89672848 CTGGCAGAGGCAGAGGCAGCCGG - Intronic
1131223819 15:90607652-90607674 AGGGCAGAGGCAGGGGACGCTGG - Intronic
1131524252 15:93139972-93139994 AGGAGACAGGCAGGGCCGGCAGG + Intergenic
1131969939 15:97881762-97881784 TGGGCAGAGGCAGAGGCAGCAGG + Intergenic
1132073430 15:98799608-98799630 AGTCCACAGGCAGAGGTGGGAGG + Intronic
1132365157 15:101251660-101251682 AAGGCGCAGGCCGCGGCGGCGGG - Exonic
1132651158 16:1021975-1021997 AGGGGACAGGAACAGGCGCCAGG - Intergenic
1132657675 16:1048185-1048207 AGGGCACAGCCAGAGACAGAGGG - Intergenic
1132667671 16:1089531-1089553 AGGCGACAGGCAGAGCTGGCAGG + Intergenic
1132689963 16:1177987-1178009 AGGCCTCAGGGAGAGGGGGCGGG - Intronic
1132690011 16:1178080-1178102 AGGCCCCAGGGAGAGGGGGCAGG - Intronic
1132756288 16:1487087-1487109 AGGGCAGAAGCAGAGGTGGCGGG - Intronic
1132765441 16:1532112-1532134 AGGGCACAGGCAGGAAGGGCTGG + Intronic
1132806644 16:1778057-1778079 AGGGGCCAGGCAGAGGGCGCGGG + Intronic
1133270951 16:4610592-4610614 AGGGCAGCGGCAGGGCCGGCGGG - Intronic
1133371565 16:5249300-5249322 GGGGCACAGTCAGGGGTGGCAGG - Intergenic
1134208948 16:12259929-12259951 GGGGCAGAGGCAGAGGCAGCGGG - Intronic
1135963892 16:27020232-27020254 AAGGCACAGTCAGAGCCGGCTGG + Intergenic
1136019021 16:27428293-27428315 AGGGCACAGGCTGGGGGGCCAGG - Intronic
1136060697 16:27724312-27724334 AGGGCACAGCCACGGGCTGCTGG - Intronic
1136296873 16:29308897-29308919 AGGGGACAGGCAGAGGAGACGGG - Intergenic
1136296893 16:29308975-29308997 AGGACACAGGCAGAGGGGATGGG - Intergenic
1136296947 16:29309187-29309209 GGGGCACAGGCAGAGGGCACAGG - Intergenic
1136296961 16:29309240-29309262 CTGGCACAGGCAGAGGGGACTGG - Intergenic
1136512594 16:30748465-30748487 AGGGGGCAGGCAGAGGAGCCAGG - Exonic
1136531930 16:30875594-30875616 AGGGCACGGGTAGGTGCGGCTGG - Intronic
1139387219 16:66580321-66580343 GGGGCCCAGGCAGAGGCAGCTGG + Intronic
1139442238 16:66974146-66974168 GGAGCCCAGGCAGAGGCGGCAGG - Exonic
1139916782 16:70433291-70433313 AGGGGACAGGGAGAGGAGGGAGG - Intronic
1140409942 16:74735381-74735403 AGGGCTCAGGGGGAGGAGGCAGG - Intronic
1141135778 16:81464214-81464236 TGGGCACAGTGAGAGGTGGCTGG + Intronic
1141206418 16:81936322-81936344 ACCGCACAGCCAGAGGCGGAAGG - Exonic
1141424582 16:83936607-83936629 AGAGCACAGGCAGAGGCCTGGGG - Intronic
1141523084 16:84594397-84594419 AGTGCGCAGCCACAGGCGGCTGG + Intronic
1141992443 16:87618289-87618311 TGGGCAGAGGAAGAGGAGGCAGG + Intronic
1142005446 16:87687621-87687643 AAGGCACAGGAAGAAGCTGCAGG + Intronic
1142058467 16:88015162-88015184 AGGGCACAGGCAGAGGGGACGGG - Intronic
1142058513 16:88015344-88015366 CTGGCACAGGCAGAGGGGACTGG - Intronic
1142132190 16:88436214-88436236 ATGGCAGAGGCAGAGGGAGCTGG - Exonic
1142175259 16:88642336-88642358 AGGGCAGAGCGGGAGGCGGCAGG + Intergenic
1142210710 16:88807150-88807172 AGAGCACTGGGAGAGGCTGCAGG - Exonic
1142318353 16:89364187-89364209 AGGGCACAGGTGGAAGTGGCAGG - Intronic
1142425721 16:90001292-90001314 AAGGCGCAGGCAGGGGTGGCGGG - Intergenic
1142961282 17:3553879-3553901 GGGATACAGGCAGAGGAGGCAGG + Intronic
1143184132 17:5000377-5000399 TGGGCACAGGCAGGGAAGGCCGG + Intronic
1144812680 17:18010746-18010768 AGGGCAGGGGCTGAGGCTGCGGG + Intronic
1145005856 17:19337367-19337389 AAGGCCGAGGCAGAGGCGGCTGG + Intergenic
1145121349 17:20263087-20263109 AGGGCAGAGGCAGAGTGGACAGG - Intronic
1145934220 17:28705572-28705594 AGGGCACAGGAAGAAGCTGCTGG + Intronic
1146185980 17:30724535-30724557 TGGGGACAGGCTGAGGCTGCAGG + Intergenic
1146398962 17:32488802-32488824 AGGGCACAGGCGGCAGGGGCAGG - Exonic
1146503134 17:33381468-33381490 AGCACACAGGCAGATGCTGCCGG - Intronic
1146747623 17:35346133-35346155 CAGGCAGAGGCAGAGGCGGGAGG + Intergenic
1147435577 17:40411946-40411968 AGGACACAGGCCGAGGTGGGTGG + Intronic
1147913942 17:43875666-43875688 AGGGCTCAGGCAGGGGAGGTAGG + Intronic
1148075198 17:44931745-44931767 AAGGCACAGGTAGAGGGGCCAGG + Intronic
1148178079 17:45584878-45584900 TGGGCAGCGGCAGCGGCGGCGGG + Intergenic
1148556232 17:48580437-48580459 AGGGAGGAGGAAGAGGCGGCTGG + Intronic
1148558835 17:48594470-48594492 AGCGCCCAGGCCGAGCCGGCAGG + Intronic
1148733346 17:49851173-49851195 AGGGCACCGGGAGGGGCGGCGGG - Intergenic
1148773189 17:50078758-50078780 AGGGCCCTGGCAGAGGGGGGTGG - Intronic
1148795132 17:50193238-50193260 AGGGAAAAGGCAGAGGAGCCTGG - Intronic
1148892937 17:50820776-50820798 AGGGCAGAGACAGAAGCGGCTGG + Intergenic
1148899702 17:50866500-50866522 AGGGCAGGGGCGGAGCCGGCCGG - Intronic
1149993944 17:61397279-61397301 AGGGCGCGGGCGGGGGCGGCTGG - Intergenic
1150488740 17:65560799-65560821 AGTGCCGAGGCCGAGGCGGCCGG - Intronic
1150640416 17:66946003-66946025 TGGGCAAAGGCAGAGGCGGTGGG - Intergenic
1151359334 17:73579161-73579183 AAGGGGCAGGCAGAGGTGGCAGG - Intronic
1151517080 17:74603428-74603450 AGGGCCCAGGGAGGGGCAGCTGG + Intergenic
1151598301 17:75091121-75091143 AGGGAACAGGCAAAGGCAGGAGG + Intronic
1151882145 17:76902460-76902482 GGCCCACAGGCAAAGGCGGCAGG - Intronic
1152030222 17:77837752-77837774 AGGCCACAGGCAGAGGTTGATGG + Intergenic
1152263349 17:79278933-79278955 ATGACAGAGGCAGAGGCAGCTGG - Intronic
1152302048 17:79500764-79500786 AGGGAACAGGCAGGGGCTGCAGG - Intronic
1152477459 17:80527341-80527363 AGGGCACAGAGAGAGGCTGAGGG + Intergenic
1154306142 18:13232327-13232349 AGGCCACAGACAGAGGCGGGAGG - Intronic
1157280676 18:46344678-46344700 ACGTCACAGGCAGAGGGGGCAGG - Intronic
1157581926 18:48778660-48778682 AGGTAACAGGCAGAGGTGGTGGG + Intronic
1158138181 18:54228472-54228494 AGGGCACAGCCAGGGGTGGTGGG + Intergenic
1158454371 18:57593480-57593502 AGCCCCCAGGCAGAGGCTGCTGG + Intergenic
1158939395 18:62393092-62393114 AGAGCTGAGTCAGAGGCGGCTGG - Intergenic
1160009085 18:75090017-75090039 AGAGCACAGTCAGAGGTGGTGGG + Intergenic
1160501064 18:79401213-79401235 TGGGCACAGACAGGGGCGGACGG - Intronic
1160682619 19:418701-418723 AGGGGACAGGGAGTGACGGCTGG + Intronic
1160746847 19:715787-715809 ATGGCAGAGCCAGAGGGGGCAGG + Intronic
1160762978 19:795162-795184 AGCAGACAGGCAGGGGCGGCCGG - Intergenic
1160776525 19:859153-859175 AAGGCCAAGGCAGAGGCAGCTGG - Intergenic
1161041724 19:2113986-2114008 GGGGCACAGGGCGAGGCGGCTGG + Intronic
1161106706 19:2447372-2447394 AGTGCACAGACACAGGCAGCGGG + Intronic
1161179204 19:2867911-2867933 GAGGCCCAGGCAGGGGCGGCTGG - Intronic
1161485714 19:4534750-4534772 TGGGCCCAGGCAGGGGCCGCAGG - Intronic
1161499698 19:4607100-4607122 AGCGCGTAGGTAGAGGCGGCGGG + Intergenic
1161566624 19:5006186-5006208 CGGGGACAGGGAGAGGCTGCGGG - Intronic
1162013936 19:7833575-7833597 AGGTCACAGGCAGGCGTGGCAGG + Intronic
1162076900 19:8194068-8194090 GGGACACAGGAAGAGGCTGCAGG - Intronic
1162124355 19:8491192-8491214 AGGGTAAAGGCTGAGCCGGCGGG - Intronic
1162372933 19:10289869-10289891 GGGGCGGCGGCAGAGGCGGCGGG - Intergenic
1162432044 19:10634945-10634967 AGGGCAAAGGCTGAGCCGGCTGG - Intronic
1162731420 19:12721214-12721236 GGGCCACAGGCGGCGGCGGCGGG + Intronic
1162894786 19:13758790-13758812 AGGAAGCAGGCAGAGGCGACAGG + Intronic
1162930380 19:13954445-13954467 TGGGCCCAGGCAAAGGGGGCAGG + Intronic
1163035861 19:14568440-14568462 AGGGAACAGCCAGGGGCTGCAGG - Intronic
1163311983 19:16520314-16520336 AGGCCACAGGAAGAGGCCTCAGG + Exonic
1163439121 19:17312666-17312688 AGTGCACAGGAAGCGGCTGCAGG - Intronic
1163674145 19:18646952-18646974 AGGGCGGGGGCAGGGGCGGCGGG + Intronic
1163825226 19:19519762-19519784 AGGACAGAGGGAGAGGAGGCAGG - Intronic
1164536161 19:29087855-29087877 AGGAGACAGGGAGATGCGGCTGG + Intergenic
1164880131 19:31726028-31726050 AGGGCCCAGACACAGGAGGCAGG + Intergenic
1165433910 19:35786757-35786779 AAGGCAGAGGCAGGGGCGGGGGG - Intronic
1165511475 19:36268926-36268948 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165512023 19:36271449-36271471 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165512571 19:36273948-36273970 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165513122 19:36276491-36276513 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165513677 19:36279044-36279066 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165514226 19:36281578-36281600 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165514780 19:36284117-36284139 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165515332 19:36286648-36286670 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165515882 19:36289186-36289208 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165516433 19:36291721-36291743 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165516985 19:36294249-36294271 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165517538 19:36296772-36296794 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165518090 19:36299307-36299329 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165518641 19:36301842-36301864 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165519189 19:36304372-36304394 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165519738 19:36306887-36306909 AAGGCGCAGCCCGAGGCGGCGGG - Intergenic
1165623781 19:37269165-37269187 GCGGCACAGCCAGAGGCGGCGGG + Intergenic
1165624871 19:37274232-37274254 GCGGCACAGCCAGAGGCGGCGGG + Intergenic
1165742301 19:38211396-38211418 CGGGCACAGGCTGGGGCGGTCGG + Intronic
1165746557 19:38233353-38233375 GGGACACAGGCAGAGGGGTCGGG + Intergenic
1165746569 19:38233388-38233410 GGGACACAGGCAGAGGGGTCTGG + Intergenic
1165746626 19:38233556-38233578 GGGACACAGGCAGAGGGGTCCGG + Intergenic
1165746642 19:38233590-38233612 GGGGCACAGGCAGAGGGGTCGGG + Intergenic
1165746652 19:38233625-38233647 AGGACACAGGCAGAGGGGTCCGG + Intergenic
1165746667 19:38233659-38233681 GGGGCACAGGCAGAGGGGTCGGG + Intergenic
1165804580 19:38572744-38572766 GGGGCACAGGCAGAGGGATCGGG - Intronic
1165804613 19:38572846-38572868 GGGGCACAGGCAGAGCAGTCGGG - Intronic
1165806558 19:38584354-38584376 GGGGCACAGGCAGAGGGGTCAGG - Intronic
1165806578 19:38584421-38584443 GGGGCACAGGCAGAGGGGTCAGG - Intronic
1165806604 19:38584491-38584513 GGGGCACAGGCAGAGGGGTCAGG - Intronic
1165806616 19:38584525-38584547 GGGGCACAGGGAGAGGGGTCAGG - Intronic
1165806630 19:38584559-38584581 GGGGCACAGGCAGAGGGGTCAGG - Intronic
1165806656 19:38584627-38584649 GGGGCACAGGCAGAGGGGTCAGG - Intronic
1165806669 19:38584662-38584684 GGGGCACAGGCAGAGGGGTCAGG - Intronic
1165806682 19:38584695-38584717 GGGGCGCAGGCAGAGGGGTCAGG - Intronic
1165843805 19:38805434-38805456 AGGGCACAGGCAGAGGGGCAGGG - Intronic
1165955397 19:39499157-39499179 CGGGCGCAGGGTGAGGCGGCCGG - Intronic
1165999191 19:39867794-39867816 CGGGCATAGGCAGAGGGGTCAGG + Intronic
1165999618 19:39870644-39870666 GAGGCACAGGCAGAGGGGTCAGG + Intronic
1165999629 19:39870678-39870700 GGGGCAAAGGCAGAGGGGTCAGG + Intronic
1165999664 19:39870780-39870802 GGGGCACAGGCAGAGGGGTCAGG + Intronic
1165999722 19:39870949-39870971 GGGGCAAAGGCAGAGGGGTCAGG + Intronic
1165999748 19:39871017-39871039 GGGGCACAGGCAGAGGGGTCAGG + Intronic
1165999760 19:39871049-39871071 GGGGCACAGGCAGAGGGGTCAGG + Intronic
1165999774 19:39871084-39871106 GGGGCACAGGCAAAGGGGTCAGG + Intronic
1166044134 19:40219557-40219579 GAGGCACAGGCAGAGGGGTCGGG + Intergenic
1166068989 19:40376921-40376943 GGGGCACAGGGAGAGGGGCCAGG + Intronic
1166069003 19:40376955-40376977 GGGGCACAGGCAGAGGGGTTGGG + Intronic
1166069035 19:40377057-40377079 GGAGCACAGGCAGAGGGGTCAGG + Intronic
1166069072 19:40377157-40377179 GGGGCACAGGCAGAGGGGTCGGG + Intronic
1166069125 19:40377295-40377317 GGGGCACAGGCAGAGGGGTCAGG + Intronic
1166069150 19:40377364-40377386 GGGGCACAGGCAGAGGGGTCAGG + Intronic
1166069177 19:40377433-40377455 GGGGCACAGGCAGAGGGGTCAGG + Intronic
1166072558 19:40395497-40395519 AAGGCAGAGGCTGAGGGGGCTGG - Exonic
1166116972 19:40662306-40662328 GGGGCACAGGCAGAGGGGTCGGG + Intergenic
1166120133 19:40681314-40681336 GAGGCACAGGCAGAGGGGTCAGG + Intronic
1166137388 19:40785979-40786001 AGAACACAGGCAGAGGGGTCAGG + Intronic
1166137784 19:40787638-40787660 AGGGCACAGGCAGAGGGATCAGG + Intronic
1166293379 19:41877443-41877465 AGGGCACAGGCAGAGGGAAGGGG + Intronic
1166339875 19:42131071-42131093 TGGGCACAGGCAGAGGTGTCGGG - Intronic
1166451939 19:42909760-42909782 AGGGGACAGGCAGAAGCTGGTGG + Intronic
1167623133 19:50569597-50569619 AGGGCAGATGCAGAGGCCTCTGG + Intergenic
1167852090 19:52210014-52210036 AGGTGACAGGCAGGGGTGGCAGG - Intronic
1168175443 19:54624778-54624800 AGGGCACAGGCAGAACCCTCAGG + Intronic
925082113 2:1078553-1078575 AGGGGACAGGGAGAGACTGCAGG + Intronic
925411410 2:3641938-3641960 TGGGGACAGGCAGAGGCTGCTGG + Intronic
925411772 2:3643650-3643672 AAGGCACAGCCACAGGCAGCAGG - Intronic
926054703 2:9767837-9767859 ACGGCACAAGCAGAGGCAGGGGG - Intergenic
926099208 2:10103319-10103341 AGGGCACAGGGAGAGGAGCTGGG + Intergenic
926175046 2:10583446-10583468 CGGGCCCAGGAAGAGGAGGCTGG - Intronic
926216989 2:10912032-10912054 GGCGCGCAGGCAGCGGCGGCAGG - Exonic
929053555 2:37857474-37857496 AGACCACAGGCAGAGGCGAGGGG - Intergenic
929758695 2:44788577-44788599 AGGTCACAGGCAGAGTGGCCAGG - Intergenic
929780280 2:44952776-44952798 AGGGGAAAGGCAGCGGTGGCCGG - Intergenic
929822854 2:45287395-45287417 AGGGCACAGGCAACTGCTGCTGG + Intergenic
930686528 2:54313916-54313938 AGGGCAGAGGCAGAGGCAAGGGG - Intergenic
931234788 2:60404051-60404073 CGGGCACGGGCAGAGGGAGCTGG - Intergenic
931305789 2:61026973-61026995 AGGGAACAGGGAGAGGCAACAGG - Intronic
931683627 2:64773411-64773433 TGGGAAGAGGCAGAGGAGGCTGG + Intergenic
932285549 2:70528898-70528920 AAGGAACAGGGAGAGGAGGCTGG - Intronic
934176662 2:89583919-89583941 AGGGCAAAGGCGGTGGCAGCTGG + Intergenic
934286971 2:91658280-91658302 AGGGCAAAGGCGGTGGCAGCTGG + Intergenic
934478039 2:94605831-94605853 AGGGGATGGGCAGAGGAGGCTGG + Intergenic
936273569 2:111071085-111071107 AGGTGACAGGCAGTGGCAGCTGG - Intronic
936381217 2:111988198-111988220 AGGAGACAGGAAGAGGCGGTGGG - Intronic
937305579 2:120868544-120868566 AAGGAACAGGCAGGGGCAGCTGG + Intronic
937312119 2:120908944-120908966 CAGGCACAGGCAGAGACGGGGGG - Intronic
937323769 2:120976726-120976748 AGGGCACAGGCAGAAGCCCCTGG - Intronic
937666549 2:124494321-124494343 AGGCCAAAGGCTGAGGCGCCTGG + Intronic
937900545 2:127016129-127016151 AGGGAACAGGCCGAGGTGGGAGG + Intergenic
938092259 2:128441472-128441494 GTGCCAAAGGCAGAGGCGGCAGG + Intergenic
940639567 2:156332611-156332633 AGGGAGCAGGGACAGGCGGCCGG + Exonic
940767871 2:157809521-157809543 AGGAGACAGGGAGAGGAGGCAGG + Intronic
940905650 2:159167250-159167272 AAGGCACAGGTAGAAGGGGCAGG - Intronic
942277688 2:174334872-174334894 AGGGCGCAGGCAGAGCAGACCGG - Intergenic
942453397 2:176122357-176122379 AGGGCACACGGAGCGGCCGCGGG - Intergenic
943612011 2:190045140-190045162 AGGACACTGGCAGGGGTGGCTGG + Intronic
944406145 2:199385840-199385862 AGGTGACAAGCAGAGGAGGCTGG - Intronic
944666138 2:201961243-201961265 GGGGAACAGGCAGAGGCGGGAGG + Intergenic
945045611 2:205778894-205778916 AGAGCAAAGGCAGAGGTTGCAGG - Intronic
946130832 2:217605376-217605398 GGGGCACAGGATGAGGCGGTAGG + Intronic
946239647 2:218345756-218345778 AGGGCAGAGGCAGAGGCCAGTGG - Exonic
946410483 2:219513003-219513025 TGGGGCCAGGCAGAGGCTGCGGG + Intergenic
946692279 2:222319050-222319072 AGGGCACGGGCTGCGGCGGGCGG - Intergenic
947615601 2:231555027-231555049 AGGGCAGAGGCGGAGACAGCTGG - Intergenic
947901588 2:233725301-233725323 GAGGCAGAGGCAGAGGCGCCTGG + Intronic
948136402 2:235639427-235639449 TGGGCAGAGGAAGAGGAGGCTGG + Intronic
948159734 2:235814052-235814074 TGGGCACACACACAGGCGGCTGG - Intronic
948259107 2:236589978-236590000 TGGGCACGGGCAGAGGTGCCTGG + Intergenic
948567220 2:238894704-238894726 TGGGCACAGGCAGAGATGGGAGG - Intronic
948717392 2:239874210-239874232 AGGGCCCAGGCAGAGGCAGGTGG - Intergenic
948806748 2:240456358-240456380 GGGGCACAGGAGGAGCCGGCGGG + Intronic
1169109411 20:3022293-3022315 AGGGCCCTGGCTGAGGAGGCTGG + Intronic
1169131720 20:3169262-3169284 AGGGCTGAGGCATAGGGGGCTGG - Intronic
1169136369 20:3200194-3200216 AGGGCACAGACCCAGGCGGCAGG + Intronic
1169699469 20:8430287-8430309 AGGGGACAGGGAGAGGCCTCAGG + Intronic
1169901984 20:10562489-10562511 CGGGCACACACACAGGCGGCTGG - Intronic
1170044632 20:12072252-12072274 AGGTCAGAGGCAGAGGCTGGAGG + Intergenic
1170589227 20:17758522-17758544 AGGTCACAGACAGTGGTGGCTGG + Intergenic
1170749167 20:19130113-19130135 AGGGTACTGGCAGCGACGGCAGG - Intergenic
1170958569 20:21003985-21004007 AGGGAACAGGGAGGGGAGGCAGG + Intergenic
1171245270 20:23605875-23605897 AGGGCAAAGGCAAGGGCTGCTGG - Exonic
1171387635 20:24780881-24780903 GGGCCACAGGCAGAGGCAGAAGG + Intergenic
1172175529 20:32969900-32969922 AGGGCATAGGCTGAGTCAGCCGG - Intergenic
1173000829 20:39104488-39104510 AGGTCACAAGCAGAGGAGGTAGG + Intergenic
1173005763 20:39138588-39138610 AGGGCACTGGCAGAGTCCACTGG - Intergenic
1173007372 20:39150663-39150685 AGGGGGCAGGCAGAGGGGCCTGG + Intergenic
1173370380 20:42429586-42429608 AGGGCACAGGCAGAGAAAGGTGG + Intronic
1173460377 20:43238578-43238600 TGAGCACACGCAGAGGCTGCAGG + Intergenic
1173954170 20:47017962-47017984 AGAGCAGAAGCAGAGGAGGCAGG - Intronic
1175064332 20:56272492-56272514 AGAGGACAGGCAGTGGGGGCAGG - Intergenic
1175246086 20:57582957-57582979 AGGGCACAGGCTGAGGGGTCTGG + Intergenic
1175552341 20:59825741-59825763 AGGGCCCAGGCAGAGGCGCTGGG + Intronic
1175812764 20:61867644-61867666 AGGGCACAGGAGGAGGGGCCTGG - Intronic
1175919574 20:62444378-62444400 AGGTCTCAGGCTGGGGCGGCTGG + Intergenic
1176042520 20:63072806-63072828 AGGGCACGGGGAGAGGGGCCTGG + Intergenic
1176150840 20:63590006-63590028 AGGGAGCGGGCAGAGGCCGCAGG - Exonic
1176268635 20:64223845-64223867 AGGGCCAAGGCAGAAGCAGCTGG - Intronic
1176283369 20:64327974-64327996 AGGGCGCAGGCGGCGGCGGGCGG - Intergenic
1176419020 21:6499392-6499414 AGGGCACCGGCAGGGGGCGCGGG - Intergenic
1176512911 21:7762129-7762151 TGGGCAGAGGGAGAGGCAGCAGG + Intronic
1177074110 21:16550345-16550367 AGGGCAGAGGCAGGAGAGGCAGG + Intergenic
1177472896 21:21581698-21581720 AGAGCACAGGCAGAGGCAATTGG - Intergenic
1178647024 21:34392653-34392675 TGGGCAGAGGGAGAGGCAGCAGG + Intronic
1178773701 21:35528965-35528987 AGGGCAGAGGCAGGGGCTGCCGG - Intronic
1179101485 21:38358862-38358884 AGGGCATTGGCAGAGGCCTCTGG + Intergenic
1179533060 21:42033135-42033157 AGGGCACAGCCAGGGGCAGGTGG + Intergenic
1179584330 21:42365289-42365311 AGGGCGCAGGCAGATGGGCCTGG + Intronic
1179694513 21:43107714-43107736 AGGGCACCGGCAGGGGGCGCGGG - Intergenic
1179707963 21:43193562-43193584 CGGGCACAGGCATAGGCCCCAGG - Intergenic
1179716646 21:43291889-43291911 CGGGCCCAGGCAGCGGTGGCTGG + Intergenic
1179731350 21:43369451-43369473 AGGGGAGAGGCAGGGGCTGCAGG + Intergenic
1179828526 21:43981809-43981831 AGGCCCCTGGCAGGGGCGGCAGG - Intronic
1179831430 21:43999476-43999498 AGGACACAGGCAGACAGGGCTGG - Intergenic
1179917275 21:44485560-44485582 AGGGCAGAGGCAGAAACTGCTGG + Intergenic
1179942259 21:44647921-44647943 AGGGGACAGGCATGGGCGGGTGG - Intronic
1179991342 21:44949631-44949653 AAGGCGCAGGCAGAAGCGGCAGG - Intronic
1180157223 21:45983532-45983554 GGGGCACAGTCAGAGGCTGCCGG + Intronic
1181057696 22:20267866-20267888 AGGGCGGAGCCGGAGGCGGCAGG - Intronic
1181090789 22:20471133-20471155 AGGGCAAAGGCAGAGGCCTGGGG + Intronic
1181097207 22:20513711-20513733 AGGGCACAGGAGGTGGTGGCAGG - Intronic
1181307884 22:21927241-21927263 AGGGCACGGGGAGAGGCAGGTGG + Intronic
1181580828 22:23827244-23827266 TGGGCACTGGCAGCGGCTGCAGG - Intronic
1181594648 22:23906471-23906493 AGGGCCCAGACAGAGGCAGGAGG - Intergenic
1181623351 22:24105882-24105904 AGAGCACAGGCAGACCCAGCCGG + Intronic
1181638053 22:24183383-24183405 AGGGCACAGGGACAGCTGGCTGG + Intronic
1182392297 22:30008558-30008580 ATGGCACAGGCAGAGGCACCAGG + Intronic
1182462041 22:30490079-30490101 AGTGCACAGGTAGAGGTGGCTGG + Exonic
1182549508 22:31093333-31093355 AGGGCAAAGGCAAGGGCAGCGGG - Intronic
1182866410 22:33608040-33608062 AGGGCCAAGTCAGAGGCAGCAGG + Intronic
1183058340 22:35320396-35320418 AGGGGACAGGGAGAGCAGGCTGG + Intronic
1183194321 22:36343030-36343052 AGGGCACAGGTGGAGGGGGCTGG - Intronic
1183223991 22:36536764-36536786 AGGGCAGAGCCAGAGAGGGCGGG + Intergenic
1183301062 22:37059445-37059467 CGGACACAGGCTGAGGCGGGTGG - Intronic
1183409216 22:37645191-37645213 AGGACAGAGGCAGTGGAGGCGGG + Intronic
1183752459 22:39729440-39729462 AGGTCACATGCAGAGGCACCTGG - Intergenic
1183969990 22:41469407-41469429 TGGGCCCAAGCAGCGGCGGCCGG + Intronic
1184117053 22:42428290-42428312 GAGGCACAGGCAGAGGTGGGCGG - Intronic
1184445129 22:44542645-44542667 AGGGCACAGACACAGGAGCCTGG - Intergenic
1184665428 22:45986580-45986602 AGGGCACACGCACAGACAGCCGG + Intergenic
1184691978 22:46121602-46121624 GGGGCAGAGGCAGGGGTGGCAGG + Intergenic
1184693361 22:46127394-46127416 AGGTCAGGGGCAGGGGCGGCAGG - Intergenic
1184794354 22:46722946-46722968 TGGGGAGAGGCAGAGGCCGCTGG + Intronic
1185023949 22:48396944-48396966 CAGGCCCAGGCAGAGCCGGCAGG + Intergenic
1185058039 22:48591482-48591504 AGAGCACAGACAGAGGCAGCTGG + Intronic
1185071918 22:48661316-48661338 AGGGCACAAGGAGAGAGGGCTGG - Intronic
1185137385 22:49080519-49080541 AGGCCACAGGCCCAGGGGGCTGG - Intergenic
1185157781 22:49204741-49204763 CGGGCACTGGCAGGGGCTGCGGG - Intergenic
1185288111 22:50011275-50011297 AGGGCAGGGGCTGAGGCGGGTGG - Intronic
1185409604 22:50674822-50674844 AGGGTCCCGGCGGAGGCGGCGGG - Intergenic
949808295 3:7978665-7978687 CGGGCACAGACACAAGCGGCTGG - Intergenic
950136398 3:10584170-10584192 GGGGCAGAGGCAGGGGCTGCGGG + Intronic
950703862 3:14768182-14768204 AGGGCACAGGGTGAGGAGACTGG + Intronic
950704126 3:14769572-14769594 AGGGCACAGGGTGAGGAGACTGG + Intronic
950870121 3:16220894-16220916 AGGGCAGAGCCAAAGGAGGCCGG - Intronic
952747165 3:36792349-36792371 AGGGCATAGCCAGAGGAGGAAGG + Intergenic
953188444 3:40660732-40660754 AAGGGACAGGCAGAGGCCACTGG - Intergenic
953906720 3:46872148-46872170 GGGGCACAGGCTGAGGCAGTGGG - Intronic
954418946 3:50408436-50408458 AGGGCCCAGGCAGAGGTGACAGG + Intronic
954419601 3:50411803-50411825 GGGCCACAGGCAGAGGCTGCTGG - Intronic
954671332 3:52292798-52292820 AGGGCTCGGGCAGGGGTGGCCGG + Exonic
954808966 3:53236289-53236311 AGGGCCAAGGCAGGGGCAGCAGG + Intronic
956216883 3:66858332-66858354 CGGGCACAGACACAAGCGGCTGG + Intergenic
956390800 3:68770934-68770956 AGGGCACACACACAAGCGGCTGG + Intronic
956483891 3:69700901-69700923 AGGTCACAGGCAGAGAGAGCAGG + Intergenic
957089935 3:75719580-75719602 AGGGCACACACTGAGGCGGATGG - Intronic
959539885 3:107525275-107525297 GAGGCAGAGGCAGTGGCGGCGGG + Intronic
961056152 3:123790372-123790394 AGGGCAAAGGCAAAGGGGCCTGG + Intronic
961067203 3:123885327-123885349 AGGGCACATGGAGAGGCTCCTGG - Intergenic
961175916 3:124834844-124834866 AGGCCACAGGTAGAGGCCACAGG + Intronic
961282742 3:125776350-125776372 GGGGCACAGTCAGGGGTGGCAGG - Intergenic
961418926 3:126784353-126784375 AGGAAACAGGAAGAGGCTGCTGG - Intronic
961543994 3:127619282-127619304 AGAGCCCAGGCAGAGCCGGGAGG + Intronic
961710238 3:128823061-128823083 GGGGCAGATGCAGAGGCAGCTGG - Intergenic
962756193 3:138467300-138467322 AGGGGACAAGCAGAGGCTGCTGG - Intronic
965458902 3:168936815-168936837 AGGGCACAAGCAAAGTAGGCTGG + Intergenic
966235900 3:177701115-177701137 AGGCCACAGGCCGAGGCTGGAGG - Intergenic
967230403 3:187332429-187332451 GGAGCACATGCAGAGACGGCAGG - Intergenic
967931133 3:194691096-194691118 AGGGCACAGACGGAGGAGGAAGG - Intergenic
968279675 3:197466868-197466890 AGGGCAGAGGCAGAGAGGGAAGG + Intergenic
968451012 4:676042-676064 AGGGTTCAGGCAGAGGCCTCAGG - Intronic
968516817 4:1018962-1018984 TAGGCACGGGCAGAGGCAGCTGG - Intronic
968563259 4:1296015-1296037 GGGGCACAGGCACAGGTGGGGGG - Intronic
968563316 4:1296216-1296238 GGGGCACAGGCACAGGTGGGGGG - Intronic
968601052 4:1509488-1509510 AGGGCACAGGCATCAGGGGCTGG + Intergenic
968610690 4:1555618-1555640 TAGGCAGAGGCAGAGGCTGCAGG - Intergenic
968876500 4:3270455-3270477 AGGGCACAGTCTGAGGTCGCAGG - Intronic
969122250 4:4919198-4919220 AGGGCATATGCAGAGGCTGGTGG - Intergenic
969532904 4:7739665-7739687 AGGGCACCGGGAGACACGGCTGG - Intronic
969562215 4:7956550-7956572 ATGGCACAGGCAAAGGCCTCAGG - Intergenic
969593149 4:8133257-8133279 AGGTCACATGCAGAGGGGTCAGG + Intronic
969638548 4:8383217-8383239 AGGGCACAGGCAGGGTTGGGCGG + Intronic
969646562 4:8433137-8433159 AGGCCCCAGCCAGAGGCTGCTGG - Intronic
969714114 4:8860274-8860296 CGGGCACAGGCTGAGGGGACCGG + Intronic
970227460 4:13874533-13874555 AGGGCAGAGGGAGAGGGGTCGGG + Intergenic
972866527 4:43240035-43240057 TGGGCACAAGCAGAAGCTGCAGG + Intergenic
973044537 4:45519559-45519581 GGGGCACAGACACAGGTGGCTGG - Intergenic
973827498 4:54723335-54723357 ATGGCTGAGGCAGAGGTGGCAGG - Intronic
974752035 4:66154152-66154174 AAGGCAGAGACAGAGGCAGCTGG + Intergenic
975956358 4:79844869-79844891 AGGGCACAGGCAGTAGCTTCAGG + Intergenic
976523684 4:86060286-86060308 AGGGCATAGGGAGAGGGAGCAGG - Intronic
976619798 4:87115852-87115874 GAGGCAGAGGCAGAGGCGGGTGG - Intronic
977045219 4:92060983-92061005 TGGGCACAGACACAGGTGGCTGG - Intergenic
977819733 4:101458120-101458142 AGAGCTCAGGCAGGGGTGGCTGG - Intronic
980068994 4:128222809-128222831 AGGCCACAGGCAGAGCCCGCAGG + Intronic
980734462 4:136867236-136867258 AGGGCACACACAGAGGTGGCTGG + Intergenic
980817009 4:137961206-137961228 AGGGCAGTGGCAGAAGCAGCTGG + Intergenic
980920898 4:139084410-139084432 ACGGCAGGGGCAGGGGCGGCAGG + Intronic
981413496 4:144460145-144460167 AGGGCAAAGGCAGAGACGTGGGG + Intergenic
982959417 4:161818071-161818093 AAGGCAGAGACAGAGGCAGCTGG + Intronic
983554903 4:169051311-169051333 GGGGCAGAGGAAGAGGCAGCTGG - Intergenic
985280663 4:188283023-188283045 CGGGCACGGGCAGATGGGGCCGG - Intergenic
985345650 4:189001868-189001890 AGAACACAGGCAGGGGTGGCTGG + Intergenic
985515874 5:344256-344278 GCGGCAGAGGCGGAGGCGGCGGG + Intronic
985675312 5:1228287-1228309 AGTGCCCAGGCAGTGGGGGCTGG + Intronic
985777259 5:1851348-1851370 AGGGCGCAGGAGGAGGCTGCAGG - Intergenic
986302019 5:6484771-6484793 AGGGAACAAGCAGAGAGGGCTGG - Intronic
988622937 5:32842170-32842192 AGGGCACAGGCATGGGTGGAGGG + Intergenic
988935901 5:36082891-36082913 AGAGCACTGGCAGGGGTGGCTGG - Intergenic
989367219 5:40670195-40670217 AGGGCACAGGGATGGGCGGTAGG + Intergenic
992042382 5:72848575-72848597 GGGGCAGAGGCGGAGGCGACGGG - Intronic
995831801 5:116362089-116362111 AGGACAGAGGGAGAGGCTGCAGG + Intronic
997342056 5:133152679-133152701 AGGACACAGGGAGCGGAGGCCGG - Intergenic
998043502 5:138968451-138968473 GGCGCTCAGGCAGAGGCGGTGGG - Intronic
998365829 5:141630153-141630175 AGGGCCCAGACAGAGGCAGGAGG - Intronic
999074371 5:148780652-148780674 AGAGCACTGGCAGAGGTGGCTGG - Intergenic
999262782 5:150247832-150247854 AGGGCAGTGGGAGAGGAGGCCGG + Intronic
999583237 5:153062744-153062766 AGGGCAAAGGCACAGGCAGTGGG - Intergenic
999959133 5:156735430-156735452 AGAGCACTGGCAGGGGTGGCTGG + Intronic
1001043860 5:168356297-168356319 AGGGAACATGCCGATGCGGCCGG + Intronic
1001344838 5:170884592-170884614 GTGGCAGAGGCAGAGGAGGCAGG + Intronic
1001486078 5:172120453-172120475 AGGCCACAGGGACAGGGGGCAGG - Intronic
1002106520 5:176881913-176881935 TGGGCCCAGGCAGTGGTGGCTGG - Intronic
1002195522 5:177498819-177498841 AGGCCAGAGGCAGAGGAGGATGG - Intergenic
1002313794 5:178330410-178330432 AGTTCACAGGCCGAGGCGGGAGG + Intronic
1002661313 5:180792671-180792693 GGGTCACAGGCACACGCGGCTGG + Exonic
1002895120 6:1374526-1374548 AGGTCAGAGGCAGAGGGAGCAGG - Intergenic
1003071583 6:2949335-2949357 AGGGCAGAGGCCCAGGCGGGAGG - Intronic
1003445259 6:6178031-6178053 AGGCCACAGGGAGAGGGGGGGGG + Intronic
1003594699 6:7463928-7463950 AGAGCACAGCCAGATGCTGCTGG + Intergenic
1004362617 6:14984689-14984711 AGGGCAGAGGCAGAAACGGAAGG + Intergenic
1004486961 6:16075704-16075726 AGGGAAAAGGCAGAGGCTGGTGG - Intergenic
1004746157 6:18511048-18511070 CAGGCACAGGCACAAGCGGCTGG + Intergenic
1005983687 6:30856756-30856778 ATGGTAGAGGCAGAGGGGGCTGG - Intergenic
1006033560 6:31195328-31195350 GGAGCCCAGGCAGAGGAGGCGGG - Intergenic
1006067539 6:31472852-31472874 AGGGCACAGCCACAGGCCACTGG - Intergenic
1006247863 6:32756238-32756260 AGTGCACAGGCAGAGGCTCTGGG + Exonic
1006423076 6:33947607-33947629 TGGGCAGAGACAGAGGAGGCCGG + Intergenic
1006581629 6:35080888-35080910 ACGGCACAGGCAGCGGCACCGGG - Intronic
1007276232 6:40676149-40676171 AGGGCACAGGCAGAGGTTGAAGG - Intergenic
1008619188 6:53255105-53255127 AGGCAAAAGGCAGAGGAGGCAGG - Intergenic
1009006820 6:57798576-57798598 CGGGCACAGACACAAGCGGCTGG - Intergenic
1009009033 6:57821339-57821361 CGGGCACAGACACAAGCGGCTGG - Intergenic
1012440164 6:99254989-99255011 AGGGCAGAGACAGAAGCAGCTGG + Intergenic
1015168351 6:130224217-130224239 CGGGCACAGACACAAGCGGCTGG - Intronic
1016916184 6:149246628-149246650 AGGGCTCAGGCGGAGGGGCCAGG + Intronic
1017801033 6:157896902-157896924 GGGGCCCAGCCAGAGGGGGCTGG + Exonic
1017818203 6:158030058-158030080 GGAGCCCAGGCAGAGGCGGCTGG + Intronic
1018729735 6:166639711-166639733 TGGGCAGAGGCAGAGCGGGCAGG - Intronic
1018766636 6:166938769-166938791 AGTGCACATGCAGAAGCTGCTGG + Intronic
1018795767 6:167184420-167184442 AGAGCACAGGCTGTGGAGGCGGG + Intronic
1018820553 6:167370644-167370666 AGAGCACAGGCTGTGGAGGCGGG - Intronic
1018831014 6:167443606-167443628 AGGGCACAGGAGGAGGCGAAGGG + Intergenic
1019104381 6:169656648-169656670 AGGGCCCAGGAGGAGGAGGCTGG + Intronic
1019173058 6:170145650-170145672 ATGGCACAGGCAGGGAGGGCCGG - Intergenic
1019631561 7:2052425-2052447 AGGGCCCAGGCACAGCAGGCAGG + Intronic
1019631573 7:2052469-2052491 AGGGCCCAGGCACAGCAGGCAGG + Intronic
1021491241 7:21221496-21221518 CGGGCCCGGGCAGAGGCGGCAGG + Intergenic
1021698020 7:23292532-23292554 AACGCACTGGCAGAGGAGGCAGG + Intergenic
1022131833 7:27411818-27411840 AGGGCACAGGCAGACGCAGGGGG - Intergenic
1023829718 7:44031738-44031760 TGGTTACAGGCAGAGGCTGCAGG + Intergenic
1023981641 7:45073955-45073977 AGGGCACAGGCATTGGCCCCGGG + Intronic
1024044168 7:45575900-45575922 AGGGCCCAGGAAGAGTCCGCGGG - Intronic
1024259289 7:47561806-47561828 AGGGCAAAGGCAGAAGCTGCAGG - Intronic
1024602269 7:50994337-50994359 GGGGCTCAGGCAGAGGAGGAAGG - Intergenic
1024930194 7:54661016-54661038 AGGACACAGGCAGGGGATGCTGG + Intergenic
1025025061 7:55509896-55509918 AGGGCAGAGGAACAGGCGGTGGG - Intronic
1025230959 7:57203178-57203200 AGGGCCGAGGCGGAGGAGGCGGG - Intergenic
1026497647 7:70917517-70917539 AGGACACAGGCCAAGGCGGGCGG - Intergenic
1026557809 7:71423074-71423096 TGGGCACAGACACAAGCGGCTGG - Intronic
1026951985 7:74353819-74353841 GTGGCACAGGCAGAGATGGCAGG - Intronic
1029038619 7:97549532-97549554 AAGGCAGAGACAGAGGCGGCTGG + Intergenic
1029375711 7:100175952-100175974 AGTGAACAGGCAGAGGCAGGAGG + Intronic
1029438421 7:100574844-100574866 AGGGCAGGGGCAGGGCCGGCGGG + Exonic
1029740028 7:102485997-102486019 TGGTTACAGGCAGAGGCTGCAGG + Intronic
1029758025 7:102585176-102585198 TGGTTACAGGCAGAGGCTGCAGG + Intronic
1029775963 7:102684237-102684259 TGGTTACAGGCAGAGGCTGCAGG + Intergenic
1029826206 7:103197634-103197656 ATGGAGCAGGCAGAGGAGGCAGG + Intergenic
1030687841 7:112504942-112504964 AGGCCAGTGGCAGAGGCGGGAGG + Intergenic
1030769484 7:113456679-113456701 AAGGCAGAGACAGAGGCAGCTGG + Intergenic
1032087319 7:128890993-128891015 GAGGCAGAGGCAGCGGCGGCAGG + Exonic
1032462450 7:132122217-132122239 AGGGCACAGACAGAAGGGTCAGG - Intergenic
1033577630 7:142701474-142701496 AGGGTACAGGCAAAGGCAGAAGG + Intergenic
1035249144 7:157585591-157585613 TGAGCACAGGCAGAGGCCACAGG - Intronic
1035257890 7:157643662-157643684 AGGGCGCAGACAGAGGCTGGAGG - Intronic
1035272180 7:157726889-157726911 CAGGCACAGGCAGAGGCGCTTGG + Intronic
1035305467 7:157928787-157928809 AGGGCACAGGGATAGAGGGCAGG + Intronic
1035406849 7:158604281-158604303 ATGGCTCAGGCAGAGGCGAGAGG - Intergenic
1035456361 7:159011547-159011569 AGGGCAGATGCAGAGGCTGCTGG + Intergenic
1035702444 8:1646960-1646982 AGGGCAGAGGCAGAGGTGAGCGG + Intronic
1036256760 8:7212476-7212498 GGGGCACAGTCAGGGGTGGCAGG + Intergenic
1036284146 8:7429071-7429093 ATTGCAGAGTCAGAGGCGGCCGG - Exonic
1036308810 8:7671078-7671100 GGGGCACAGTCAGGGGTGGCAGG + Intergenic
1036337330 8:7882459-7882481 ATTGCAGAGTCAGAGGCGGCCGG + Exonic
1036360731 8:8075033-8075055 GGGGCACAGTCAGGGGTGGCAGG - Intergenic
1036439303 8:8766127-8766149 AGGACTCAGGGAGAGGCAGCAGG + Intergenic
1036702083 8:11019519-11019541 TGGCCACAGGCACAGGAGGCAGG + Intronic
1036743912 8:11390700-11390722 TGGGCAAAGGCAGAGGGGCCTGG + Intronic
1036786739 8:11692821-11692843 CGGGCAGAGGCGGGGGCGGCCGG + Intronic
1037181797 8:16015794-16015816 AGAGCACAGGAAGAGGCAGGAGG - Intergenic
1037354191 8:17999482-17999504 AGGGCACCGGCAGAGTCGTGAGG - Intronic
1037591138 8:20313136-20313158 ACAGCAGAGGCAGTGGCGGCAGG - Intergenic
1038338338 8:26663128-26663150 AAGGCATAGGCAGAGGTGACTGG - Intergenic
1039397677 8:37240964-37240986 AGGGCACAGGCAGACGGGCCTGG + Intergenic
1041709123 8:60876859-60876881 AGGACACAGGCAGAGACGGAGGG + Intergenic
1041934833 8:63323210-63323232 AGGGCAGAGGCAGAGGCCAGCGG - Intergenic
1042499004 8:69488839-69488861 AGTGGACAAGCAGAGGCTGCAGG + Intronic
1043291073 8:78601968-78601990 AGGGCAGAGGCTGTGGCTGCAGG + Exonic
1044668732 8:94657155-94657177 AGGGTACAGGCAGAGGCAGTGGG - Intronic
1044926767 8:97215799-97215821 AGGGCACTGACAGAGGGGGCTGG + Intergenic
1048011033 8:130456516-130456538 AGGAGCCAGGCAGAGACGGCCGG - Intergenic
1048671746 8:136730467-136730489 AGGGCACAGACACAAGCGGCTGG - Intergenic
1049004828 8:139847927-139847949 AGGGCACAGGCAGAGGCGGCAGG - Intronic
1049180021 8:141217482-141217504 AGGGCCACGGCAGAGGCTGCGGG - Intronic
1049222722 8:141435275-141435297 AGGGCTCAGACATAGGCGGTGGG - Intergenic
1049227922 8:141466522-141466544 AGAGCACAGGCGGAGGCGGATGG + Intergenic
1049236713 8:141515763-141515785 AGGGCACAGGCAAGGGTAGCAGG - Intronic
1049283464 8:141762263-141762285 TGGGGCCAGGCAGAGGCTGCAGG + Intergenic
1049405319 8:142449707-142449729 CGGGCGCAGGCGGCGGCGGCGGG + Exonic
1049425881 8:142537686-142537708 CAGGCACAGGCAGGGGCGGGGGG - Intronic
1049602827 8:143515836-143515858 GGTGCACAGGTAGAGGCGGCCGG - Intronic
1049674488 8:143883644-143883666 TGGGCCCAGGGAGAGGCGGCAGG - Intergenic
1049683274 8:143929259-143929281 AAGGCACAGGCAGAGGTGGAGGG - Exonic
1049726135 8:144147410-144147432 TCGGCAGAGGCGGAGGCGGCGGG - Intergenic
1050342509 9:4654768-4654790 AAGGCAGAGACAGAAGCGGCTGG - Intronic
1050691708 9:8234553-8234575 AGGGCACAGGCTGAGGGAGAAGG + Intergenic
1051524080 9:18022987-18023009 AGGGCACAGGAAGAGGGAGATGG - Intergenic
1052851909 9:33383729-33383751 AGGGGATGGGCAGAGGAGGCTGG - Intergenic
1053003508 9:34590432-34590454 AGGGGAGAGGCGGAGCCGGCTGG - Intergenic
1053129987 9:35609313-35609335 TGGCCACAGCCAGAGGCAGCTGG - Exonic
1053375782 9:37605216-37605238 TGGGCACAGGCTGAGTCTGCTGG - Intronic
1053680017 9:40480277-40480299 AGGGGATGGGCAGAGGAGGCTGG - Intergenic
1054283695 9:63144658-63144680 AGGGGATGGGCAGAGGAGGCTGG + Intergenic
1054293098 9:63315787-63315809 AGGGGATGGGCAGAGGAGGCTGG - Intergenic
1054391124 9:64620280-64620302 AGGGGATGGGCAGAGGAGGCTGG - Intergenic
1054504604 9:65896046-65896068 AGGGGATGGGCAGAGGAGGCTGG + Intergenic
1055561560 9:77526574-77526596 AAGGCAGAGGCAGAGGCTGGAGG + Intronic
1056002007 9:82227614-82227636 AGAACACAGGCAGGGGTGGCTGG + Intergenic
1056197746 9:84245139-84245161 GGGGAGCAGGCAGAGGCCGCAGG + Intergenic
1056754583 9:89373732-89373754 AGGACACAGGCAGAAGCGGTAGG + Intronic
1056982497 9:91328045-91328067 AAGGCCCAGACAGAGGTGGCAGG + Intronic
1057303436 9:93899447-93899469 AGGGAAGAGGCAGAGGCGGTGGG + Intergenic
1057416036 9:94863117-94863139 AGGGCACAGGTAGAGAGGCCAGG + Intronic
1057518277 9:95739465-95739487 ATGGCCCAGGCAGAGGTGGGGGG + Intergenic
1057830947 9:98406512-98406534 GGGGCACAGGGAGAGGAGTCAGG - Intronic
1057921999 9:99105180-99105202 GGGCCACAGGCGGTGGCGGCGGG + Exonic
1057957561 9:99423860-99423882 GGGGCACAGTGAGAGGTGGCTGG - Intergenic
1057957592 9:99423967-99423989 GGGGCACAGTGAGAGGTGGCTGG - Intergenic
1057957604 9:99424003-99424025 GGGGCACAGAGAGAGGCGGCTGG - Intergenic
1057957656 9:99424218-99424240 GGGGCACAGTGAGAGGTGGCTGG - Intergenic
1057957666 9:99424253-99424275 GGGGCACAGTGAGAGGTGGCTGG - Intergenic
1057957738 9:99424541-99424563 GGGGCACAGTGAGAGGTGGCTGG - Intergenic
1059102444 9:111483678-111483700 AGGACGCAGGCGGCGGCGGCGGG - Intronic
1059343784 9:113614968-113614990 AGGGCAGAGTGAGAGGCTGCCGG - Intergenic
1060295456 9:122340044-122340066 ATGGTACAGGCAGAGGCAGGAGG + Intergenic
1060624339 9:125096592-125096614 TGGGGACAGGAAGAGGAGGCTGG - Intronic
1060700572 9:125746861-125746883 AGCGGGCGGGCAGAGGCGGCGGG - Intergenic
1060721989 9:125985720-125985742 AGGGGCCAGGCAGAGGAGGGAGG - Intergenic
1061313169 9:129777226-129777248 TGAGCTCAGGCAGAGGCGCCTGG - Intergenic
1061450814 9:130666127-130666149 TGGGCACTGGCAGAGGAGCCGGG - Intronic
1061534416 9:131238818-131238840 AGGCCACAGGCAGGGGTGGGGGG + Intergenic
1061720667 9:132549187-132549209 TGTGGAGAGGCAGAGGCGGCAGG - Intronic
1061726090 9:132582725-132582747 GGGGCAGGGGCAGCGGCGGCTGG + Exonic
1061798101 9:133100228-133100250 AGGGCGATGGCAGAGGGGGCAGG - Intronic
1061948395 9:133921543-133921565 GAGGCACAGGGAGAGGCTGCAGG - Intronic
1062019885 9:134314244-134314266 AAGGCACAGGCCGGGGAGGCCGG + Intergenic
1062105331 9:134752088-134752110 GGGCCACATGCAGAGGGGGCAGG + Intronic
1062519963 9:136953670-136953692 AGGGGACAGGTGGAGGCGGAAGG - Intronic
1062532170 9:137006803-137006825 AGGGCACAGGCCAAGGCCCCAGG - Intergenic
1062629474 9:137457458-137457480 AGGTCTCAGGCAGAGGTGGCTGG + Exonic
1062678886 9:137765674-137765696 CGGGGACAGGCTGGGGCGGCGGG - Intronic
1203487637 Un_GL000224v1:72160-72182 AGGGCACACACTGAGGCGGATGG + Intergenic
1203500258 Un_KI270741v1:14055-14077 AGGGCACACACTGAGGCGGATGG + Intergenic
1185458135 X:320443-320465 AGGGGACAGTAAGAGGCAGCCGG + Intergenic
1185464450 X:346377-346399 AGGGCACAGGCGGGGGCAGAGGG + Intronic
1189146462 X:38660068-38660090 AAGGCAGAGGCAGAGGTGGGCGG - Intronic
1189203104 X:39214740-39214762 AGGGAACAAGCAGAGGAGGATGG - Intergenic
1190797799 X:53760466-53760488 AGAGCAGAGTCAGAGGCCGCAGG + Intergenic
1190917362 X:54820744-54820766 AGAGCAGAGTCAGAGGCCGCAGG - Intergenic
1192239567 X:69318775-69318797 AGCGAAAAGGCAGAGGCTGCTGG + Intergenic
1195671933 X:107477253-107477275 AGGACACAGGAAGAGCCAGCTGG + Intergenic
1196951022 X:120875585-120875607 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196951853 X:120931957-120931979 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196952537 X:120936818-120936840 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196953222 X:120941679-120941701 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196953907 X:120946539-120946561 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196954592 X:120951400-120951422 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196955275 X:120956260-120956282 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196955962 X:120961143-120961165 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196956644 X:120966004-120966026 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196957326 X:120970864-120970886 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196958008 X:120975724-120975746 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196958690 X:120980584-120980606 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1196959371 X:120985444-120985466 GGAGCACAGGCCGAGGCGGCCGG - Exonic
1197776063 X:130119474-130119496 AGGGCAGAGGCTGAGACTGCAGG + Intergenic
1200213703 X:154358168-154358190 CGGGCACAGGCAGGGGAGGCAGG - Intronic
1200284090 X:154804486-154804508 AAGCCACAGGGAGAGGCTGCTGG + Intronic
1201291042 Y:12421087-12421109 AGGCCCAAGGCAGAGGCTGCGGG - Intergenic
1202117456 Y:21483527-21483549 AGGACACAGGCAGTTGCTGCCGG - Intergenic
1202233304 Y:22678655-22678677 AGCGCAAGGACAGAGGCGGCAGG + Intergenic
1202309852 Y:23517503-23517525 AGCGCAAGGACAGAGGCGGCAGG - Intergenic
1202560949 Y:26153090-26153112 AGCGCAAGGACAGAGGCGGCAGG + Intergenic