ID: 1049004829

View in Genome Browser
Species Human (GRCh38)
Location 8:139847931-139847953
Sequence ACACAGGGCACAGGCAGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 615}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049004829_1049004843 14 Left 1049004829 8:139847931-139847953 CCGCCTCTGCCTGTGCCCTGTGT 0: 1
1: 0
2: 4
3: 52
4: 615
Right 1049004843 8:139847968-139847990 GGGCACGTGGGGCCTGGACTTGG No data
1049004829_1049004833 -8 Left 1049004829 8:139847931-139847953 CCGCCTCTGCCTGTGCCCTGTGT 0: 1
1: 0
2: 4
3: 52
4: 615
Right 1049004833 8:139847946-139847968 CCCTGTGTCAGCAGCAGCCCTGG No data
1049004829_1049004844 22 Left 1049004829 8:139847931-139847953 CCGCCTCTGCCTGTGCCCTGTGT 0: 1
1: 0
2: 4
3: 52
4: 615
Right 1049004844 8:139847976-139847998 GGGGCCTGGACTTGGTCTGCCGG No data
1049004829_1049004837 1 Left 1049004829 8:139847931-139847953 CCGCCTCTGCCTGTGCCCTGTGT 0: 1
1: 0
2: 4
3: 52
4: 615
Right 1049004837 8:139847955-139847977 AGCAGCAGCCCTGGGGCACGTGG No data
1049004829_1049004846 28 Left 1049004829 8:139847931-139847953 CCGCCTCTGCCTGTGCCCTGTGT 0: 1
1: 0
2: 4
3: 52
4: 615
Right 1049004846 8:139847982-139848004 TGGACTTGGTCTGCCGGAACTGG No data
1049004829_1049004835 -7 Left 1049004829 8:139847931-139847953 CCGCCTCTGCCTGTGCCCTGTGT 0: 1
1: 0
2: 4
3: 52
4: 615
Right 1049004835 8:139847947-139847969 CCTGTGTCAGCAGCAGCCCTGGG No data
1049004829_1049004838 2 Left 1049004829 8:139847931-139847953 CCGCCTCTGCCTGTGCCCTGTGT 0: 1
1: 0
2: 4
3: 52
4: 615
Right 1049004838 8:139847956-139847978 GCAGCAGCCCTGGGGCACGTGGG No data
1049004829_1049004840 8 Left 1049004829 8:139847931-139847953 CCGCCTCTGCCTGTGCCCTGTGT 0: 1
1: 0
2: 4
3: 52
4: 615
Right 1049004840 8:139847962-139847984 GCCCTGGGGCACGTGGGGCCTGG No data
1049004829_1049004836 -6 Left 1049004829 8:139847931-139847953 CCGCCTCTGCCTGTGCCCTGTGT 0: 1
1: 0
2: 4
3: 52
4: 615
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004829_1049004839 3 Left 1049004829 8:139847931-139847953 CCGCCTCTGCCTGTGCCCTGTGT 0: 1
1: 0
2: 4
3: 52
4: 615
Right 1049004839 8:139847957-139847979 CAGCAGCCCTGGGGCACGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049004829 Original CRISPR ACACAGGGCACAGGCAGAGG CGG (reversed) Intronic
900130965 1:1087095-1087117 CCCCAGGACACCGGCAGAGGTGG + Intronic
900407187 1:2497922-2497944 ACAGAGGGGCCAGGCACAGGGGG - Intronic
900459012 1:2791236-2791258 GCACAGGCCACTGGGAGAGGCGG + Intronic
900550491 1:3252156-3252178 AGATAGGGCTCAGGAAGAGGGGG - Intronic
901169527 1:7246564-7246586 CCACAGGGCCCAGTCAGGGGAGG - Intronic
901322057 1:8345955-8345977 ACACAGGGCCCATGCAGTGAGGG - Intergenic
901660513 1:10795660-10795682 ACACAGGGCACGGGGAGCCGGGG - Intronic
901800934 1:11707672-11707694 AAACAGGGCAGAGGCAGGAGCGG - Intronic
901872284 1:12145127-12145149 GCACAGGAGACAGTCAGAGGAGG - Intergenic
903101432 1:21034657-21034679 TGACATGGCACTGGCAGAGGTGG + Intronic
903259869 1:22125706-22125728 AGACACGGTAGAGGCAGAGGAGG + Intronic
903274002 1:22209261-22209283 ACACAGTGCCCGGCCAGAGGCGG - Intergenic
903361382 1:22779388-22779410 ACACAAGCCACAGGCAGTTGTGG + Intronic
903884033 1:26530804-26530826 TCAAAAGGCACAGGAAGAGGTGG - Intronic
904338261 1:29811895-29811917 ACTCGGGGCACAGGCAGACCTGG + Intergenic
904376525 1:30085584-30085606 AGGCAGGGCACTGGCAGAGAGGG + Intergenic
904705460 1:32386941-32386963 ACACAGGGAACAGGAACAAGGGG - Intronic
904917777 1:33982788-33982810 GCACAGGGCACAGGGAGGGCTGG + Intronic
905206022 1:36343282-36343304 AGGCAGGGCAAGGGCAGAGGTGG - Intronic
905296438 1:36957355-36957377 TCACAGGGCACAGACTCAGGGGG - Intronic
906109390 1:43312886-43312908 ACACAGGGCATGGGCGGATGTGG + Intronic
906193432 1:43913873-43913895 ACGAAGGGCAGAGGCAGAGGTGG + Intronic
906725583 1:48041858-48041880 AGACAGAGCAGAGGCAGATGAGG - Intergenic
907157053 1:52344179-52344201 GCACTGTGCACAGGCAGAAGTGG - Intronic
907571115 1:55484989-55485011 ACACAGAGCACAGCCAAAAGGGG - Intergenic
908527408 1:65001381-65001403 AGCCAGCGCACAGGGAGAGGGGG - Intergenic
909728631 1:78867203-78867225 GCACAGGGCAGAGCCAGAAGGGG + Intergenic
910054799 1:83020609-83020631 TTATAGGGCACAGGCAGAGTAGG + Intergenic
910880262 1:91916852-91916874 ACACAGGACACAGCCGCAGGAGG + Intergenic
911200011 1:95034900-95034922 ACAGAGGGCAAAGAGAGAGGAGG - Intronic
911739127 1:101368309-101368331 AGACAGGCCACATGCATAGGAGG - Intergenic
912307899 1:108589622-108589644 AGAAGGGGCACAGGCAAAGGAGG - Intronic
912312489 1:108637803-108637825 GCTCAGGGCACAGGAGGAGGTGG - Exonic
912941889 1:114052526-114052548 TCACAGTGCACAGGCACACGGGG - Intergenic
912944893 1:114076609-114076631 TCAGTGGGCACAGGCTGAGGTGG + Intergenic
912954382 1:114144232-114144254 AGACAGGGAACAGGAAGTGGAGG - Intronic
913957894 1:143320606-143320628 GAACAGGGCACAGGCAGGGCAGG + Intergenic
914052203 1:144145964-144145986 GAACAGGGCACAGGCAGGGCAGG + Intergenic
914126994 1:144820577-144820599 GAACAGGGCACAGGCAGGGCAGG - Intergenic
914415264 1:147474561-147474583 TTACAGGGCACAGGCAGGGCAGG - Intergenic
915037541 1:152941480-152941502 AGACTGGGCAAAGGCAGAGGAGG + Intergenic
915562789 1:156697182-156697204 AGACCGGGCATGGGCAGAGGAGG - Intergenic
916886449 1:169073127-169073149 AGGCAGGGCCCAGGCAGAGAAGG - Intergenic
917258387 1:173140909-173140931 ACACAGGGCAGAGGCATTCGTGG - Intergenic
918600760 1:186357155-186357177 ACTCAGGAGACAGGCTGAGGTGG - Intronic
920006194 1:202835527-202835549 ACCCAGGGAAAAGGCTGAGGGGG + Intergenic
920093351 1:203470074-203470096 GGACAGGGCAAAGGCAGCGGAGG - Intergenic
920190537 1:204190803-204190825 ACAGAGGGCACAGAAAGATGAGG + Intronic
920386262 1:205572003-205572025 ACTGAGGGCACAGGCAGAATGGG + Intronic
920547787 1:206832931-206832953 CCACAGGGCACCGGCAGAGAAGG - Intronic
922054633 1:222029002-222029024 AGACAGGGCACAGGCTGGGCAGG + Intergenic
922696149 1:227731990-227732012 CCACAGGGCAGAGCCAGGGGTGG + Exonic
923082555 1:230672457-230672479 ACAAAGGGCACAGGAAGGGGAGG - Intronic
923304536 1:232675914-232675936 ACACAGGGGACAGGGTGAGGGGG + Intergenic
923473490 1:234312558-234312580 ACACAGTGGACAGGCAATGGTGG + Intronic
923836701 1:237618715-237618737 ACACTGGGCACAGGCTGAGTGGG + Intronic
923936089 1:238762189-238762211 TTACAGAGCACAGGCAGAGTGGG + Intergenic
924034860 1:239925264-239925286 ACACCGGGCAGAGGCCTAGGAGG + Intergenic
924465802 1:244298334-244298356 ACAAAGGACTCAGGCACAGGAGG - Intergenic
924514776 1:244756719-244756741 GCAAAGGGCAGAGGCAGTGGAGG - Intergenic
924524897 1:244837214-244837236 AAACCGAGCACAGTCAGAGGTGG + Intronic
1062802742 10:392192-392214 ACACAGGTGAGGGGCAGAGGTGG + Intronic
1063362692 10:5470530-5470552 ACCTTAGGCACAGGCAGAGGAGG - Intergenic
1063419148 10:5897381-5897403 ACACAGGGCTCCTGCGGAGGAGG + Intronic
1063796309 10:9517310-9517332 ACACAGAACACATGCACAGGAGG + Intergenic
1064016134 10:11773758-11773780 ATTCAGGGAACAGGCAGAGCAGG + Intergenic
1065132206 10:22633572-22633594 GCAAAGGGTACAGGCAGGGGAGG + Intronic
1065460067 10:25951457-25951479 AAAGAAGCCACAGGCAGAGGGGG + Intronic
1065963345 10:30752031-30752053 AGACAGGCCACCAGCAGAGGAGG + Intergenic
1066300568 10:34092026-34092048 ACAGAGGGCACCTGCAGTGGAGG + Intergenic
1066759785 10:38739994-38740016 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1067079431 10:43204887-43204909 CCACAGGGCAGAGCCAGGGGAGG - Intronic
1067092715 10:43277487-43277509 ACCCAGGGCAGAGGGAGAGAGGG - Intergenic
1067713792 10:48671634-48671656 GCACAGGGCACAGGCTCTGGCGG + Intergenic
1067728509 10:48791724-48791746 TCACAGGTCTCAGGCAGTGGAGG + Intronic
1068189312 10:53629655-53629677 ACAAAGGGCAGAGTCAGAGAAGG + Intergenic
1069812527 10:71173003-71173025 ACCCAGAGCACAGGAAGAGGTGG + Intergenic
1070779920 10:79131642-79131664 GCACAGGGGAGAAGCAGAGGGGG - Intronic
1071200314 10:83214577-83214599 ACAGAGGGCACAGGCCAGGGTGG + Intergenic
1071913447 10:90262825-90262847 ACACATTGCACAGGCAAATGGGG - Intergenic
1072048666 10:91682046-91682068 ACTCAGGGCACAGACAGGGAGGG - Intergenic
1072747246 10:97949392-97949414 CAAAAGGGCACAGGCAGAGGTGG + Intronic
1073304695 10:102493869-102493891 ACAGAAGCCCCAGGCAGAGGCGG + Intronic
1073326627 10:102647084-102647106 GTTCAGGGCACAGGCAGGGGTGG + Intronic
1073616195 10:104998700-104998722 CCAGAGGTCTCAGGCAGAGGAGG + Intronic
1074168848 10:110912532-110912554 ACACAGTGGACAGACAGAGAAGG + Intronic
1074758527 10:116646622-116646644 ACACTGGTCAGAGGCAGATGAGG + Intergenic
1074786694 10:116848453-116848475 ACTCGGGAAACAGGCAGAGGAGG + Intergenic
1075100409 10:119502583-119502605 ACCCAGGGCAGAGGAGGAGGGGG + Intronic
1075202301 10:120415044-120415066 AGACAGGGCCCAGGCAGTGGGGG - Intergenic
1075330098 10:121567652-121567674 ACACACAGCAGTGGCAGAGGAGG + Intronic
1075713488 10:124542996-124543018 TCACAGGGCACACGCAGTGCAGG - Intronic
1075782969 10:125028690-125028712 ACAGAGGTCACAGGAACAGGAGG + Intronic
1075817224 10:125273905-125273927 ACACTGGGCTTAGGCACAGGAGG + Intergenic
1075914853 10:126158277-126158299 GCACAGAGCACCGGGAGAGGAGG + Intronic
1076494080 10:130885452-130885474 ACTCAGGGAACAGGAAGAGAAGG + Intergenic
1076710774 10:132332516-132332538 ACACAGGGCCCAGGCAGCGCAGG - Intronic
1076804886 10:132850381-132850403 ACACGGGGCACTGGCACAGCTGG - Exonic
1076837171 10:133027025-133027047 ACATGGGGCACACGCAGACGAGG + Intergenic
1077186872 11:1239408-1239430 ACAGAGGGCAGAGGCTAAGGAGG - Intronic
1077217413 11:1400747-1400769 CCGCAGGGCCCAGGCAGAGCCGG - Intronic
1077800396 11:5530501-5530523 ATACAGGGCAGAGGCTGAGGTGG - Intronic
1078417843 11:11180414-11180436 AGACAGGACACAGGGAGAGTCGG - Intergenic
1078597306 11:12698435-12698457 ATTCAGAGCACAGGCAGAGCAGG + Intronic
1079315525 11:19404948-19404970 ACAGAGAGCACAGAGAGAGGAGG - Intronic
1079351149 11:19693149-19693171 ACCAAGGGCCCTGGCAGAGGTGG - Intronic
1080192406 11:29568009-29568031 TCACATTGAACAGGCAGAGGAGG + Intergenic
1080657105 11:34266772-34266794 ACAGAGGGCACAGGGGGTGGGGG - Intronic
1081306515 11:41518511-41518533 ACAAAGGGAAGAGCCAGAGGAGG + Intergenic
1083423955 11:62573474-62573496 ACACAGGGGACAGGTTGAAGAGG - Exonic
1083626700 11:64075519-64075541 ACCGAGGGAACAGGCAGAGGTGG + Intronic
1083882455 11:65555295-65555317 ACACAGGGAAGGAGCAGAGGGGG - Intronic
1083983122 11:66190896-66190918 ACCCAGGTCACAGGCTGAGGAGG + Intronic
1084045268 11:66564508-66564530 AGCCAGGCCACAGGCAGGGGTGG - Intronic
1084426485 11:69087007-69087029 CCACAGGGCACCCGCTGAGGGGG - Intronic
1084727131 11:70949265-70949287 CCACAGAACACAGGCAGCGGGGG + Intronic
1085054173 11:73394452-73394474 GCAGGGGGCACAGGCAGAAGTGG - Intronic
1085117824 11:73945798-73945820 TCAGAGGACACAGGCACAGGCGG + Intergenic
1085454268 11:76656849-76656871 GCACAGGGCCTAGGGAGAGGAGG + Intergenic
1086416810 11:86597042-86597064 ACAGATGGCACAGGCAGAGCAGG + Intronic
1086725400 11:90176492-90176514 ACTCAGGTGACAGGCAGAAGTGG - Intronic
1089117537 11:116108408-116108430 GCACAGGAGACAGGCAGGGGAGG - Intergenic
1089632245 11:119791175-119791197 ACACAAGGCCCAGGAAGAGGAGG - Intergenic
1089957003 11:122580717-122580739 TCCCAGGGCAGAGGCAGAGGCGG - Intergenic
1090933906 11:131324739-131324761 ACAAAGGGCACAGAGATAGGAGG + Intergenic
1091317669 11:134625903-134625925 ACACAGTGCACAGGTGAAGGTGG + Intergenic
1091338875 11:134795068-134795090 ACAGAGGGCACAGGTTGGGGTGG + Intergenic
1092123803 12:6062345-6062367 AACCAGGGCACAGGAAGTGGAGG - Intronic
1092123961 12:6063068-6063090 GGACAGGACTCAGGCAGAGGTGG + Intronic
1092287492 12:7137161-7137183 ACACTGGGCAGTGACAGAGGCGG - Intronic
1092879737 12:12878802-12878824 ACACAGGGCAGAGGAAGACAGGG - Intergenic
1094310935 12:29081887-29081909 ACACAGGGGACTGTCAGAGTTGG + Intergenic
1094464953 12:30743133-30743155 ATCCAGGGCACAGGTAGAAGCGG - Intronic
1094849403 12:34375668-34375690 ACACAGGGGCCAGCCAAAGGCGG - Intergenic
1096075718 12:48802764-48802786 ACAAAGAGCAGAGGCAGATGTGG - Intergenic
1096602168 12:52737071-52737093 GCCCAGGGCACAGCCAGAGCAGG - Intergenic
1096787745 12:54027329-54027351 ACTCAGGGCACCGCCAGTGGAGG - Intronic
1096790275 12:54040094-54040116 AAACAGGGCAAACGCAAAGGAGG + Intronic
1096865125 12:54558121-54558143 TCAGAAGGCACAGGCACAGGAGG + Intronic
1097191322 12:57220895-57220917 GCACAGGGGACAGGCAGGGATGG - Intronic
1097541263 12:60946487-60946509 ACACAGGGCAAGGTCTGAGGTGG - Intergenic
1097707794 12:62885586-62885608 ACACAGGGCACACACAGTAGAGG + Intronic
1098086188 12:66846817-66846839 CCACGGGGCAGAGGAAGAGGGGG + Intergenic
1098367893 12:69724458-69724480 ATACAGGAAACAGGCAAAGGAGG - Intergenic
1099654202 12:85468596-85468618 ACCCAGCCCACAGGCAGAGAAGG - Intergenic
1100950934 12:99848308-99848330 ACAGAGGGAACAGGAAGGGGAGG + Intronic
1101362697 12:104042854-104042876 CCACAGGCCACAGGCAGTGCTGG - Intronic
1101528915 12:105556828-105556850 ACACAGGGGCAAGGGAGAGGTGG - Intergenic
1102243350 12:111339362-111339384 ACAGGGGGCTGAGGCAGAGGAGG - Intronic
1102346578 12:112164573-112164595 TCCCAGCGCACGGGCAGAGGTGG - Intronic
1102953735 12:117046434-117046456 CCACAGGCCACAGGTAGAGCAGG + Intronic
1103761899 12:123256379-123256401 ACACAGGGCAGAGGCAGGAAAGG + Intronic
1103893687 12:124258884-124258906 ACACACGGAACAGGCAGCAGAGG + Intronic
1103904072 12:124318577-124318599 GCAAAGGACAAAGGCAGAGGTGG - Intergenic
1104359497 12:128118540-128118562 ACAGAGACCACAGGCAGATGCGG + Intergenic
1104782894 12:131433009-131433031 ACACAGGGCAGAGGATGCGGGGG - Intergenic
1104782904 12:131433040-131433062 ACACAGGGCAGAGGATGCGGGGG - Intergenic
1104782930 12:131433129-131433151 ACACAGGGCAGAGGATGCGGGGG - Intergenic
1104783351 12:131434326-131434348 ACACAGGGGACAGGATGCGGGGG - Intergenic
1105779137 13:23690997-23691019 ACACAGGGCTCAGTCAGTGCCGG - Intergenic
1106075822 13:26460028-26460050 ACAAAGAGGACAGACAGAGGAGG - Intergenic
1108247504 13:48532767-48532789 GCCCAGGCCGCAGGCAGAGGCGG - Intronic
1108436228 13:50404177-50404199 ACACTGGGGACAGGCATTGGTGG + Intronic
1109246267 13:59957443-59957465 AATCATGGCACAGGCAAAGGAGG - Intronic
1111068386 13:83128735-83128757 ATGCAGGGCTCAGACAGAGGGGG + Intergenic
1112161445 13:96872633-96872655 ACTAAGGCCACAGGCAGAGATGG - Intergenic
1112783419 13:102926457-102926479 AGACAGGGGACAGGCAGCAGGGG + Intergenic
1113339581 13:109409026-109409048 ACACAGGGTGAGGGCAGAGGTGG + Intergenic
1113785979 13:113002257-113002279 TCACAGGCCAAGGGCAGAGGCGG - Intronic
1114746375 14:25152514-25152536 ACACAGAGCAAAGGGAGTGGAGG - Intergenic
1115409881 14:33061994-33062016 GCAAAGGACACAGGCAGAAGTGG + Intronic
1116465773 14:45230906-45230928 TCACTGGGCCCAGGCAAAGGTGG + Intronic
1117652621 14:57922605-57922627 ACACAGAGCAGAGGAAGAGGAGG - Intronic
1118126328 14:62908745-62908767 ACAAAGGGCAAAGGCACATGGGG - Intronic
1118773879 14:68961542-68961564 ACACGGGGCACAGGGCGCGGGGG + Intronic
1118793497 14:69117658-69117680 TCAAAGGGCACATTCAGAGGAGG + Intronic
1119187155 14:72651099-72651121 GCTCAGGGTACAGGAAGAGGTGG + Intronic
1119264215 14:73254615-73254637 ACACAGGGCTCAGTCAGAGGTGG - Exonic
1119433833 14:74585307-74585329 ACAGGGACCACAGGCAGAGGAGG + Intronic
1119546867 14:75478269-75478291 TCACAGGGCTCAAGAAGAGGAGG + Intergenic
1119702586 14:76765434-76765456 ACTCAGAGCCCAGGTAGAGGAGG - Intronic
1120932169 14:89859766-89859788 ACAGAGGAAACAGGCAGAGGAGG + Intronic
1121072097 14:91033351-91033373 ACACCTGGCTCAGGCCGAGGTGG + Intronic
1122052457 14:99069338-99069360 ACACAGCACACAGTCAGTGGGGG - Intergenic
1122145756 14:99688019-99688041 ACAGAGGGCACAGAGAGGGGTGG - Intronic
1122353898 14:101112294-101112316 AGACAGGGCCGAGGAAGAGGGGG - Intergenic
1122763804 14:104050640-104050662 GCACAGGGCACAGGGGGAGCAGG - Intronic
1122848405 14:104513348-104513370 ACACACGGGACAGGCTGAGCAGG + Intronic
1122871136 14:104639604-104639626 GCACAGAGCACAGGAAGGGGAGG - Intergenic
1123117179 14:105900008-105900030 ACAGAGGCCACAGGCTGAGGTGG - Intergenic
1123121470 14:105918876-105918898 ACAGAGGCCCCAGGCTGAGGTGG - Intronic
1202930488 14_KI270725v1_random:29468-29490 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1123421861 15:20141942-20141964 GAACAGGGCACAGGCAGGGCAGG + Intergenic
1123443218 15:20304693-20304715 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1123531089 15:21148482-21148504 GAACAGGGCACAGGCAGGGCAGG + Intergenic
1124158858 15:27251730-27251752 ACACAGTGCACAAGTAGAGTTGG + Intronic
1125456738 15:39867780-39867802 ACACAAGGCTAAGGCAGAGTGGG + Intronic
1125954378 15:43779157-43779179 TAACAGGCCACAGGCAGAGAAGG + Intronic
1127863046 15:63010401-63010423 CAACAGGCCCCAGGCAGAGGAGG + Intergenic
1128494024 15:68180999-68181021 ACAGAGGCCACAGGAAGAAGTGG - Intronic
1128702345 15:69813616-69813638 AGACAGGGTACAGGCAGGGGTGG + Intergenic
1129004017 15:72357259-72357281 ACAGAAGGATCAGGCAGAGGAGG + Intronic
1129388582 15:75209103-75209125 GGAGAAGGCACAGGCAGAGGAGG - Intronic
1129708228 15:77806740-77806762 CCCCACAGCACAGGCAGAGGAGG + Intronic
1129719266 15:77869206-77869228 ACGAATGGCCCAGGCAGAGGTGG + Intergenic
1129789083 15:78328734-78328756 AAGCAGGGCACAGGCAAGGGTGG + Intergenic
1129804765 15:78446584-78446606 ACAAAGTGAGCAGGCAGAGGAGG - Intronic
1131066049 15:89435701-89435723 AGGCAGGCCACAGGCAGGGGTGG - Intergenic
1131084895 15:89567831-89567853 GATCAGGGCACTGGCAGAGGGGG - Intergenic
1131249345 15:90820338-90820360 AACCAGGGCACAGGCAGGGAGGG + Intergenic
1132048113 15:98582653-98582675 ACACTGGCCTCAGGCAGAGAGGG + Intergenic
1132149022 15:99446835-99446857 AGACAGGGCAAAGAGAGAGGAGG - Intergenic
1132495632 16:261969-261991 ACACAAGGCCCAGGAAGAGAGGG - Intronic
1132495643 16:262014-262036 ACACAAGGCCCAGGAAGAGAAGG - Intronic
1132618071 16:852085-852107 ACACAGAACACAGGCAGCCGGGG + Intergenic
1132642376 16:983700-983722 GCACAGGGCAGAGGCAGGGATGG - Intronic
1132650696 16:1020330-1020352 CTGCAGGGCACAGCCAGAGGGGG + Intergenic
1132773602 16:1579262-1579284 TCACACTGAACAGGCAGAGGAGG + Intronic
1132870737 16:2114713-2114735 CCGCAGGGCACAGGCAGGGCAGG + Exonic
1133613750 16:7456729-7456751 GCACAGAGCACAGCCATAGGTGG - Intronic
1134291241 16:12903783-12903805 ACACAGGCCCCCGGCAGAGGGGG - Intronic
1134404583 16:13945235-13945257 ACTAAGGGGAGAGGCAGAGGAGG - Intronic
1134521792 16:14922191-14922213 CCGCAGGGCACAGGCAGGGCAGG - Intronic
1134635898 16:15791561-15791583 ACCCAGGTAACTGGCAGAGGAGG - Intronic
1134672262 16:16064529-16064551 GCACAGGGCACACACAGAGAGGG - Intronic
1134709462 16:16320842-16320864 CCGCAGGGCACAGGCAGGGCAGG - Intergenic
1134716675 16:16360871-16360893 CCGCAGGGCACAGGCAGGGCAGG - Intergenic
1134950141 16:18347803-18347825 CCGCAGGGCACAGGCAGGGCAGG + Intergenic
1134958075 16:18391288-18391310 CCGCAGGGCACAGGCAGGGCAGG + Intergenic
1135572963 16:23563359-23563381 ACACCGTGCACAGGCGGGGGTGG - Intronic
1135925578 16:26690778-26690800 ACACCAGGCACAGGCAGTGTAGG + Intergenic
1136232406 16:28894420-28894442 AGAGAGGGCACAGGAAGAGCAGG - Intronic
1136558776 16:31025916-31025938 ACACAGCTCACAGGGAGAAGGGG + Intergenic
1136723023 16:32339266-32339288 GAACAGGGCACAGGCAGGGCGGG + Intergenic
1136773937 16:32861157-32861179 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1136841343 16:33545265-33545287 GAACAGGGCACAGGCAGGGCGGG + Intergenic
1136862980 16:33713741-33713763 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1136896672 16:34000362-34000384 GAACAGGGCACAGGCAGGGCAGG + Intergenic
1137061858 16:35798243-35798265 ACACAGGGCACCAGCTGCGGGGG - Intergenic
1138569154 16:57857141-57857163 ACACAGCACACAGGGAGAGTGGG - Intronic
1138768412 16:59632032-59632054 ACACAGAGCAGAGGGAGAAGTGG + Intergenic
1139213841 16:65108132-65108154 ATACAGGGCACAGGAGGAGTGGG + Intronic
1139468691 16:67167087-67167109 GATCAGGGCACAGGCAGGGGTGG - Intronic
1139782762 16:69365431-69365453 ACACAGAGCAGAGGCAGAGGTGG + Intronic
1140519157 16:75566765-75566787 ACGCAGGGCGCAGGAGGAGGAGG + Intronic
1140968384 16:79989359-79989381 GAACAGGGCACAGGCAAGGGTGG + Intergenic
1141102603 16:81209064-81209086 ACCCAGAGAACCGGCAGAGGAGG + Intergenic
1141958784 16:87391347-87391369 ACATTGGCCACAGGCTGAGGTGG + Intronic
1142016779 16:87753048-87753070 ACAAGGGGCACAGGCAGGGCAGG + Intronic
1142058433 16:88015022-88015044 CCAGAGGGCACAAGCTGAGGGGG - Intronic
1142233114 16:88909050-88909072 CCACAGGCCCCAGGCAGGGGAGG + Intronic
1203003408 16_KI270728v1_random:178498-178520 GAACAGGGCACAGGCAGGGCGGG - Intergenic
1203076357 16_KI270728v1_random:1123268-1123290 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1203124458 16_KI270728v1_random:1561889-1561911 GAACAGGGCACAGGCAGGGCGGG - Intergenic
1203135016 16_KI270728v1_random:1714905-1714927 GAACAGGGCACAGGCAGGGCGGG - Intergenic
1203151508 16_KI270728v1_random:1845562-1845584 GAACAGGGCACAGGCAGGGCGGG + Intergenic
1143378058 17:6478882-6478904 ACACAGAGCACAGGCAGTGTGGG + Intronic
1143586386 17:7852732-7852754 ACTCGGGGCACAGGCAGACAAGG - Intronic
1143693179 17:8588124-8588146 ACTCAAGGGTCAGGCAGAGGAGG - Intronic
1144203627 17:12963520-12963542 ACACACAGCATTGGCAGAGGTGG - Intronic
1144370937 17:14591018-14591040 ACACAGGTCATAGAGAGAGGAGG - Intergenic
1144769022 17:17748906-17748928 AAAAAGGGCACAGGCAGGGAGGG - Intronic
1144839502 17:18177092-18177114 ATACAGGCCAGAGGCAGAGAGGG - Intronic
1144945590 17:18968068-18968090 ACACAGGGCCCAGGCAGGATGGG - Intronic
1144948354 17:18981230-18981252 ACATAGGTCACAGGGGGAGGTGG + Intronic
1145903005 17:28500070-28500092 CCACAGGGCCCAGGGATAGGTGG + Intronic
1145991885 17:29084314-29084336 ACACAGGGGACAGACAGTTGTGG + Intronic
1145994844 17:29099398-29099420 AATCAGGGCCCAGGCAAAGGTGG - Intronic
1146147132 17:30429625-30429647 GCACAGGCAACAGGCAGTGGGGG + Intronic
1147043562 17:37736207-37736229 ACACAGGGCCCACGGGGAGGAGG - Intronic
1147455024 17:40531758-40531780 ACAGAGGGCACAGGCAGTGAAGG + Intergenic
1147978927 17:44262940-44262962 GCAGAGGGCACAGGCTGAGTGGG + Intronic
1148561243 17:48607856-48607878 AGACAGGGCTGAAGCAGAGGAGG - Exonic
1148752025 17:49950872-49950894 ACAGAGGGCCTAGGGAGAGGAGG - Intergenic
1148938191 17:51182102-51182124 GCACAGGGCCCAGGCAGGAGTGG - Intronic
1149291871 17:55225422-55225444 ACAGAGGGCACAGGAGGAGCAGG - Intergenic
1149501097 17:57153050-57153072 ACACATGAGCCAGGCAGAGGCGG + Intergenic
1149626418 17:58083612-58083634 AGGCAGAGCACAGGCAGGGGCGG - Exonic
1149661020 17:58333876-58333898 ACCCAGGTCAGAGGCAGCGGTGG - Intergenic
1149905773 17:60525613-60525635 AGACAGGGCATAGGGAGATGGGG + Intronic
1149992204 17:61389560-61389582 AGCCAGGGCAGAGGCAGAGGAGG + Intronic
1150292754 17:63990933-63990955 CCACAGGCCACAGACAGAGGAGG - Intergenic
1152069340 17:78127300-78127322 TCACAGGGCAGACGCAGAGAAGG - Intronic
1152202737 17:78956535-78956557 CCCCAGGGCAGAGTCAGAGGTGG - Intergenic
1152231787 17:79117547-79117569 ACACAGGAGCCCGGCAGAGGGGG - Intronic
1152257617 17:79249317-79249339 ACACAGGGAACAGAGGGAGGTGG - Intronic
1152333406 17:79686313-79686335 AAACTGGGCAGAGACAGAGGGGG + Intergenic
1152350845 17:79783367-79783389 ACCCTGGGAACAGGCAGTGGAGG + Intronic
1152518095 17:80837838-80837860 TCACAGGGCACAGGAGGAGCCGG - Intronic
1152600201 17:81258490-81258512 GCACCGGCCGCAGGCAGAGGCGG + Intronic
1152672123 17:81614892-81614914 ACACAGGGGACAGTCTGAGAGGG + Intronic
1152762769 17:82117934-82117956 ACGCAGGGCACACGCACAGGAGG + Intronic
1153515818 18:5900114-5900136 ACACAGGGCACATTCAGCTGTGG - Intergenic
1154171296 18:12053545-12053567 AGCCATGGCACAGGCAAAGGTGG + Intergenic
1154172626 18:12062196-12062218 ACACCTGGCTCATGCAGAGGAGG - Intergenic
1154293531 18:13130913-13130935 ACACGTCGCACAGACAGAGGTGG - Intergenic
1154306144 18:13232331-13232353 GCACAGGCCACAGACAGAGGCGG - Intronic
1154415016 18:14171809-14171831 GAACAGGGCACAGGCAGGGCAGG + Intergenic
1155481741 18:26296401-26296423 AGACAGGGCAGAGCCAGTGGTGG - Intronic
1155555295 18:27011936-27011958 GCAAAGGGCAAAGGCAAAGGTGG - Intronic
1156183142 18:34629683-34629705 CCACAGGTAACAGGCATAGGTGG - Intronic
1156204673 18:34872769-34872791 ACACAGGGCACAGACCCAGTAGG - Intronic
1156381342 18:36564179-36564201 AAACAGGTCACAGCCACAGGTGG - Intronic
1156446267 18:37239367-37239389 ACAAAGGGCAGAAGCAGAGATGG + Intergenic
1157280677 18:46344682-46344704 CCAAACGTCACAGGCAGAGGGGG - Intronic
1157581924 18:48778656-48778678 AAGCAGGTAACAGGCAGAGGTGG + Intronic
1158131839 18:54160837-54160859 ACAGAAGGCAATGGCAGAGGAGG + Intronic
1158854563 18:61530068-61530090 AGACACGGCTCAGGCACAGGGGG + Intronic
1160044706 18:75375907-75375929 ACACCTGGCACAGGCAGGTGTGG + Intergenic
1160097896 18:75891889-75891911 ACAAAGGGCACCAGGAGAGGGGG - Intergenic
1160099522 18:75906980-75907002 GCAAAGGGCACAGGCTGAGCTGG + Intergenic
1160120064 18:76122161-76122183 CCGCAGGGCACAGGAAGAGAGGG + Intergenic
1160397687 18:78584125-78584147 CCACAGTGCAGAGGCAGAGGGGG - Intergenic
1160809490 19:1007297-1007319 CCCCAGGGGAGAGGCAGAGGAGG + Intronic
1160855100 19:1213695-1213717 CCACAATTCACAGGCAGAGGCGG - Intronic
1161053146 19:2176016-2176038 GCCCAGGGGACAGGCAGAGCCGG - Intronic
1162634060 19:11952761-11952783 AGACAGGGCAGTGGCAGAGATGG + Intronic
1162637429 19:11980974-11980996 AGACAGGGCAGTGACAGAGGTGG + Intergenic
1163468576 19:17483916-17483938 ACCAAGGGCAGAGGCAGGGGAGG - Intronic
1164052560 19:21595651-21595673 ATGCAGGGCCCAGGCAGAAGAGG - Intergenic
1164083215 19:21878556-21878578 GTACAGGGCACAGGCAGAAAAGG - Intergenic
1164145417 19:22509838-22509860 ACACACAGCACGGGAAGAGGGGG + Intronic
1164205679 19:23056690-23056712 ATACAGGGCCCAGGCAGCAGAGG + Intergenic
1164431558 19:28193538-28193560 ACACAGGGCACATTCAGGGATGG + Intergenic
1164779479 19:30880861-30880883 GCAGGGGGCACAGGGAGAGGTGG + Intergenic
1165006555 19:32812207-32812229 GCTGAGGGCACAGGCACAGGGGG + Intronic
1165406288 19:35633151-35633173 CCAGGGGGCCCAGGCAGAGGGGG - Exonic
1165755248 19:38289077-38289099 ACACAGGACACAGGCCTAGCTGG - Intronic
1165767493 19:38360412-38360434 ACACTGGGCAGAGGGTGAGGTGG + Intronic
1165993998 19:39832053-39832075 AGACAGGGCACAGAGAGAAGAGG + Intronic
1166136653 19:40781369-40781391 ACAGAGGTCAGAGGCAGAGAGGG + Intronic
1166423966 19:42659565-42659587 ATACTGGGACCAGGCAGAGGTGG + Intronic
1167035951 19:46995052-46995074 ACACAGGGCACAGACACTGCTGG + Intronic
1167577762 19:50325907-50325929 TCCCAGGGCACAGGGAAAGGTGG + Intronic
1168105316 19:54162556-54162578 GCAAAGGGAGCAGGCAGAGGCGG + Intronic
1168180418 19:54658887-54658909 AGGCATGGCACAGTCAGAGGAGG + Intronic
1168479817 19:56710263-56710285 ACACAGGACTCAGGAAGGGGAGG - Intergenic
1168699980 19:58432085-58432107 AGAGTGGGCACAGGCAGATGGGG - Intergenic
1202691602 1_KI270712v1_random:98388-98410 GAACAGGGCACAGGCAGGGCAGG + Intergenic
925551779 2:5084241-5084263 GCACAGGTCACAGTCAGAGGGGG + Intergenic
926203044 2:10814884-10814906 ACAAAGGGCACTGGCAGTGTGGG - Intronic
926218663 2:10920975-10920997 GCTCAGAGCACAGGCAGAGATGG + Intergenic
926646977 2:15300775-15300797 ACACAAGGAACAGACAGAGATGG + Intronic
926921417 2:17944224-17944246 AGTCAGGGCAGAGGCAGAAGAGG - Intronic
928099777 2:28430023-28430045 GCACAGGGGATAGGCAGAGATGG - Intergenic
928261391 2:29770136-29770158 ACACCAGGCACAGTTAGAGGAGG + Intronic
928956487 2:36874390-36874412 ACAGAGGTCACAGGAAGAAGAGG + Intronic
929472813 2:42212901-42212923 ACACAGGGCACAGCCAGGACTGG - Intronic
929584711 2:43106406-43106428 TCACAGGGCACTGGCAGGGTTGG - Intergenic
929780281 2:44952780-44952802 ACACAGGGGAAAGGCAGCGGTGG - Intergenic
930034911 2:47079334-47079356 ACAAAAGGCAAAGGGAGAGGAGG - Intronic
931111644 2:59117652-59117674 CCACAGGGCACAGTCTGAGAGGG - Intergenic
931217996 2:60264079-60264101 AGAAAGGGCACAAGCAGAGGCGG - Intergenic
931557315 2:63519304-63519326 ACCCAGGGCACTGGCAGGTGTGG - Intronic
931751608 2:65335265-65335287 ATACAGGAGATAGGCAGAGGAGG - Intronic
931869320 2:66441904-66441926 ACACAGGGGAGAGGCAGAAGGGG + Intronic
932793157 2:74673382-74673404 ACAGAGGTCACAGGCAGAGTAGG - Intronic
932865093 2:75333441-75333463 TTACAGAGCACAGGCAGAGTGGG + Intergenic
933039296 2:77442012-77442034 AAACAGAGCAGAGGCAGAAGTGG + Intronic
933954788 2:87355562-87355584 GAACAGGGCACAGGCAGGGCAGG - Intergenic
934238983 2:90251788-90251810 GAACAGGGCACAGGCAGGGCAGG - Intergenic
934274209 2:91564922-91564944 GAACAGGGCACAGGCAGGGCAGG + Intergenic
934461418 2:94215130-94215152 GAACAGGGCACAGGCAGGGCAGG - Intergenic
934883997 2:98008522-98008544 TCACAGGGCACAGGCCTGGGGGG - Intergenic
935406826 2:102718503-102718525 ACACAGCGCCCAGGCTGGGGGGG + Exonic
935595517 2:104874289-104874311 ACACAGGACAAAGGCACCGGAGG + Intergenic
937118967 2:119429019-119429041 AAACATGGCAGGGGCAGAGGTGG - Intergenic
937474703 2:122204752-122204774 AAACAGGGCACAGGTAGACCTGG + Intergenic
937887916 2:126912697-126912719 TCAGAGGCCACAGGCAGATGGGG + Intergenic
937957258 2:127428327-127428349 GCAGAGGGCACAGTCAGAGTGGG - Intronic
938211140 2:129466556-129466578 CCACATGGCGCCGGCAGAGGAGG + Intergenic
938250675 2:129813263-129813285 AGACAGGGCCCAGGCATGGGAGG - Intergenic
938258245 2:129877444-129877466 CCCCAGGGAGCAGGCAGAGGTGG - Intergenic
938772239 2:134510607-134510629 TGACTGGACACAGGCAGAGGAGG + Intronic
939188401 2:138887087-138887109 ACACAGGGAAAAGTCAGAGCAGG - Intergenic
939959388 2:148552877-148552899 AGACAGGGAAGGGGCAGAGGAGG + Intergenic
941225367 2:162840272-162840294 ACTCAAGGCACAGGCATAGCAGG - Intergenic
941907838 2:170734279-170734301 ACAAAGGGCACAGTGAGAGTGGG + Intergenic
942452708 2:176118149-176118171 AAAGAGGGCAAAGGCGGAGGGGG + Intronic
942591473 2:177551908-177551930 ACCCAGGGCAGAGGAAGAGTTGG - Exonic
942598597 2:177617846-177617868 ACCCAGGGCAGAGGAAGAGTTGG - Exonic
943849240 2:192695424-192695446 AAACAGGGCACAGGGAGGGGAGG - Intergenic
944284710 2:197935899-197935921 ACACTGGGAACTGGCATAGGTGG - Intronic
944406146 2:199385844-199385866 TCACAGGTGACAAGCAGAGGAGG - Intronic
944633846 2:201655412-201655434 ACACAGGGCACATGCTTAGAAGG + Intronic
945080527 2:206083928-206083950 ACACTGGGGACTGGCAGTGGGGG + Intronic
945955797 2:216084726-216084748 AAAACGGGCACAGGAAGAGGCGG + Intronic
946007815 2:216540624-216540646 ACACAGGGACAAGGCAGAAGAGG - Intronic
946025902 2:216671492-216671514 TCACTGGGCACAGACAGCGGTGG + Intergenic
946354426 2:219176335-219176357 AAACAGGGCAGGGGCAGCGGAGG + Intronic
948058618 2:235027670-235027692 ACACAGGGAATTGGCAGGGGAGG + Intronic
948367908 2:237470403-237470425 CCACAAGTCACAGGCACAGGTGG + Intergenic
948691958 2:239711743-239711765 ACATGGGGAACATGCAGAGGAGG - Intergenic
948730706 2:239961962-239961984 TCACAGGGCACAGGGAGATCTGG + Intronic
1168811841 20:709843-709865 TCACAGGGCACACGGAGTGGAGG - Intergenic
1169195317 20:3679581-3679603 AGACAGAGCACAGGGTGAGGGGG + Intronic
1169644089 20:7789971-7789993 ACACTTGGGAGAGGCAGAGGTGG - Intergenic
1169798930 20:9495611-9495633 GCACAGGGCACAGGAGGAAGAGG - Intergenic
1170404791 20:16024756-16024778 CCACAGGGCAAAGGGGGAGGGGG + Intronic
1170701214 20:18705393-18705415 AGAAAGGGTACAGGCAGGGGCGG - Intronic
1170852513 20:20017609-20017631 CCACAGGGTCCAGGGAGAGGTGG + Intronic
1171143219 20:22760659-22760681 ACACAGGCCACAGTCAGCAGTGG + Intergenic
1171243400 20:23589142-23589164 AGACAGAGCAAAGGCAGATGAGG + Intergenic
1172758459 20:37304994-37305016 ATAGAGGGCACAGGCAGGGGAGG + Intronic
1172906286 20:38372261-38372283 AGGCAGGGCACAGGTGGAGGTGG - Intronic
1173019849 20:39258013-39258035 CTGCAGAGCACAGGCAGAGGTGG - Intergenic
1173189577 20:40865677-40865699 ACAAAGAGCACTGGCAAAGGTGG - Intergenic
1173257385 20:41404628-41404650 ACATGGGGCACAGGCTGGGGAGG - Exonic
1173262780 20:41451477-41451499 AGAAAAGGCACAGACAGAGGTGG + Intronic
1173407242 20:42777278-42777300 ATACAGGGCACAGGAGAAGGTGG - Intronic
1174675562 20:52350771-52350793 AAACAGGGCCCAGTGAGAGGTGG - Intergenic
1175062623 20:56257567-56257589 ACACAGAGCAAAGTCACAGGTGG + Intergenic
1175307990 20:57991198-57991220 AACCAGTCCACAGGCAGAGGCGG + Intergenic
1175483437 20:59327533-59327555 ACGGAGGCCCCAGGCAGAGGAGG + Intergenic
1175809610 20:61850884-61850906 ACACAGGCCACGGGCAGAGGCGG + Intronic
1175980897 20:62738075-62738097 GCACCTGGCATAGGCAGAGGAGG - Intronic
1176255948 20:64153068-64153090 ACCAAGGGCACAGGGGGAGGGGG - Intronic
1176386796 21:6142029-6142051 ATGCAGGCCACAGGCAGTGGAGG - Intergenic
1176592500 21:8658064-8658086 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1176866146 21:14056207-14056229 GAACAGGGCACAGGCAGGGCAGG + Intergenic
1178303830 21:31474009-31474031 ACTCATGGCAGAGGCAAAGGGGG + Intronic
1178414497 21:32393000-32393022 CCACATGGCGCAGGAAGAGGCGG + Exonic
1178423649 21:32461627-32461649 CCACAGAACACAGGCAGAGCTGG - Intronic
1178590327 21:33904277-33904299 ACACAGAGCAGAGGCAGGGAGGG - Intronic
1178745778 21:35248868-35248890 ACACAGCTCACAGGCAGAGTGGG + Intronic
1178863154 21:36306112-36306134 ACACAGGCCTCAGGCTCAGGAGG + Intergenic
1179294417 21:40048212-40048234 GCACATGGCACAGGCACAGCTGG + Intronic
1179510703 21:41871365-41871387 ACCCCAGGCAGAGGCAGAGGTGG - Intronic
1179736677 21:43396223-43396245 ATGCAGGCCACAGGCAGTGGAGG + Intergenic
1180078952 21:45477712-45477734 ACACAGGGCTCGGGCTGGGGTGG - Intronic
1180275357 22:10635211-10635233 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1180549851 22:16530216-16530238 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1180718674 22:17890373-17890395 CCAAAGGGAACAGGCAGAAGTGG - Intronic
1180722602 22:17920528-17920550 AGACAGAGCACAGCCAGGGGAGG - Intronic
1180972254 22:19821783-19821805 CCAGAGGGCACAGCCAGTGGTGG - Intronic
1181124619 22:20694884-20694906 ACCCACGGCCCATGCAGAGGTGG + Intergenic
1181167106 22:20989698-20989720 AGCCAGGGCGCAGGTAGAGGAGG + Intronic
1181359787 22:22325474-22325496 ACACAGTGCATGGACAGAGGGGG - Intergenic
1181552663 22:23649589-23649611 AAACAGGGTGCAGGCAGTGGAGG - Intergenic
1181609957 22:24005624-24005646 CCACGGGGCACAGGCACACGTGG - Intergenic
1181650567 22:24256846-24256868 ACCCACGGCCCATGCAGAGGTGG + Intergenic
1183058339 22:35320392-35320414 ACAGAGGGGACAGGGAGAGCAGG + Intronic
1183074295 22:35417007-35417029 ACTCACGGCAGAGGCAGAGCAGG - Intronic
1183174460 22:36212643-36212665 GTAGGGGGCACAGGCAGAGGGGG - Intergenic
1183400719 22:37602428-37602450 AGGCTGGGCACAGGCACAGGGGG - Intergenic
1183490598 22:38113572-38113594 ACACAGGTCACAGGCACTTGTGG + Exonic
1183689639 22:39381583-39381605 TCACAGGACACAGGCAGGAGAGG - Intronic
1183987476 22:41577445-41577467 ACACAGAGGATGGGCAGAGGAGG + Intronic
1184198035 22:42945322-42945344 AGCCAGGAAACAGGCAGAGGAGG - Intronic
1184474013 22:44711041-44711063 ACAGAGGGAGCAGGCAGGGGTGG + Intronic
1184497288 22:44849247-44849269 ACACTGTCCAAAGGCAGAGGAGG + Intronic
1184551135 22:45204707-45204729 ACACAGGGCACTGGGAGGGCGGG - Intronic
1185006257 22:48278623-48278645 ACACAGGGCCCAGCCTTAGGAGG + Intergenic
1185116915 22:48943062-48943084 ACACATGGCATAGGCAGGGCTGG - Intergenic
1185158316 22:49207483-49207505 TCACAAGCCACAGTCAGAGGAGG + Intergenic
1185252805 22:49814256-49814278 AAACAGTGCACAGGCAGGGCAGG + Intronic
950539075 3:13599314-13599336 GCAGATGGCACAGGGAGAGGTGG + Intronic
951517520 3:23577899-23577921 TCAGAGAGCACAGGCAGAGTAGG - Intronic
952342922 3:32460196-32460218 GCACAGGGCAGTGGCACAGGGGG - Intronic
952747163 3:36792345-36792367 ATCCAGGGCATAGCCAGAGGAGG + Intergenic
953910438 3:46890037-46890059 AGTCAGGGCAGAGGCAGAGGAGG + Intronic
954303480 3:49713601-49713623 ACAGAGGGTACAGGGGGAGGGGG + Intronic
954860059 3:53680479-53680501 ACCCAGAGCACAGGTGGAGGGGG - Intronic
959189769 3:103096889-103096911 ACCCAGGGCAGTGCCAGAGGAGG - Intergenic
959466811 3:106698393-106698415 TCACACGGCACATGCAGAAGTGG + Intergenic
959527161 3:107390082-107390104 GACCAGGGCCCAGGCAGAGGAGG - Intergenic
960994171 3:123330208-123330230 ACAGAGGGCAAGGTCAGAGGCGG - Intronic
961197302 3:125013537-125013559 ACAGAGGGCAGAGGCAAAGGAGG + Exonic
961401068 3:126643252-126643274 CAGCAGGGCAGAGGCAGAGGGGG + Intronic
961575771 3:127834988-127835010 AGGCAGGTCACAGGCAGAGTGGG - Intergenic
961707780 3:128802403-128802425 ACACAGAGCACAGGAACAGAGGG + Intronic
961722111 3:128903674-128903696 ACAGAGGCCCCAGACAGAGGTGG - Intronic
964503716 3:157376038-157376060 ACACAGGCCTGGGGCAGAGGAGG - Intronic
965991327 3:174822166-174822188 ACACAGGGCGGAGGGAGAGGGGG + Intronic
967419740 3:189259899-189259921 GCACATGACAAAGGCAGAGGAGG - Intronic
967826674 3:193882721-193882743 ACACAGGGCACACTGAGGGGAGG - Intergenic
967935923 3:194727479-194727501 ACACAAGTCAGAGGCAGAGCTGG + Intergenic
967985675 3:195094039-195094061 ACACAGGGAGGAGGAAGAGGAGG - Intronic
968506925 4:974961-974983 TCCCAGGGCCCAGGCACAGGGGG - Intronic
968574658 4:1360019-1360041 CCACCAGGCACAGGCAGGGGAGG + Intronic
968961304 4:3745138-3745160 ACACAGGGCCGTGGGAGAGGAGG + Intergenic
968974205 4:3812569-3812591 AGACTGCACACAGGCAGAGGTGG - Intergenic
969135663 4:5026733-5026755 ACACAGGGAGCAGGCAGGAGAGG - Intergenic
969418253 4:7074923-7074945 ACCCAAGGCTCAGGCAGGGGTGG + Intergenic
969468407 4:7371262-7371284 ACACAGGGCGCAGGCAGCTGCGG - Intronic
969588689 4:8109109-8109131 ACTCAGGGGACAGGCGGTGGGGG - Intronic
969609740 4:8220328-8220350 ACACGGGGTTCAGGGAGAGGGGG - Intronic
969638546 4:8383213-8383235 AGGCAGGGCACAGGCAGGGTTGG + Intronic
970760957 4:19485829-19485851 ACAAAGAGCACACACAGAGGAGG - Intergenic
972022980 4:34338200-34338222 ATACAGCACACAGGCAGAGTAGG - Intergenic
972404017 4:38729940-38729962 AATCAAGGCACAGGCAGAGCTGG + Intergenic
973662420 4:53121703-53121725 AGGCAAGGCACAGGCAGAAGTGG + Intronic
976661201 4:87542519-87542541 ACACAGGACAGAGCCAGAGATGG - Intergenic
977221856 4:94346989-94347011 GGACAGGGCACAGGCAAAGGTGG - Intergenic
980773011 4:137403067-137403089 AAACAGGGCAAAAGCAGATGTGG + Intergenic
981108323 4:140906256-140906278 ACCCAAGGCTCAGGCAGATGTGG - Intronic
981459190 4:144992046-144992068 AGGCAGAGCACAGGCAGAGTAGG - Intronic
984597724 4:181689691-181689713 ATAAAGGGCACAGGAAGAGAAGG + Intergenic
984648125 4:182241398-182241420 ACACAGGGCCCAGGTAGAGGGGG - Intronic
984880370 4:184405374-184405396 CCACAGGGCACAGTGAGGGGTGG - Intronic
985366261 4:189235870-189235892 CCACAGAGTTCAGGCAGAGGTGG + Intergenic
985524589 5:395535-395557 CCACTGGGCACAGGCAGGGTGGG - Intronic
985775112 5:1837414-1837436 ACACCAGGCCCAGGCAGTGGGGG - Intergenic
985789307 5:1916642-1916664 ACACAGGCCAGAGACAGAAGGGG + Intergenic
985806577 5:2048724-2048746 ACACAGAGCCCAGTCTGAGGTGG - Intergenic
986337127 5:6763571-6763593 ACACAGGACACGTACAGAGGGGG - Intergenic
987040397 5:14056626-14056648 ACTCTGGGCTCAGGCAGAGCTGG - Intergenic
987878533 5:23711556-23711578 TCAAAGTGCTCAGGCAGAGGTGG - Intergenic
988584733 5:32498541-32498563 AGACTGGGCACAGGCATAGGTGG - Intergenic
992165746 5:74049483-74049505 ACTCTGGGCACAGGCATGGGTGG + Intergenic
994380889 5:99069743-99069765 AGACAGAGCACATGCAAAGGGGG - Intergenic
995347117 5:111133570-111133592 ACTCAGGGCACAGGCTAAGTGGG + Intergenic
997581649 5:135020905-135020927 ACACAGGGGACAGATACAGGAGG + Intergenic
997594120 5:135094987-135095009 ACACCAGCCCCAGGCAGAGGAGG - Intronic
997814087 5:136999387-136999409 ACACAGGGGCCAGGGAGAAGGGG - Intronic
997847996 5:137305307-137305329 ACACGGGGCACAGACACACGGGG - Intronic
997975763 5:138440505-138440527 ACAGAGGGCACAGGGGCAGGAGG - Intronic
999074372 5:148780656-148780678 CCATAGAGCACTGGCAGAGGTGG - Intergenic
999395202 5:151222901-151222923 ACTCAGGGCACAAGCAAAGCAGG + Intronic
1000294656 5:159902884-159902906 ACACACGCCAGAGGCATAGGAGG - Intergenic
1001019762 5:168173042-168173064 ACCCTGAGGACAGGCAGAGGAGG - Intronic
1001319828 5:170671279-170671301 GCCCAGGGAACAGGCAAAGGTGG - Intronic
1001992958 5:176133156-176133178 ACGCAGGGCCCAGGTAGAAGAGG + Intergenic
1002193690 5:177491371-177491393 AAGAAAGGCACAGGCAGAGGGGG + Intronic
1002328917 5:178428499-178428521 ACACAGAGCACAGGCCCAGCTGG - Intronic
1002517360 5:179769123-179769145 ACGCAGGGTGCAGGCAAAGGTGG - Intronic
1002570665 5:180137729-180137751 AAAGAGGGCACAGGCTCAGGAGG + Intronic
1002809818 6:616705-616727 ATATATGGCACAGGAAGAGGGGG + Intronic
1002963135 6:1936417-1936439 ACACCAGGCACAGCCAGAAGTGG + Intronic
1003085722 6:3059670-3059692 ACTGAGAGCACAGGCAGAGTAGG - Intergenic
1003526544 6:6902717-6902739 ACACAGGGATAAGGCAGAGTGGG - Intergenic
1004787891 6:18989373-18989395 ACACAGAGCAAGGGGAGAGGAGG - Intergenic
1005822189 6:29607229-29607251 AGAGAGGGCACAGGCAGAACAGG + Intronic
1005852201 6:29830047-29830069 ACACAGGGCCCAGGCTGGGTAGG - Intronic
1005864718 6:29928688-29928710 ACACAGGGCCCAGGCTGGGTAGG - Intergenic
1005875817 6:30008816-30008838 ACACAGGGCCCAGGCTGGGTAGG - Intergenic
1006670132 6:35725259-35725281 ACAGAGAACAGAGGCAGAGGTGG - Intronic
1007474138 6:42107650-42107672 ACCCAGGGCAGGGGCAGGGGTGG + Intronic
1007702959 6:43775049-43775071 GCACAGGCCACAGTCAGTGGTGG - Intronic
1007881265 6:45169972-45169994 CCACAGGGCACAGCCCCAGGGGG + Intronic
1008751262 6:54736788-54736810 CCACAGAGCTCAGGCAGAAGAGG + Intergenic
1012222584 6:96667718-96667740 AGACTGGGCTCAGGCAGTGGTGG + Intergenic
1012693761 6:102352804-102352826 TCCCAGTGCACAGGCAGTGGGGG + Intergenic
1012703535 6:102493997-102494019 TGACAGGTGACAGGCAGAGGTGG + Intergenic
1013079686 6:106801429-106801451 CCTCAAGGCACAGGAAGAGGGGG + Intergenic
1017664217 6:156703684-156703706 ACACAGGGCACAGGTTTTGGAGG - Intergenic
1017989736 6:159475845-159475867 ATACAGTACAGAGGCAGAGGAGG + Intergenic
1018363677 6:163097526-163097548 ACCCAGGGCACAGTCTCAGGAGG + Intronic
1018961701 6:168454170-168454192 CCACAGGGCAGAGTCACAGGAGG - Intronic
1019004768 6:168787132-168787154 CCACAGGGAACAGGCATAGCAGG + Intergenic
1019575784 7:1737038-1737060 GTCCAGGGCACAGGCAGTGGCGG - Intronic
1019579046 7:1751053-1751075 ACAGAGGGCAAAGACAGGGGGGG + Intergenic
1019735531 7:2648213-2648235 GCACAGGCCACAGGCACAGAAGG - Intronic
1019906979 7:4072319-4072341 ACACAGGCCACACACAGAAGGGG - Intronic
1019928692 7:4209405-4209427 ACACGGCGCCCGGGCAGAGGGGG + Intronic
1021591509 7:22268663-22268685 ACACAGGGAGAAGGCAGAGATGG + Intronic
1021896048 7:25237028-25237050 AAGCAGGGCACAGCGAGAGGTGG + Intergenic
1022324533 7:29319048-29319070 ACACAGGGCAGAGGCTAAGACGG + Intronic
1022602118 7:31771229-31771251 GCAAAGGGCACAGGTACAGGAGG - Intronic
1022795841 7:33730867-33730889 GCACAGGGCACATGCAGGGAGGG - Intergenic
1023294705 7:38702598-38702620 GCCCAGGGGACAGGCACAGGAGG - Intergenic
1025784861 7:64635020-64635042 ATTCAGGGCCCAGGCAGAAGAGG - Intergenic
1025785184 7:64637439-64637461 ATACAGGACCCAGGCAAAGGAGG + Intergenic
1026850430 7:73719901-73719923 AGACAGGGCTGGGGCAGAGGAGG - Intergenic
1026879092 7:73897349-73897371 GAAGAGGGCACAGGCATAGGAGG - Intergenic
1027601261 7:80244461-80244483 ACAGAGGGGACAGGAAGAGTGGG - Intergenic
1030435304 7:109510866-109510888 ACACAGGGTGCAGGAAGATGAGG + Intergenic
1030769063 7:113450908-113450930 AATCAGAGCACAGGCAGATGAGG - Intergenic
1031016702 7:116583216-116583238 GCACAGGGCAAAGAAAGAGGAGG + Intergenic
1031887329 7:127255178-127255200 ACGGAGGGGAAAGGCAGAGGAGG + Intergenic
1031969112 7:128051079-128051101 ACACAGGGCAGAACCAGAGAAGG - Intronic
1032498636 7:132382164-132382186 ACAAAGCACACAGGCTGAGGAGG + Intronic
1033216298 7:139495928-139495950 AGACTGAGGACAGGCAGAGGTGG - Intergenic
1033434891 7:141324227-141324249 AGACAGGGCAAACTCAGAGGCGG + Intronic
1033508663 7:142031866-142031888 TCACAGAGCATAGGGAGAGGAGG + Intronic
1034859138 7:154581342-154581364 ACAGAGGGGACAGGAAGAAGGGG + Intronic
1034964818 7:155384449-155384471 CCACATGGCGAAGGCAGAGGTGG - Intronic
1034987581 7:155526459-155526481 ACACAGATCACAGCCAGAGGAGG + Intronic
1035335995 7:158127293-158127315 ACGCAGGGTGCACGCAGAGGAGG - Intronic
1035335999 7:158127316-158127338 ATGCAGGGCGCAAGCAGAGGAGG - Intronic
1035563898 8:628661-628683 ACACAAAGCAAAGCCAGAGGAGG + Intronic
1035649745 8:1255695-1255717 ACACAGCTCCCAGGCAGAAGAGG - Intergenic
1035730239 8:1849420-1849442 ACAGAGGGCAAATGCTGAGGAGG + Intronic
1035730260 8:1849506-1849528 ACACAGGGCAAATGCTGAGGAGG + Intronic
1035730330 8:1849813-1849835 ACACAGGGCAAATGCTGAGGAGG + Intronic
1035730348 8:1849900-1849922 ACAGAGGGCAAATGCTGAGGAGG + Intronic
1035730358 8:1849944-1849966 ACAGAGGGCAAATGCTGAGGAGG + Intronic
1035730368 8:1849988-1850010 ACAGAGGGCAAATGCTGAGGAGG + Intronic
1035730378 8:1850032-1850054 ACAGAGGGCAAATGCTGAGGAGG + Intronic
1035730388 8:1850076-1850098 ACAGAGGGCAAATGCTGAGGAGG + Intronic
1035730398 8:1850120-1850142 ACAGAGGGCAAATGCTGAGGAGG + Intronic
1035730409 8:1850164-1850186 ACAGAGGGCAAATGCTGAGGAGG + Intronic
1037876073 8:22549171-22549193 ACAAAGGGCAGTGCCAGAGGTGG + Intronic
1037942066 8:22959122-22959144 ACACAGGGCAAAGACCAAGGAGG - Intronic
1038697581 8:29819680-29819702 ACATAGGCCACTGGAAGAGGGGG - Intergenic
1040378504 8:46849747-46849769 AATCAGGGCACAGGCAGGAGGGG - Intergenic
1040378676 8:46851180-46851202 AGGCAGGGCTCAGGCAGAAGAGG - Intergenic
1041332275 8:56739854-56739876 ACAGAGGGCACTGGCAGGGATGG - Intergenic
1042641683 8:70942445-70942467 AAACAGCCCACAGGCAAAGGAGG + Intergenic
1044258726 8:90094325-90094347 ACTGAGGGGACAGGCGGAGGGGG + Intronic
1044926766 8:97215795-97215817 CTACAGGGCACTGACAGAGGGGG + Intergenic
1045586596 8:103544593-103544615 ACACAGAGTTCAGGCAGAAGTGG - Intronic
1047136316 8:122082461-122082483 ACTCAAGGCAAAGGCAGAAGGGG + Intergenic
1047644048 8:126851262-126851284 ACACAGGGAAGGGGCAGTGGAGG + Intergenic
1048105779 8:131407649-131407671 ACAAAGGACAAAGGCTGAGGAGG - Intergenic
1048496388 8:134939542-134939564 TCTCAGGGGCCAGGCAGAGGTGG - Intergenic
1048873049 8:138814503-138814525 ACTCAGTGGACAGGCACAGGTGG + Intronic
1049004829 8:139847931-139847953 ACACAGGGCACAGGCAGAGGCGG - Intronic
1049150876 8:141034749-141034771 ACACAGGGCAGGGGCAGAAGTGG - Intergenic
1049213491 8:141397307-141397329 ACACAGGCTCCAGGCAGTGGGGG + Intronic
1049227921 8:141466518-141466540 GGACAGAGCACAGGCGGAGGCGG + Intergenic
1049322285 8:142002965-142002987 GGGCAGGGCACAGGCAGAGAGGG - Intergenic
1049332927 8:142064786-142064808 ACACTGGCCCCAGGCAGAAGTGG + Intergenic
1049463661 8:142741424-142741446 GAACAGGTCACAGTCAGAGGAGG - Intronic
1049604126 8:143521213-143521235 ACACAGGGCAGAGGCGCGGGTGG + Intronic
1049683276 8:143929263-143929285 GCAGAAGGCACAGGCAGAGGTGG - Exonic
1050247987 9:3712173-3712195 ACACAGGGGACTGTCAGGGGAGG + Intergenic
1050449889 9:5768734-5768756 ATACAGGGAACAGGAAAAGGGGG - Intronic
1051893711 9:21967968-21967990 ACACAGTGAAAAGGCAGAAGCGG + Intronic
1052999720 9:34571305-34571327 ACAGATGGCAGAGGCAGTGGGGG - Intronic
1053034002 9:34809525-34809547 AAACAGTGCACAGTCAGAGTTGG + Intergenic
1053691892 9:40590762-40590784 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1053857762 9:42355928-42355950 CCACTGGGCACAGGTAGTGGGGG - Intergenic
1054272911 9:63046729-63046751 GAACAGGGCACAGGCAGGGCAGG + Intergenic
1054303149 9:63391728-63391750 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1054401928 9:64718238-64718260 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1054435534 9:65202553-65202575 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1054494859 9:65819134-65819156 GAACAGGGCACAGGCAGGGCAGG + Intergenic
1057077888 9:92148803-92148825 CCATGGGGCAGAGGCAGAGGAGG - Intergenic
1057229257 9:93308922-93308944 AAACAGAACTCAGGCAGAGGTGG - Intronic
1057302874 9:93896642-93896664 ACACAGGGTACAGGTGGAGGCGG + Intergenic
1057691284 9:97288747-97288769 GCCAAGGGCACAGGGAGAGGAGG + Intergenic
1057783889 9:98072383-98072405 ACCTAGGGCACAGGCAGTGAGGG + Intronic
1059308577 9:113373477-113373499 ACAAAGGCCGCAGGGAGAGGGGG + Exonic
1059805847 9:117799417-117799439 TCACAGGGGACAGGCAGAGAAGG + Intergenic
1060206889 9:121687362-121687384 AGAAAGGGCACAGGGTGAGGTGG + Intronic
1060445013 9:123679893-123679915 ACAAAGGCAGCAGGCAGAGGCGG - Intronic
1060879604 9:127108816-127108838 GCACAGGGCACTGACAGTGGTGG - Intronic
1060894146 9:127206914-127206936 ACACTGGGAAGAGGCAGAGTAGG - Intronic
1061128005 9:128689077-128689099 ACACAGGGCCCGGCGAGAGGTGG - Intronic
1061370418 9:130194519-130194541 ACACAGGGCCCTGGGAGAGGGGG - Intronic
1061534412 9:131238814-131238836 GCAGAGGCCACAGGCAGGGGTGG + Intergenic
1061572266 9:131485095-131485117 ACAGAGGCCACAGGCATGGGTGG - Exonic
1061826360 9:133260731-133260753 ACAGAGGGCGAGGGCAGAGGAGG + Intronic
1062065064 9:134522249-134522271 ACCCAGGGCCCAGACAGAGGTGG - Intergenic
1062365253 9:136205226-136205248 ACACGGGGCAGAGGCGGGGGTGG - Intergenic
1062579385 9:137222643-137222665 GCACCGGGCACAGGCGGAGCTGG - Intergenic
1203622554 Un_KI270749v1:136897-136919 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1185593248 X:1292266-1292288 ACACTGGGTCCAGGTAGAGGTGG - Intronic
1185593570 X:1294090-1294112 ACACTGGGTCCAGGTAGAGGTGG - Intronic
1186407504 X:9316939-9316961 ACACAGGTCAGAGCCTGAGGGGG + Intergenic
1187026876 X:15445035-15445057 ACACAGGACAGAGGGAGAGCTGG - Intronic
1190076168 X:47318791-47318813 ACACAGGGCAGGGGAAGAGAAGG - Intergenic
1191171640 X:57453687-57453709 ACACAGAGTTCAGGCAGATGTGG - Intronic
1191673850 X:63774408-63774430 ACACAGGACACTGGCAGAGTGGG - Intronic
1192190260 X:68986938-68986960 AAACAGGGCACCCACAGAGGAGG - Intergenic
1192263595 X:69523838-69523860 ACACAGGGCATGGGGAGGGGAGG - Intronic
1195488419 X:105438163-105438185 TTAGAGGGAACAGGCAGAGGTGG - Intronic
1195870064 X:109476162-109476184 ATACGGGGTACAGGAAGAGGAGG - Intronic
1198065426 X:133091744-133091766 GCACAGGGGACAGGAGGAGGGGG + Intronic
1198729425 X:139712691-139712713 ACCCAGGGCACAGAGAGTGGAGG + Intergenic
1199768403 X:150957575-150957597 ACACCAGGCACTTGCAGAGGTGG - Intergenic
1199907611 X:152250057-152250079 AGACAGGGCTGAGGTAGAGGAGG - Intronic
1200213705 X:154358172-154358194 GCTCCGGGCACAGGCAGGGGAGG - Intronic
1200848608 Y:7859026-7859048 AGGCAGGGCTCAGGCAGATGAGG + Intergenic
1200865409 Y:8038216-8038238 AGACAGGGCTCAGGTAGAAGTGG - Intergenic
1200902878 Y:8450722-8450744 AAGCAGGGTCCAGGCAGAGGAGG - Intergenic
1200915408 Y:8567033-8567055 GCAAATGGTACAGGCAGAGGTGG - Intergenic
1201190529 Y:11439328-11439350 GAACAGGGCACAGGCAGGGCAGG - Intergenic
1202268371 Y:23044679-23044701 AGTCAGGGCTCAGGCAGATGTGG - Intergenic
1202421363 Y:24678423-24678445 AGTCAGGGCTCAGGCAGATGTGG - Intergenic
1202449423 Y:24991659-24991681 AGTCAGGGCTCAGGCAGATGTGG + Intergenic