ID: 1049004830

View in Genome Browser
Species Human (GRCh38)
Location 8:139847934-139847956
Sequence CTGACACAGGGCACAGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 382}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049004830_1049004843 11 Left 1049004830 8:139847934-139847956 CCTCTGCCTGTGCCCTGTGTCAG 0: 1
1: 0
2: 4
3: 44
4: 382
Right 1049004843 8:139847968-139847990 GGGCACGTGGGGCCTGGACTTGG No data
1049004830_1049004839 0 Left 1049004830 8:139847934-139847956 CCTCTGCCTGTGCCCTGTGTCAG 0: 1
1: 0
2: 4
3: 44
4: 382
Right 1049004839 8:139847957-139847979 CAGCAGCCCTGGGGCACGTGGGG No data
1049004830_1049004835 -10 Left 1049004830 8:139847934-139847956 CCTCTGCCTGTGCCCTGTGTCAG 0: 1
1: 0
2: 4
3: 44
4: 382
Right 1049004835 8:139847947-139847969 CCTGTGTCAGCAGCAGCCCTGGG No data
1049004830_1049004836 -9 Left 1049004830 8:139847934-139847956 CCTCTGCCTGTGCCCTGTGTCAG 0: 1
1: 0
2: 4
3: 44
4: 382
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004830_1049004840 5 Left 1049004830 8:139847934-139847956 CCTCTGCCTGTGCCCTGTGTCAG 0: 1
1: 0
2: 4
3: 44
4: 382
Right 1049004840 8:139847962-139847984 GCCCTGGGGCACGTGGGGCCTGG No data
1049004830_1049004846 25 Left 1049004830 8:139847934-139847956 CCTCTGCCTGTGCCCTGTGTCAG 0: 1
1: 0
2: 4
3: 44
4: 382
Right 1049004846 8:139847982-139848004 TGGACTTGGTCTGCCGGAACTGG No data
1049004830_1049004837 -2 Left 1049004830 8:139847934-139847956 CCTCTGCCTGTGCCCTGTGTCAG 0: 1
1: 0
2: 4
3: 44
4: 382
Right 1049004837 8:139847955-139847977 AGCAGCAGCCCTGGGGCACGTGG No data
1049004830_1049004838 -1 Left 1049004830 8:139847934-139847956 CCTCTGCCTGTGCCCTGTGTCAG 0: 1
1: 0
2: 4
3: 44
4: 382
Right 1049004838 8:139847956-139847978 GCAGCAGCCCTGGGGCACGTGGG No data
1049004830_1049004844 19 Left 1049004830 8:139847934-139847956 CCTCTGCCTGTGCCCTGTGTCAG 0: 1
1: 0
2: 4
3: 44
4: 382
Right 1049004844 8:139847976-139847998 GGGGCCTGGACTTGGTCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049004830 Original CRISPR CTGACACAGGGCACAGGCAG AGG (reversed) Intronic
900423557 1:2566200-2566222 CGGACACAGGGAACAGGGAGCGG - Intergenic
900569838 1:3352830-3352852 CTGACACCGGGCAGAGGCCTTGG - Intronic
900881404 1:5383788-5383810 ATGACACAGGCCAGGGGCAGTGG + Intergenic
901168544 1:7237059-7237081 CTGCCACAAGGCACAGGGAAGGG - Intronic
901280023 1:8026540-8026562 CTGCCGCACGGCTCAGGCAGAGG - Intergenic
901760370 1:11467165-11467187 CTGACTCAGGGAACAAGCGGAGG - Intergenic
902138876 1:14334831-14334853 CAGACACAGGACAAACGCAGAGG + Intergenic
903114975 1:21171547-21171569 CTAACATGGGGCAGAGGCAGAGG - Intronic
903661693 1:24982445-24982467 CTGGCCCAGGCCACAGACAGGGG + Intergenic
904290782 1:29484736-29484758 CAAACACAGGGCAGAGACAGGGG - Intergenic
904687878 1:32273982-32274004 CCAACACAGGGTACTGGCAGAGG + Intronic
904700626 1:32355836-32355858 CTGACTCAGGGCAGTGGCAGTGG + Intronic
904963440 1:34352706-34352728 CTGACTCAGAGCAGAGGCTGTGG - Intergenic
905402524 1:37714122-37714144 CTGGCTCTGAGCACAGGCAGTGG + Intronic
905462291 1:38129684-38129706 CAGAGACAGGGCCCAGGCTGAGG + Intergenic
905665403 1:39760574-39760596 CAGGAAGAGGGCACAGGCAGGGG + Intronic
905799463 1:40834110-40834132 TTGACACTGGGCACATGGAGGGG - Intronic
905803573 1:40861156-40861178 CAACCACAGGGCCCAGGCAGCGG + Exonic
905858478 1:41330563-41330585 CTGACCCAGGCCTCAGGCTGGGG + Intergenic
905881560 1:41467469-41467491 CTGACACTGTGCACAGCCCGGGG + Intergenic
905882509 1:41474029-41474051 CTGTGACAGGCCCCAGGCAGTGG + Intergenic
907337933 1:53712647-53712669 CTGAATAAGGTCACAGGCAGTGG + Intronic
907425323 1:54375814-54375836 CTGCCACAGGGCCCTGGCGGTGG + Intronic
908511357 1:64852383-64852405 CAGAAACAGGGCTCAGGGAGAGG + Intronic
910238440 1:85060390-85060412 CTGAAATAAGGCAGAGGCAGAGG + Intronic
912332803 1:108834881-108834903 CAGACACAGGACACAGAAAGAGG - Intronic
912452231 1:109774198-109774220 CAGGCACAGGGCAGGGGCAGGGG + Intronic
915488059 1:156235853-156235875 CTGACAGAGGGCCCAGACTGTGG - Intronic
915963041 1:160283169-160283191 CTGATAGAAGCCACAGGCAGTGG + Intronic
916017239 1:160761063-160761085 CTGACAGAGAACACAGCCAGTGG + Intergenic
916065391 1:161132259-161132281 CTGAGACTGGGCCCAGCCAGGGG - Intronic
917975935 1:180237643-180237665 CTGACAGAGGGAACAGGGTGGGG - Intronic
919816672 1:201445188-201445210 CTGGCCCAGGGTAGAGGCAGAGG + Intergenic
919864899 1:201773525-201773547 CTGAACCAGAGCAAAGGCAGGGG + Intronic
919930281 1:202216882-202216904 CTGGCTCTGGGCACAGGCAGGGG + Intronic
920044718 1:203125920-203125942 CTGAGGCTGGGAACAGGCAGGGG + Intronic
920631614 1:207658694-207658716 CGGGCACAGGGCACTGGCACAGG - Intronic
920642104 1:207762824-207762846 CGGGCACAGGCCACAGGCACAGG - Intronic
920678230 1:208053408-208053430 CTTACCCAGGGCAGGGGCAGTGG - Intronic
921492203 1:215790949-215790971 CAGACACAGGTGACAGGCTGGGG + Intronic
921565349 1:216710914-216710936 CTGACAGTGGGACCAGGCAGAGG + Intronic
922776071 1:228214731-228214753 CAGACCCAGGGCTCAGGAAGAGG + Intronic
923642226 1:235775735-235775757 CTAAGGCAGGGCACAGCCAGGGG + Intronic
924620790 1:245658942-245658964 ATGATAGAGGGCACATGCAGTGG + Intronic
1063121049 10:3106033-3106055 CGGACACAGGGCCCAGACAGTGG - Intronic
1064305723 10:14164331-14164353 CCGGCACAGGGCTCAGGCATAGG - Intronic
1064436708 10:15317114-15317136 CGGAAACAGGACACAGGGAGGGG + Intronic
1066531432 10:36344510-36344532 CTGGCACAGGGGACAGGAGGGGG - Intergenic
1067080406 10:43209317-43209339 CTGCCCCAGGTCACAGCCAGAGG + Intronic
1067108040 10:43378457-43378479 CTGAAACAGGCCCCAGGAAGGGG - Intergenic
1067147464 10:43703666-43703688 CTGTAACAGGTCACAGGGAGTGG - Intergenic
1067728508 10:48791721-48791743 ATGTCACAGGTCTCAGGCAGTGG + Intronic
1068360370 10:55969433-55969455 CTGACATTGGACAGAGGCAGTGG - Intergenic
1069619989 10:69831364-69831386 GTGACACTGAGCACAGGCAGAGG - Intronic
1069812526 10:71173000-71173022 CTCACCCAGAGCACAGGAAGAGG + Intergenic
1069873460 10:71547323-71547345 CAGACGGATGGCACAGGCAGCGG + Intronic
1070745357 10:78930499-78930521 CTGACTCAGAGCAGAGGCGGTGG - Intergenic
1070746546 10:78937178-78937200 CTGACTCAGGTCCCAGGCACAGG - Intergenic
1070962434 10:80508591-80508613 CTGCCCCAGGCCACAAGCAGTGG - Intronic
1071255646 10:83869564-83869586 CTGGCACATGGTAAAGGCAGAGG - Intergenic
1073112784 10:101072448-101072470 CAGGCACAGGGCTGAGGCAGCGG + Intergenic
1073120759 10:101121410-101121432 CTGAGAAAGGGCGCAGGCCGCGG + Intronic
1074063295 10:109988524-109988546 CTGACCCAGAGCCCAAGCAGTGG - Intergenic
1075815693 10:125263423-125263445 CTGACAGAGTTCACAGTCAGTGG - Intergenic
1075908894 10:126106430-126106452 CTGACCCAGGGCAGGGGAAGTGG - Intronic
1076340445 10:129741749-129741771 CCGACTCAGGGCCCAGGCACTGG - Intronic
1076442330 10:130488553-130488575 CTGTCTGAGGGCAGAGGCAGGGG + Intergenic
1076947311 10:133660076-133660098 ATGACACAAGGCAGAGGCTGTGG + Intergenic
1077168257 11:1153362-1153384 CTGACACCGGCCCCAGGCTGGGG + Intergenic
1077443807 11:2580960-2580982 CTGCCTCAGGGCATTGGCAGGGG + Intronic
1077522870 11:3046614-3046636 CTGACCCACGGCAGAGGCGGGGG + Intronic
1078131963 11:8620629-8620651 CTGCCATAGGGCAGAGGGAGAGG - Intronic
1078930774 11:15910712-15910734 CTCACACTGGGCAGAGGCAGAGG + Intergenic
1078992515 11:16664340-16664362 CTGGCACAGGCCACAAGGAGTGG + Intronic
1079021764 11:16914979-16915001 CTGTCTCAGGGCACTGGGAGTGG - Intronic
1081729610 11:45361020-45361042 CTGCCAAATGGGACAGGCAGGGG - Intergenic
1082811717 11:57482658-57482680 CTGCCACAGGGCAGAGGCCAGGG + Intergenic
1083164939 11:60878341-60878363 CTGCCACAGGTCAGAGACAGTGG - Intergenic
1083406253 11:62459278-62459300 CTGACTCAGGGCACTGGAAATGG + Intronic
1083789819 11:64977200-64977222 CTGTCACAGGACAGAAGCAGAGG + Intergenic
1084173247 11:67410534-67410556 CAGACGCAGGGCCCAGGGAGGGG - Intronic
1084750955 11:71204308-71204330 CCGGCTCAGGGCACGGGCAGAGG + Intronic
1085281844 11:75336072-75336094 ATGAGACAGGGCAGAGGCACGGG - Intronic
1085386525 11:76161211-76161233 CAGACCCAGGGCAGGGGCAGAGG - Intergenic
1086350372 11:85937853-85937875 CTGACACAGCGCACAAGGACTGG - Intergenic
1087841742 11:102927731-102927753 CTGACCCAGGGCTTAGGCAGTGG + Intergenic
1089005099 11:115084385-115084407 CTGACGCAGAGCTCAGGGAGTGG - Intergenic
1089345812 11:117791003-117791025 TAGAGACAGGGCACAGGGAGTGG + Intronic
1089957004 11:122580720-122580742 CTTTCCCAGGGCAGAGGCAGAGG - Intergenic
1090158627 11:124467805-124467827 CTGGCACAGGGCTGAGGAAGGGG + Intergenic
1091338874 11:134795065-134795087 CTGACAGAGGGCACAGGTTGGGG + Intergenic
1093643352 12:21553990-21554012 CTCACACAGGGGAAAAGCAGTGG - Intronic
1094393392 12:29977945-29977967 CTGACTCAGGGAACAGACAGTGG + Intergenic
1095873279 12:47053668-47053690 CTGAGACAGGGCACAAAGAGTGG - Intergenic
1096591235 12:52660427-52660449 AAGACTCAGGGGACAGGCAGAGG - Intergenic
1096787746 12:54027332-54027354 CAGACTCAGGGCACCGCCAGTGG - Intronic
1097990014 12:65824618-65824640 CGGGCACGGAGCACAGGCAGAGG - Exonic
1098039159 12:66336664-66336686 CTGACACAGGGCACGGTGTGTGG + Intronic
1100616856 12:96237485-96237507 CAGAGACAGAGCAGAGGCAGGGG + Intronic
1101898332 12:108772153-108772175 CTACCACAGGGCACAGAAAGTGG + Intergenic
1101921534 12:108937207-108937229 CCAAAACAGGGCACAGGGAGTGG + Intronic
1102198526 12:111041724-111041746 CTGGCACAGGGCCCTGGCACTGG - Intronic
1103933961 12:124465575-124465597 CTGACACTGGGCCCTGGAAGGGG - Intronic
1103955312 12:124573106-124573128 CTGTCACAGAGCACAGGCAAGGG + Intergenic
1104387566 12:128364433-128364455 CTCACACAGGGCACATGGATGGG + Intronic
1104448711 12:128853150-128853172 CTTCCACAGGGAACAGGCAGCGG - Intergenic
1104959102 12:132479783-132479805 CTGCTACAGGGCCCAGGGAGAGG - Intergenic
1106764533 13:32900612-32900634 TTGACACATGGCACTGTCAGAGG - Intergenic
1106810418 13:33353211-33353233 GGGACACAGGGTAGAGGCAGTGG - Intergenic
1109556737 13:63986200-63986222 TTGCCACAGGGAATAGGCAGGGG - Intergenic
1111678433 13:91415154-91415176 CTGACACATGGCCCAAGCAGAGG - Intronic
1111716891 13:91889242-91889264 CTGACTCAGGGGACAGGCTGGGG + Intronic
1111996369 13:95169544-95169566 CTGAGGCAGGGGACTGGCAGTGG - Intronic
1113144435 13:107192233-107192255 CTGACACGGGGCACCAGCTGTGG + Intronic
1113350657 13:109526090-109526112 TTTACAGAGGGCACAGGAAGGGG - Intergenic
1113491264 13:110693876-110693898 TGGACACAGGGCCCAGCCAGCGG - Intronic
1117474123 14:56076729-56076751 CTGGCACAAGGCTCTGGCAGTGG - Intergenic
1117838219 14:59829680-59829702 CTCACACAGGGAGCAGGCAGAGG + Intronic
1118603494 14:67486857-67486879 CTGTCACAGGGCAATGGGAGGGG - Intronic
1120034975 14:79686292-79686314 CAGAGAGAGAGCACAGGCAGAGG + Intronic
1121610346 14:95274410-95274432 CTGACACACGACACAGCCTGTGG - Intronic
1122052460 14:99069341-99069363 CAGACACAGCACACAGTCAGTGG - Intergenic
1122266984 14:100551172-100551194 CCCACATAGGCCACAGGCAGGGG - Intronic
1122906971 14:104806076-104806098 CAGACACAGGCACCAGGCAGGGG + Intergenic
1123050405 14:105538656-105538678 CTCACTCAGGGCCCAGGCTGAGG - Intergenic
1202921366 14_KI270723v1_random:32627-32649 ATGACACAAGGCAGAGGCTGTGG + Intergenic
1125244915 15:37624405-37624427 CTGACACAGGGGAAAGACATGGG + Intergenic
1125502212 15:40246838-40246860 CTGACCCAGGGCACATGCAGAGG + Intronic
1125970047 15:43904106-43904128 CTGCCACAAGGCATGGGCAGAGG + Intronic
1126660623 15:51030108-51030130 CTGACACAGTGCAGGGCCAGTGG - Intergenic
1126927910 15:53611630-53611652 CTGACACAGTGGACAGGAAATGG + Intronic
1128112072 15:65082734-65082756 CTGAGGCAGTGCGCAGGCAGAGG - Intergenic
1128535751 15:68488965-68488987 TTGACACAGGGCACATGGAAGGG + Intergenic
1128684041 15:69670767-69670789 CACACACAGGGCCCAGGGAGAGG - Intergenic
1128702344 15:69813613-69813635 CCAAGACAGGGTACAGGCAGGGG + Intergenic
1128739661 15:70074729-70074751 CAGGCACAGGGCACAAGTAGGGG + Intronic
1128753534 15:70165676-70165698 CTGGCTCAGGCCTCAGGCAGGGG + Intergenic
1128768944 15:70267546-70267568 CAGGCAGAGGGGACAGGCAGTGG - Intergenic
1130032842 15:80332051-80332073 CTGGCACTGGGCACAGGGACAGG - Intergenic
1130926873 15:88392098-88392120 CAGACACAGGGCACCAGGAGGGG - Intergenic
1131695703 15:94875780-94875802 CTGACTCATGTCACAGGAAGAGG - Intergenic
1132352266 15:101147302-101147324 CTGACTCAGGACACAGGCCCTGG + Intergenic
1133017849 16:2952854-2952876 CTCACGCAGGGCACAGCCACTGG + Intergenic
1133385605 16:5367747-5367769 ATGAGACAGGGCACACGGAGGGG + Intergenic
1135414360 16:22257581-22257603 CTGTGACGGGGGACAGGCAGTGG - Intronic
1135572964 16:23563362-23563384 CAGACACCGTGCACAGGCGGGGG - Intronic
1136019024 16:27428300-27428322 CTGGGGCAGGGCACAGGCTGGGG - Intronic
1136220175 16:28823427-28823449 CGGCCACAGGCCCCAGGCAGGGG - Exonic
1136277833 16:29189530-29189552 GTGAAAGAGGCCACAGGCAGAGG - Intergenic
1136296838 16:29308773-29308795 CAGGCAGAGGGGACAGGCAGAGG - Intergenic
1136296897 16:29308982-29309004 CGGGCAGAGGACACAGGCAGAGG - Intergenic
1136640136 16:31557294-31557316 CTGACAAAGGGGGCAGGCTGGGG - Intergenic
1137061861 16:35798246-35798268 CTCACACAGGGCACCAGCTGCGG - Intergenic
1137448353 16:48546915-48546937 CTGACAATGAGCCCAGGCAGAGG + Intronic
1137607029 16:49793719-49793741 GTGACACAGAGCAGAGGCATAGG + Intronic
1137769947 16:51008182-51008204 CTGAAACAGGGCACTGGTGGTGG - Intergenic
1138534739 16:57653876-57653898 GAGACACAGGGAAGAGGCAGAGG - Intronic
1139136442 16:64210379-64210401 CAGACAGAGGGAATAGGCAGAGG - Intergenic
1139321260 16:66116301-66116323 CTGATAGAGGTGACAGGCAGAGG - Intergenic
1139517621 16:67461028-67461050 CAGACACTGAGCAAAGGCAGCGG + Intronic
1139588190 16:67917735-67917757 CTGCCTGTGGGCACAGGCAGGGG + Intronic
1141408105 16:83812036-83812058 CTGACACAAGACAGTGGCAGTGG - Exonic
1141616787 16:85214402-85214424 CAGACACAGGGTGCAGGCAGAGG + Intergenic
1142058447 16:88015079-88015101 CGGGCAGAGGGGACAGGCAGAGG - Intronic
1142058471 16:88015169-88015191 CGGGCAGAGGGCACAGGCAGAGG - Intronic
1142058481 16:88015209-88015231 CAGGCAGAGGGCACAAGCAGAGG - Intronic
1142082208 16:88155570-88155592 GTGAAAGAGGCCACAGGCAGAGG - Intergenic
1142111623 16:88335041-88335063 CAGCCACTGGGCACAGGAAGAGG + Intergenic
1142172414 16:88629840-88629862 CAGACACAGAGAACAGGCAGGGG + Intronic
1142275700 16:89117775-89117797 CAGACAGATGGCACAGGGAGAGG + Intronic
1142282454 16:89155579-89155601 CTGACCCCGGGAACAGTCAGAGG + Exonic
1142290169 16:89190469-89190491 CTGACACAGAGCAGCTGCAGAGG + Exonic
1142804001 17:2362140-2362162 CGGAGACAGGGCTCAGCCAGCGG + Exonic
1144808480 17:17983456-17983478 AGGACACAGGACACAGACAGAGG - Intronic
1145836509 17:27957969-27957991 CAGACACTGGGAAAAGGCAGGGG + Intergenic
1146147129 17:30429622-30429644 GTGGCACAGGCAACAGGCAGTGG + Intronic
1146912880 17:36659524-36659546 CTCCCCCAGGGCACAGACAGTGG - Intergenic
1147694499 17:42341016-42341038 CTAACTCAGGGCACAGGCATTGG + Intronic
1148053483 17:44780341-44780363 CTGTCACTGAGCACAGTCAGGGG + Exonic
1148912131 17:50948474-50948496 CTGGCACTGGGCACCGGCTGAGG - Intergenic
1148913450 17:50955487-50955509 CTGACACATGGCACAGCAAGGGG - Intergenic
1149626419 17:58083615-58083637 CCGAGGCAGAGCACAGGCAGGGG - Exonic
1149992203 17:61389557-61389579 CTTAGCCAGGGCAGAGGCAGAGG + Intronic
1151316373 17:73325095-73325117 CTGGCTCTGGGTACAGGCAGGGG - Intergenic
1151422180 17:74005798-74005820 GTGACACAGGGCAGTGGCTGGGG + Intergenic
1151477641 17:74352981-74353003 CTGGGACAGGGCACAGGGTGGGG - Intronic
1151809092 17:76425882-76425904 CTGACACAGGTGAGCGGCAGAGG - Intronic
1151954089 17:77372172-77372194 CTGACTCTGGGCAGAGGCCGAGG + Intronic
1152473820 17:80504587-80504609 CTGACAGAGGGCAGTGGGAGAGG - Intergenic
1152559398 17:81070479-81070501 CGGACACTGGGCAAAGGAAGAGG + Intronic
1153150577 18:2088048-2088070 CAGAGACAGGCCACAGTCAGTGG - Intergenic
1153904953 18:9653005-9653027 ATGAAACAGGTCAGAGGCAGAGG - Intergenic
1154415551 18:14173720-14173742 CAGGTCCAGGGCACAGGCAGGGG + Intergenic
1159772278 18:72560036-72560058 ATCAAACAGGGAACAGGCAGAGG + Intronic
1159935903 18:74367432-74367454 ATGACACAGGCCACACGCAGAGG - Intergenic
1160234205 18:77072983-77073005 CTAAGACAGGGCAATGGCAGTGG - Intronic
1160282744 18:77507986-77508008 CTGACACGAGGCAGAAGCAGAGG - Intergenic
1160373167 18:78391011-78391033 GGGCCACAGGGCACCGGCAGTGG - Intergenic
1160842413 19:1152150-1152172 CAGCCACAGGGCTCAGGCCGGGG - Intronic
1161043664 19:2123190-2123212 GCGCCACAGGGCACTGGCAGAGG + Intronic
1161355014 19:3814084-3814106 CAGACACAGGGCACAGGGCCCGG - Intronic
1161377437 19:3947227-3947249 CTGACACTGGGCCCAGGCATGGG - Intergenic
1161467989 19:4442786-4442808 CTGACAGTGGGGACAGGCAGAGG - Intronic
1161517124 19:4702761-4702783 CTAACACTGGGGACAGCCAGGGG + Intronic
1162041025 19:7971217-7971239 CACACACGGGCCACAGGCAGGGG - Intronic
1162486309 19:10962453-10962475 GGGACACAGCGGACAGGCAGGGG + Intronic
1163266847 19:16227021-16227043 CTGTCACAGGCCACTGGAAGAGG + Intronic
1163468577 19:17483919-17483941 CGGACCAAGGGCAGAGGCAGGGG - Intronic
1163488151 19:17601715-17601737 GAGACACAGGTCACAGGCGGAGG - Exonic
1163488333 19:17602703-17602725 CTGACACATGGGACAGAGAGTGG - Exonic
1163642333 19:18468862-18468884 CTGCCCCAGGCCACAGGCAGTGG - Intronic
1164694011 19:30229865-30229887 CAGACAAAGTCCACAGGCAGAGG - Intronic
1165406180 19:35632722-35632744 CTGCCACAGGGCTGAGCCAGAGG + Intronic
1165487072 19:36102609-36102631 CAGACACAGGGTACGAGCAGGGG - Intronic
1165857114 19:38886043-38886065 CTGACAGAGGACACTGGCAGAGG + Intronic
1165860186 19:38905338-38905360 CTGAAGCAGGGCACGGGCACAGG - Exonic
1165902794 19:39176567-39176589 CTGGGACAGGGCAGAGGCAGTGG - Intronic
1166137782 19:40787631-40787653 CAGGGTCAGGGCACAGGCAGAGG + Intronic
1166741678 19:45118285-45118307 GTGACACAGGTCACAGGCCCCGG - Intronic
1167494407 19:49809259-49809281 CTGAAGCAGGGCACAGGCTGGGG + Intronic
1167560101 19:50221879-50221901 CAGGCAGAGGGCACAGCCAGGGG - Intronic
1167659258 19:50786250-50786272 CTGGTAGAGGGGACAGGCAGGGG + Intergenic
1167981058 19:53276184-53276206 GTGACAAAGGACAGAGGCAGAGG - Intergenic
1168649464 19:58084549-58084571 CGGATTCAGGGCACAGGCAGAGG + Exonic
926062248 2:9811960-9811982 CTGCCACAGAGCACAGACTGGGG - Intergenic
926163370 2:10503372-10503394 CTGAGGCAGAGGACAGGCAGGGG - Intergenic
926299888 2:11595055-11595077 CTGACACATGGCAGAGGCTCAGG - Intronic
926996416 2:18740719-18740741 GTGACAGAGGGCCCAGCCAGCGG - Intergenic
927240657 2:20917226-20917248 CTGACACTGGGCACAGGCACTGG + Intergenic
927927719 2:27025130-27025152 CTGACACAGGGCCCCTGGAGGGG + Intronic
928485435 2:31726471-31726493 CTGAGACAGGGCTCGGGCACTGG + Intergenic
929027135 2:37615656-37615678 ATGACCCAGGGCTGAGGCAGGGG + Intergenic
929169851 2:38920737-38920759 GAAACACAGGGCACACGCAGAGG - Intronic
929600919 2:43204093-43204115 CTGCCACAGGCCACGGCCAGAGG + Intergenic
929977788 2:46652109-46652131 CTGAGGGAGGGCTCAGGCAGAGG + Intergenic
933174211 2:79158247-79158269 CAGGCACAGGGGACAGGGAGTGG + Intronic
934884000 2:98008525-98008547 CAGTCACAGGGCACAGGCCTGGG - Intergenic
935092726 2:99911777-99911799 CTAACACCTGGCACAGGTAGTGG - Intronic
935103740 2:100020565-100020587 CTGACACAGGCAACAAGTAGAGG - Intronic
935222779 2:101029099-101029121 CTTCCACAGGGGCCAGGCAGTGG + Intronic
935406823 2:102718500-102718522 CTAACACAGCGCCCAGGCTGGGG + Exonic
936077662 2:109411991-109412013 CTGCCACAGGGCCCATTCAGGGG - Intronic
936451368 2:112636189-112636211 CTATCTCAGGGAACAGGCAGTGG + Intergenic
938211138 2:129466553-129466575 CTGCCACATGGCGCCGGCAGAGG + Intergenic
938408778 2:131047060-131047082 CTGACCCACAGCCCAGGCAGCGG + Exonic
940336700 2:152536256-152536278 CTGACACAAGTAACAGGGAGAGG - Intronic
940453877 2:153872442-153872464 CGGTCCCAGGGCAAAGGCAGGGG + Intronic
942079383 2:172385767-172385789 CCGACACAGAGCAAAGGCACAGG - Intergenic
942344849 2:174992069-174992091 GTGACAGAGGGCAGAGGAAGAGG + Intronic
943849241 2:192695427-192695449 AAGAAACAGGGCACAGGGAGGGG - Intergenic
944531688 2:200673862-200673884 CAGACAGAGGACACAGGCAAAGG - Intronic
945955682 2:216083826-216083848 CTGACAGAGGTCAGAGGCAGAGG - Intronic
946005025 2:216517579-216517601 CTGCCACAGGGCAGAGCCAATGG + Intronic
946239650 2:218345763-218345785 TTGGCCCAGGGCAGAGGCAGAGG - Exonic
946266260 2:218544614-218544636 CTGCCAGAGGGCAAAGCCAGGGG + Intronic
946354425 2:219176332-219176354 CTGAAACAGGGCAGGGGCAGCGG + Intronic
947654597 2:231815783-231815805 CATTCACAGAGCACAGGCAGAGG + Intergenic
947715115 2:232335438-232335460 CTGACAGATGGCACCAGCAGGGG + Intronic
947734193 2:232446389-232446411 CTGACAGATGGCACCAGCAGGGG + Intergenic
947856341 2:233327026-233327048 CTCACACAGGGCACATGATGTGG - Intronic
947936533 2:234009485-234009507 CTGACCCAGGGCCCAGGCTGGGG - Intronic
948236233 2:236393278-236393300 AGGACCCAGGGCACAGACAGAGG + Intronic
948309254 2:236972732-236972754 CTGGGGCAGTGCACAGGCAGCGG - Intergenic
948676792 2:239601556-239601578 CTGACAAAGGACAGAGGCCGGGG - Intergenic
948938143 2:241181753-241181775 CCTACAATGGGCACAGGCAGGGG - Intronic
949078130 2:242074312-242074334 ATGGCACAGGGCACAGGCTCTGG + Intergenic
1170606909 20:17881709-17881731 CTGCCTCAGGGCTCAGGGAGGGG - Intergenic
1170701215 20:18705396-18705418 GTGAGAAAGGGTACAGGCAGGGG - Intronic
1171232462 20:23498630-23498652 CAGACAGAGACCACAGGCAGGGG - Intergenic
1171254690 20:23680452-23680474 CTGACAAAGGGGGCAGGCTGGGG + Intergenic
1172112932 20:32558186-32558208 ATGACACAGGGCAGTGGCACTGG - Intronic
1172213100 20:33214687-33214709 CTGTGAGAGGGCACAGGGAGGGG - Intergenic
1172249857 20:33471465-33471487 CTGACACAGAGCAGAGTCAGTGG + Intergenic
1172324652 20:34025040-34025062 CTGGCACAGGGCAAAGGCACAGG - Intronic
1172647693 20:36481556-36481578 CTGCCACAGTGCCCAGTCAGTGG + Intronic
1173579641 20:44137843-44137865 CTGACACTGGGAAGAGGGAGAGG + Intronic
1173670084 20:44792917-44792939 CTGAGAAGGGGCACAAGCAGAGG + Intronic
1175327367 20:58139088-58139110 CTCAGAAAGGGCTCAGGCAGAGG - Intergenic
1175786829 20:61717209-61717231 CTGTCACAGGACAAAGGCAGGGG + Intronic
1175809609 20:61850881-61850903 AGGACACAGGCCACGGGCAGAGG + Intronic
1176009501 20:62885207-62885229 CTGACACGGGGAACAGACACAGG + Intronic
1176119695 20:63448728-63448750 CCGAGACTGGGCACAGGCACGGG + Intronic
1176297204 21:5080443-5080465 CTGAGGCAGGGCAGGGGCAGGGG + Intergenic
1176375196 21:6083526-6083548 CTGACAGAGGCCACACGCTGGGG + Intergenic
1176866822 21:14058643-14058665 CAGGGCCAGGGCACAGGCAGGGG + Intergenic
1179533058 21:42033128-42033150 TGGACACAGGGCACAGCCAGGGG + Intergenic
1179748278 21:43454718-43454740 CTGACAGAGGCCACACGCTGGGG - Intergenic
1179859825 21:44181505-44181527 CTGAGGCAGGGCAGGGGCAGGGG - Intergenic
1180050411 21:45328556-45328578 CTAACACAGGGCAGGGGCACAGG - Intergenic
1180151364 21:45950003-45950025 ACGACACAGGGCACCGGGAGGGG - Intergenic
1180856469 22:19048989-19049011 CTGGCCCATGGCACAGGGAGTGG + Intronic
1180992866 22:19948365-19948387 ATGTCACAGGCCACATGCAGTGG + Intronic
1181115563 22:20631003-20631025 CTCAAACAGGGGACAGGCACAGG + Intergenic
1181363666 22:22357642-22357664 CTGACCCAGGGCTCAGGGTGGGG + Intergenic
1181366480 22:22380725-22380747 CTGACCCAGGGCTCAGGGTGGGG + Intergenic
1181372850 22:22431842-22431864 CTGACCCAGGGCTCAGGGTGGGG + Intergenic
1182351598 22:29702978-29703000 CTAACACAGGCCCCAGGCTGGGG - Intergenic
1183102258 22:35591225-35591247 CTGACCCAGGGGGCAGGCTGGGG - Intergenic
1183196741 22:36358678-36358700 CTGGAACAGGGCACGGGCAGTGG - Intronic
1183380496 22:37488364-37488386 TTGACACGGGGAACAGGCAAAGG + Intergenic
1183497252 22:38153962-38153984 CTGCCACAGGGCTGGGGCAGTGG + Intronic
1184309229 22:43630543-43630565 CTGAGAGAGGGAACAGGGAGGGG + Intronic
949372899 3:3354514-3354536 CAGACACATGACTCAGGCAGAGG + Intergenic
950687537 3:14629176-14629198 CTCCCACAGAGCACAGACAGAGG + Intergenic
953910437 3:46890034-46890056 CTCAGTCAGGGCAGAGGCAGAGG + Intronic
954133132 3:48570070-48570092 GGTACAAAGGGCACAGGCAGGGG + Intronic
954421722 3:50422352-50422374 CTGACAAAGGGAACAGCCTGTGG - Intronic
954777289 3:53031262-53031284 GTCACACAGGGCAAAGGAAGTGG + Intronic
954808964 3:53236282-53236304 CTGCCGCAGGGCCAAGGCAGGGG + Intronic
955247126 3:57235747-57235769 CTAACACAGGGCTAAAGCAGTGG - Intronic
956449969 3:69364303-69364325 CTGAACCAGGGGACAGACAGAGG + Intronic
956834302 3:73083265-73083287 CTCACACAGGGTTCAGGCAAAGG - Intergenic
957080145 3:75630340-75630362 ATGACACAAGGCAGAGGCTGTGG - Intergenic
959038026 3:101387655-101387677 CTGATGGAGTGCACAGGCAGTGG - Intronic
959971298 3:112413387-112413409 CAGCCACAGAGCACTGGCAGTGG - Intergenic
960542256 3:118874044-118874066 CAGCCACAGGGGACAGGCACTGG + Intergenic
961762224 3:129179581-129179603 CTGACACTGGCCAGGGGCAGTGG + Intronic
962821009 3:139047274-139047296 CTGAGACTGGGCACTGGCCGGGG + Intronic
962900448 3:139756849-139756871 CTGATATTGGGCAGAGGCAGTGG - Intergenic
962969620 3:140386782-140386804 CTGACACTGTGCACAGGCCTTGG - Intronic
964503717 3:157376041-157376063 CTGACACAGGCCTGGGGCAGAGG - Intronic
967143754 3:186587826-186587848 TGGACACAGGTCACAGGCAGTGG + Intronic
968356470 3:198111495-198111517 CTTGCACTGGGCACAGCCAGTGG + Intergenic
969625396 4:8302386-8302408 CTCCCTCAGGGGACAGGCAGAGG - Intronic
970561284 4:17284368-17284390 ATGGCACAGTGCACAGGCTGAGG - Intergenic
971140111 4:23915903-23915925 CTGATAGAAGGCACAGGGAGGGG - Intergenic
972688040 4:41369824-41369846 CTGAGAAAGCGCTCAGGCAGTGG - Intronic
977637912 4:99321991-99322013 CTGCCTCTTGGCACAGGCAGAGG - Intergenic
981475145 4:145180284-145180306 CTGACTCAGGACCCAGGCCGGGG + Intergenic
985450768 4:190060876-190060898 ATGACACAAGGCAGAGGCTGTGG + Intergenic
985755128 5:1709329-1709351 CTGAGCCATGACACAGGCAGAGG + Intergenic
985768866 5:1796592-1796614 CTGAGGCTGGGCACGGGCAGGGG - Intergenic
986416850 5:7537578-7537600 CTGACCCAGGGCAGAGGCAGAGG - Intronic
987376919 5:17244465-17244487 CTGAGACTGGGCACGGCCAGAGG + Intronic
988976772 5:36523875-36523897 CTGATCAAGGGCACAGGCAAGGG - Intergenic
992000577 5:72432347-72432369 CTGCCACAGTGCACAGCCAGGGG + Intergenic
992747547 5:79834436-79834458 CAGACAGAGGGATCAGGCAGGGG + Intergenic
993658084 5:90597026-90597048 TGGACACAGGACAGAGGCAGAGG + Intronic
995291306 5:110458461-110458483 CTGACACAAGGCATAGGCCCTGG + Intronic
996197485 5:120627029-120627051 CTCACCCAGGGTACAGGTAGTGG - Intronic
996317455 5:122176566-122176588 CTGACACTGGGGAGAGGAAGGGG - Intronic
996693627 5:126368309-126368331 CAGTCAAAGGGCTCAGGCAGTGG + Intronic
997510323 5:134449517-134449539 GGCCCACAGGGCACAGGCAGGGG - Intergenic
998611436 5:143693456-143693478 CAGAGACAGGGCACTGCCAGTGG + Intergenic
999277031 5:150338383-150338405 ATGGCACAGGGCTCAGCCAGAGG + Intronic
999300844 5:150489420-150489442 CTGACACAAGGCACAGGAACAGG - Intronic
999383729 5:151139842-151139864 CTGCCTCTGGGCAAAGGCAGCGG + Intronic
999708195 5:154293129-154293151 CTAACACAGGGATCAGCCAGAGG + Intronic
1001533524 5:172481899-172481921 CAGACAAAGGGCACAGGCTCCGG - Intergenic
1002294345 5:178221899-178221921 CTGACACATGGCATATTCAGTGG - Intronic
1003441632 6:6148238-6148260 CTGAGACAGGCCGGAGGCAGTGG + Intronic
1005278202 6:24242616-24242638 CTGTCACAGAGCACAGGTATAGG + Intronic
1006109794 6:31737609-31737631 AGGACAAAGGGCACAGGAAGGGG - Intronic
1007130768 6:39471385-39471407 CTGGCCCAGGGCACAGGGAATGG - Intronic
1007223284 6:40295422-40295444 GAGAGGCAGGGCACAGGCAGAGG + Intergenic
1007422635 6:41728781-41728803 GGGAGACAGGGCAGAGGCAGAGG + Intronic
1009980094 6:70717484-70717506 TTGGCACAGTGCACAGGGAGGGG + Intronic
1010502870 6:76622990-76623012 CTGACATAGGGTGGAGGCAGAGG - Intergenic
1013111964 6:107071201-107071223 CTCTCACAGGGCACCAGCAGTGG + Intronic
1016803310 6:148188483-148188505 TTACCACAGAGCACAGGCAGGGG - Intergenic
1017545965 6:155450813-155450835 GTGGCAGGGGGCACAGGCAGGGG + Intronic
1018573299 6:165233195-165233217 CAGACACAGGGCACAGGAAAGGG + Intergenic
1018805308 6:167254675-167254697 CAGACACATGACACAGGCAGAGG - Intergenic
1019493170 7:1324463-1324485 GGGCTACAGGGCACAGGCAGGGG + Intergenic
1019519985 7:1456292-1456314 CAGACACAGGCCAGACGCAGTGG + Intronic
1019929813 7:4215950-4215972 CTCACACAGGGAGCAAGCAGTGG + Intronic
1022282439 7:28924848-28924870 CTGGAAAAAGGCACAGGCAGGGG - Intergenic
1023017806 7:35984117-35984139 GAGGGACAGGGCACAGGCAGGGG - Intergenic
1023835221 7:44063920-44063942 CTGGCACTGGGGCCAGGCAGAGG - Intronic
1023873097 7:44273254-44273276 AGGACACAGTGAACAGGCAGGGG - Intronic
1025031350 7:55559761-55559783 CCAACCCAGGGCACATGCAGTGG + Intronic
1025257036 7:57391049-57391071 CTGACACAGGGTACAGGTTAAGG + Intergenic
1025635169 7:63315119-63315141 CAGTCACTGGGCACCGGCAGGGG - Intergenic
1025647526 7:63433051-63433073 CAGTCACTGGGCACCGGCAGGGG + Intergenic
1025854015 7:65262996-65263018 ATGACACAAGGCAGGGGCAGTGG - Intergenic
1025965280 7:66263975-66263997 CTGACACATGGAACAGGGAATGG - Intronic
1026098718 7:67367454-67367476 TTGACACAGGAGACAGGCAGGGG + Intergenic
1027246203 7:76369273-76369295 CTGAGCCTGGGGACAGGCAGGGG + Intergenic
1027723216 7:81770401-81770423 CTAAATCAAGGCACAGGCAGGGG + Intronic
1032405479 7:131652569-131652591 CTAAGACAAGGGACAGGCAGAGG - Intergenic
1032991623 7:137400686-137400708 CTGACAGAGGTGAGAGGCAGAGG + Intronic
1033534446 7:142298982-142299004 GTCACCCGGGGCACAGGCAGGGG - Intergenic
1034244356 7:149633444-149633466 CACACACAAGGCACAGACAGAGG - Intergenic
1035579138 8:729023-729045 CTGACAGAGGACACATCCAGGGG - Intronic
1035702443 8:1646953-1646975 AGGGCACAGGGCAGAGGCAGAGG + Intronic
1035702453 8:1647010-1647032 CAGACACAGGGCTCAGGCTTTGG + Intronic
1036647848 8:10623221-10623243 CTGTAACAGGGCAGAGGAAGAGG + Intronic
1036662230 8:10715839-10715861 CTGGCACAGAGAAAAGGCAGGGG - Intergenic
1037578815 8:20232520-20232542 CCAGCACAGTGCACAGGCAGAGG + Intergenic
1037838558 8:22228625-22228647 CTGACAGGTGGCAGAGGCAGTGG + Intronic
1037876072 8:22549168-22549190 CTGACAAAGGGCAGTGCCAGAGG + Intronic
1038416393 8:27399307-27399329 GTGACACTGGGGACAGGAAGAGG + Intronic
1039005449 8:33031556-33031578 TGGACACAGGGCACAGGGAGGGG + Intergenic
1043437586 8:80249489-80249511 CTGCAACATGGCACAGGCAATGG + Intergenic
1044926770 8:97215805-97215827 CTGACAGAGGGGGCTGGCAGGGG + Intergenic
1048221895 8:132549766-132549788 CTGACACAGGGGTCTGACAGGGG + Intergenic
1048872714 8:138812470-138812492 CTGAAACGGGGCAGAGGCTGAGG + Intronic
1049004830 8:139847934-139847956 CTGACACAGGGCACAGGCAGAGG - Intronic
1049186916 8:141260102-141260124 CTCAAGCAGGGCAGAGGCAGGGG + Intronic
1051371372 9:16362140-16362162 CTGACCCAGGGCCCTGGGAGAGG - Intergenic
1051529337 9:18082762-18082784 CTGAGAAAGGGAAGAGGCAGAGG + Intergenic
1053168627 9:35862396-35862418 CTGACACTGGACACAGGCGTGGG + Intergenic
1053169361 9:35867863-35867885 ATAACTCAGTGCACAGGCAGTGG - Intergenic
1053857766 9:42355931-42355953 CTGCCACTGGGCACAGGTAGTGG - Intergenic
1054567529 9:66774808-66774830 CTGCCACTGGGCACAGATAGTGG + Intergenic
1057928459 9:99172763-99172785 CTGATCCAGAGCTCAGGCAGGGG - Intergenic
1058403407 9:104642995-104643017 AGGACACAGGCCACAGGCACAGG + Intergenic
1059658061 9:116374447-116374469 CTGGGAAAGGGGACAGGCAGTGG - Intronic
1060879605 9:127108819-127108841 ATGGCACAGGGCACTGACAGTGG - Intronic
1061037326 9:128120979-128121001 CTAACACAGGGCACCTGCTGGGG - Exonic
1061185043 9:129048191-129048213 CTGCCACAGGGCACAGGGCCAGG - Intronic
1061370421 9:130194522-130194544 CCGACACAGGGCCCTGGGAGAGG - Intronic
1061747860 9:132753358-132753380 CTGCCACTGGGGCCAGGCAGAGG - Intronic
1062129580 9:134885319-134885341 ATGTCACAGAGCACAGTCAGGGG - Exonic
1062133547 9:134913041-134913063 ATGTCACAGAGCACAGTCAGGGG + Exonic
1062217529 9:135397357-135397379 CTGGCTCAGGGCACAGGCTTGGG - Intergenic
1062365254 9:136205229-136205251 CCGACACGGGGCAGAGGCGGGGG - Intergenic
1062410352 9:136421032-136421054 CTGTCTCAGGGCACAGGCAGGGG - Intronic
1189304243 X:39974584-39974606 CTGCCACATTGCTCAGGCAGGGG + Intergenic
1190801602 X:53794550-53794572 CTGAAACAGGACAGTGGCAGAGG + Intergenic
1191841945 X:65519458-65519480 CTGACCTGGGGCACTGGCAGTGG + Intronic
1191859828 X:65657083-65657105 CTGACCTGGGGCACTGGCAGTGG + Intronic
1193905775 X:87242872-87242894 CTGACACAGTGCAGACCCAGTGG - Intergenic
1196269265 X:113692121-113692143 TGGACACAGGACACAGGGAGGGG - Intergenic
1198033840 X:132781716-132781738 AGGAGACAGAGCACAGGCAGGGG + Intronic
1198107552 X:133475961-133475983 CCCACCCAGGGCACTGGCAGGGG - Intergenic
1198503270 X:137274984-137275006 CCTACACAGGGCACAGTCTGTGG + Intergenic
1199007430 X:142718279-142718301 CTGCCACAGGACACAGAAAGGGG - Intergenic
1199474733 X:148232616-148232638 CTGTCAGAGGTCACAGGCAATGG + Intergenic
1199540356 X:148952018-148952040 AGGACACACGGCACAGGAAGTGG + Intronic
1199778137 X:151033662-151033684 CTGACTCAGGGCCCAGGCTGAGG + Intergenic