ID: 1049004836

View in Genome Browser
Species Human (GRCh38)
Location 8:139847948-139847970
Sequence CTGTGTCAGCAGCAGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049004827_1049004836 -1 Left 1049004827 8:139847926-139847948 CCCTGCCGCCTCTGCCTGTGCCC 0: 1
1: 0
2: 17
3: 72
4: 653
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004823_1049004836 16 Left 1049004823 8:139847909-139847931 CCACCAAAGCCTCCGCTCCCTGC 0: 1
1: 1
2: 1
3: 38
4: 399
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004825_1049004836 7 Left 1049004825 8:139847918-139847940 CCTCCGCTCCCTGCCGCCTCTGC 0: 1
1: 1
2: 8
3: 281
4: 3177
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004830_1049004836 -9 Left 1049004830 8:139847934-139847956 CCTCTGCCTGTGCCCTGTGTCAG 0: 1
1: 0
2: 4
3: 44
4: 382
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004826_1049004836 4 Left 1049004826 8:139847921-139847943 CCGCTCCCTGCCGCCTCTGCCTG 0: 1
1: 1
2: 12
3: 249
4: 2801
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004824_1049004836 13 Left 1049004824 8:139847912-139847934 CCAAAGCCTCCGCTCCCTGCCGC 0: 1
1: 0
2: 3
3: 25
4: 362
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004828_1049004836 -2 Left 1049004828 8:139847927-139847949 CCTGCCGCCTCTGCCTGTGCCCT 0: 1
1: 0
2: 4
3: 114
4: 658
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004822_1049004836 19 Left 1049004822 8:139847906-139847928 CCACCACCAAAGCCTCCGCTCCC 0: 1
1: 1
2: 1
3: 40
4: 401
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data
1049004829_1049004836 -6 Left 1049004829 8:139847931-139847953 CCGCCTCTGCCTGTGCCCTGTGT 0: 1
1: 0
2: 4
3: 52
4: 615
Right 1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049004836 Original CRISPR CTGTGTCAGCAGCAGCCCTG GGG Intronic
No off target data available for this crispr