ID: 1049005658

View in Genome Browser
Species Human (GRCh38)
Location 8:139854021-139854043
Sequence GGCAAATGGTCTCACTGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049005651_1049005658 24 Left 1049005651 8:139853974-139853996 CCAAAATATTATTTAATTTTATG 0: 1
1: 2
2: 10
3: 202
4: 1645
Right 1049005658 8:139854021-139854043 GGCAAATGGTCTCACTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049005658 Original CRISPR GGCAAATGGTCTCACTGAAA GGG Intronic
No off target data available for this crispr