ID: 1049008266

View in Genome Browser
Species Human (GRCh38)
Location 8:139871462-139871484
Sequence CCCCAGCCCCGCGAGCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049008264_1049008266 -7 Left 1049008264 8:139871446-139871468 CCTGCTGGAGGGTCTGCCCCAGC No data
Right 1049008266 8:139871462-139871484 CCCCAGCCCCGCGAGCCAGAAGG No data
1049008260_1049008266 24 Left 1049008260 8:139871415-139871437 CCTGCAGGCATTTATACTGTGTC No data
Right 1049008266 8:139871462-139871484 CCCCAGCCCCGCGAGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049008266 Original CRISPR CCCCAGCCCCGCGAGCCAGA AGG Intronic