ID: 1049008266 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:139871462-139871484 |
Sequence | CCCCAGCCCCGCGAGCCAGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049008264_1049008266 | -7 | Left | 1049008264 | 8:139871446-139871468 | CCTGCTGGAGGGTCTGCCCCAGC | No data | ||
Right | 1049008266 | 8:139871462-139871484 | CCCCAGCCCCGCGAGCCAGAAGG | No data | ||||
1049008260_1049008266 | 24 | Left | 1049008260 | 8:139871415-139871437 | CCTGCAGGCATTTATACTGTGTC | No data | ||
Right | 1049008266 | 8:139871462-139871484 | CCCCAGCCCCGCGAGCCAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049008266 | Original CRISPR | CCCCAGCCCCGCGAGCCAGA AGG | Intronic | ||