ID: 1049010127

View in Genome Browser
Species Human (GRCh38)
Location 8:139881920-139881942
Sequence CATCAGAGGGAGGCCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 982
Summary {0: 1, 1: 0, 2: 3, 3: 81, 4: 897}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049010127_1049010136 4 Left 1049010127 8:139881920-139881942 CCTGCCTGGGCCTCCCTCTGATG 0: 1
1: 0
2: 3
3: 81
4: 897
Right 1049010136 8:139881947-139881969 CCCCACCATGCATGGATGCCAGG No data
1049010127_1049010139 8 Left 1049010127 8:139881920-139881942 CCTGCCTGGGCCTCCCTCTGATG 0: 1
1: 0
2: 3
3: 81
4: 897
Right 1049010139 8:139881951-139881973 ACCATGCATGGATGCCAGGAAGG No data
1049010127_1049010143 11 Left 1049010127 8:139881920-139881942 CCTGCCTGGGCCTCCCTCTGATG 0: 1
1: 0
2: 3
3: 81
4: 897
Right 1049010143 8:139881954-139881976 ATGCATGGATGCCAGGAAGGGGG No data
1049010127_1049010142 10 Left 1049010127 8:139881920-139881942 CCTGCCTGGGCCTCCCTCTGATG 0: 1
1: 0
2: 3
3: 81
4: 897
Right 1049010142 8:139881953-139881975 CATGCATGGATGCCAGGAAGGGG No data
1049010127_1049010134 -4 Left 1049010127 8:139881920-139881942 CCTGCCTGGGCCTCCCTCTGATG 0: 1
1: 0
2: 3
3: 81
4: 897
Right 1049010134 8:139881939-139881961 GATGGTGGCCCCACCATGCATGG No data
1049010127_1049010141 9 Left 1049010127 8:139881920-139881942 CCTGCCTGGGCCTCCCTCTGATG 0: 1
1: 0
2: 3
3: 81
4: 897
Right 1049010141 8:139881952-139881974 CCATGCATGGATGCCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049010127 Original CRISPR CATCAGAGGGAGGCCCAGGC AGG (reversed) Intronic
900190216 1:1349954-1349976 CACTAGAGGGCGGCCCAGGATGG + Intergenic
900558090 1:3290004-3290026 CAGCAGGGGCAGCCCCAGGCAGG - Intronic
900680491 1:3913576-3913598 CCTCCCAGGGACGCCCAGGCAGG + Intergenic
900875128 1:5337045-5337067 CAACAGACGGAGGCGGAGGCAGG + Intergenic
900928954 1:5724171-5724193 AAAAAGAGGGAGGCCAAGGCAGG - Intergenic
900972243 1:5998128-5998150 TCACAGAGGGAGGACCAGGCAGG + Intronic
901137882 1:7009435-7009457 CAGCACAGAGAGGCCCAGGCAGG - Intronic
901251480 1:7783630-7783652 CATTAGAGGGAGGGAGAGGCGGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901420179 1:9145362-9145384 CAGCAGAGAGAGGAACAGGCAGG + Intergenic
901441040 1:9278693-9278715 CATCCTAGGGAGGCCCTGGCTGG + Intergenic
901469734 1:9448038-9448060 CATTTTTGGGAGGCCCAGGCGGG + Intergenic
901470927 1:9455996-9456018 CAGCAGGGGGACACCCAGGCTGG - Intergenic
901627247 1:10631296-10631318 CAGCAGAGGGAGGGGCAGGGCGG - Intergenic
901810818 1:11766025-11766047 CTTCAGAGCTAGGCCCAGGCGGG - Exonic
901830443 1:11888910-11888932 CAGCAGGAGGAGGCCCAGGAAGG - Intergenic
901916867 1:12506781-12506803 CATCAGGGGGAGGCCCACTGCGG - Intronic
902450576 1:16494361-16494383 CAACACTGGGAGGCCAAGGCAGG + Intergenic
902735630 1:18398978-18399000 CACCAGATGGATGCCCTGGCTGG + Intergenic
902738037 1:18414161-18414183 CTTCAGGGAGAGGTCCAGGCTGG - Intergenic
902762810 1:18594889-18594911 CAACATTGGGAGGCCAAGGCGGG + Intergenic
902775128 1:18669837-18669859 CTTAATAGGGAGGCCAAGGCAGG + Intronic
902877725 1:19350862-19350884 CAACACTGGGAGGCCAAGGCAGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903514569 1:23901945-23901967 GATCAGGGGGAAGTCCAGGCGGG + Intronic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903883489 1:26528389-26528411 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904369624 1:30040198-30040220 AAGCAGAGGGAGGCCCTGACAGG + Intergenic
904689127 1:32280699-32280721 CAACACTGGGAGGCCGAGGCAGG - Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905165271 1:36077975-36077997 CAACACTGGGAGGCCGAGGCGGG + Intergenic
905189418 1:36222144-36222166 CAACACTGGGAGGCCAAGGCGGG - Intergenic
905318899 1:37101667-37101689 CTTCACAGGGAGGCAGAGGCAGG - Intergenic
905449213 1:38046370-38046392 CACCAGGGGGCGGCCCACGCGGG - Exonic
905664946 1:39757742-39757764 CTGCAGTGGGTGGCCCAGGCTGG - Exonic
905873982 1:41420546-41420568 CCTCAGAGGGAAGGCCAGGCTGG + Intergenic
906317370 1:44796816-44796838 CAGCACTGGGAGGCCGAGGCCGG - Intergenic
906367704 1:45224480-45224502 AATCCCAGGGAGGCCAAGGCAGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908026950 1:59962332-59962354 CAGCAAAGGGAAGCCCAGGATGG + Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908603794 1:65771169-65771191 CAGCAGAGGGAGGCTTAGTCTGG - Intergenic
909101722 1:71357383-71357405 CACCAGAGGGAGACCCAGTTAGG - Intergenic
909626052 1:77717111-77717133 CAGCACTGGGAGGCCAAGGCAGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909986674 1:82169664-82169686 CAACACTGGGAGGCCAAGGCAGG - Intergenic
910404961 1:86878431-86878453 CAGCATTGGGAGGCCAAGGCAGG + Intronic
910596324 1:88984456-88984478 CAACACTGGGAGGCCGAGGCAGG - Intronic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910828243 1:91432124-91432146 CAACACTGGGAGGCCAAGGCAGG + Intergenic
911722604 1:101207746-101207768 CATTTGGGGGAGGCCCAGGCAGG - Intergenic
911973898 1:104467416-104467438 CATCAGAAGGAAGCCTAGACAGG - Intergenic
912343041 1:108936341-108936363 CAGCACTGGGAGGCCGAGGCAGG - Intronic
912527629 1:110295817-110295839 CATTAGTGGGAGGCTGAGGCAGG - Intergenic
912680909 1:111728238-111728260 CATTTCAGGGAGGCCCAGGGAGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912950680 1:114118374-114118396 AAACAGAGTGAGGCTCAGGCTGG + Intronic
912980620 1:114368382-114368404 CATCAGAAGGAAGCCTAGACAGG - Intergenic
913291840 1:117280744-117280766 TTTCAGAGGGAGGCTGAGGCAGG + Intergenic
913579235 1:120209663-120209685 GATCATTGGGAGGCCGAGGCGGG - Intergenic
913628937 1:120688725-120688747 GATCATTGGGAGGCCGAGGCGGG + Intergenic
914407386 1:147389633-147389655 CATCTGAGGGAGGCTCAGTTGGG + Intergenic
914561166 1:148821095-148821117 GATCATTGGGAGGCCGAGGCGGG - Intronic
914611668 1:149309113-149309135 GATCATTGGGAGGCCGAGGCGGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915175670 1:154012755-154012777 CAGCACTGGGAGGCCGAGGCGGG + Intronic
915198780 1:154210723-154210745 CAACACTGGGAGGCCGAGGCAGG - Intronic
915300458 1:154948435-154948457 AATCAGAGGAAGGCACAGGGAGG + Intronic
915576658 1:156783497-156783519 CAACACTGGGAGGCCCAGGCGGG + Intronic
916413372 1:164569805-164569827 CAGCACTGGGAGGCCGAGGCAGG - Intronic
916730300 1:167560504-167560526 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
916766379 1:167864402-167864424 CATCAGAAGGAAGCCTAGACAGG + Intronic
917101001 1:171445258-171445280 TATCAGACGGAGGCCGAGGCAGG + Intergenic
917115780 1:171601648-171601670 CATCAGAAGGAAGCCTAGACAGG + Intergenic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
917844176 1:179006585-179006607 CCTCAGAAGCAGGACCAGGCCGG + Intergenic
917848860 1:179043150-179043172 CATGGGAGGGAGGCCAAGGGAGG - Intronic
918115245 1:181490504-181490526 CTTCAGAGAGAGGCCCTGCCTGG + Intronic
918394715 1:184101798-184101820 CCTGAGAGAGAGGTCCAGGCAGG - Intergenic
918709475 1:187708754-187708776 CAACTTAGGGAGGCCGAGGCAGG - Intergenic
919059524 1:192613955-192613977 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
919528203 1:198680205-198680227 CAACATTGGGAGGCCGAGGCAGG + Intronic
919781849 1:201226134-201226156 CCTGAGAGGGAGGAGCAGGCAGG + Intronic
919824039 1:201491182-201491204 CAGCAGTGGGAAGCCAAGGCTGG + Intronic
919897841 1:202020332-202020354 CAACAAGGGGAGGCCGAGGCAGG + Intergenic
920259803 1:204681201-204681223 AATCCTAGGGAGGCCAAGGCGGG - Intronic
920262922 1:204701991-204702013 TGGCAGAGGGATGCCCAGGCTGG + Intergenic
920379444 1:205527230-205527252 CAGCACTGGGAGGCCAAGGCAGG + Intronic
920435760 1:205946021-205946043 CATTGGTGGGAGGCCCAGGAAGG + Intergenic
920495352 1:206450863-206450885 CAGCACTGGGAGGCCCAGGCGGG + Intronic
920601586 1:207329964-207329986 CATCAGAAAGATTCCCAGGCTGG + Intronic
921498506 1:215870539-215870561 CAGCAGTGGGAGGCCGAGGTGGG - Intronic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
921706764 1:218330958-218330980 AATCAGAAGAAGGCCCAGGTTGG + Exonic
921747492 1:218754231-218754253 CATCAGAAGGAAGCCTAGACAGG - Intergenic
921848077 1:219905172-219905194 CTGCAGAGGGAGGCAGAGGCAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922790494 1:228308376-228308398 CGTCAGAGGTAGCCACAGGCGGG + Exonic
923101535 1:230821534-230821556 CAGGAGAGGAGGGCCCAGGCCGG + Intergenic
923119669 1:230978622-230978644 CAGCAGCAGGAGGCCCCGGCGGG - Exonic
923351352 1:233109866-233109888 GATCTTTGGGAGGCCCAGGCGGG + Intronic
924385186 1:243493179-243493201 CTTGAGAGGCAGGCCCTGGCTGG + Intronic
1062926247 10:1317721-1317743 CATCAGCAGGGGGCACAGGCAGG + Intronic
1062947625 10:1473400-1473422 CAACAGAGTGAGGCCCTGTCAGG - Intronic
1063081656 10:2773111-2773133 CAGCAGAGCGTGGCCCGGGCCGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063132361 10:3189191-3189213 CAACAGAGAGAGGCCCTGTCAGG - Intergenic
1063186770 10:3658919-3658941 CTACAGAGGAAGGCCCAGCCAGG - Intergenic
1064049257 10:12046042-12046064 CAACACTGGGAGGCCAAGGCGGG + Intergenic
1064082952 10:12323243-12323265 CATCAGATGGGGCCACAGGCTGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064264241 10:13812125-13812147 CAACACTGGGAGGCCGAGGCAGG - Intronic
1064589205 10:16871286-16871308 CAGCACAGGGAGGCTGAGGCAGG - Intronic
1065600131 10:27359458-27359480 CCTGAGAGGGAGGCCAAGGCGGG + Intergenic
1065607780 10:27437025-27437047 CAACACTGGGAGGCCAAGGCGGG + Intergenic
1065746542 10:28847677-28847699 CAACAGAGCAAGGCTCAGGCTGG + Intronic
1065808687 10:29420898-29420920 CATCAGGGCATGGCCCAGGCAGG - Intergenic
1066682464 10:37947368-37947390 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1067105046 10:43361033-43361055 CAGCACTGGGAGGCCTAGGCAGG - Intergenic
1067219887 10:44336441-44336463 ACACAGAGGGAGGCCCAGACGGG + Intergenic
1067539397 10:47140820-47140842 GAGCAGAGGGAGCCCCAGCCTGG + Intergenic
1068016323 10:51521040-51521062 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1068196165 10:53719593-53719615 CATCAAAGGGACCCCTAGGCAGG - Intergenic
1068890389 10:62142582-62142604 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1068985100 10:63100956-63100978 CAACACTGGGAGGCCAAGGCCGG + Intergenic
1069002637 10:63282960-63282982 CAACTTTGGGAGGCCCAGGCAGG - Intronic
1069291015 10:66779607-66779629 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1069489691 10:68850723-68850745 CAGCACTGGGAGGCCAAGGCAGG + Intronic
1069938995 10:71940590-71940612 CATCAGAAGGAAGCCTAGACAGG + Intergenic
1070002535 10:72391183-72391205 CAACACTGGGAGGCCAAGGCGGG + Intronic
1070167155 10:73907443-73907465 CTGCAGAGTGAGGCACAGGCTGG + Intergenic
1070783493 10:79150379-79150401 CACCACGGGGAGGCCCAGGGAGG - Intronic
1071599354 10:86949953-86949975 CAACACTGGGAGGCCGAGGCAGG + Intronic
1072081029 10:92032258-92032280 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1072110430 10:92314393-92314415 CAACACTGGGAGGCCAAGGCAGG + Intronic
1072110682 10:92317215-92317237 AATCCCAGGGAGGCCGAGGCAGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072832649 10:98675457-98675479 CACAGGAGGGAGGCCAAGGCGGG + Intronic
1072868888 10:99095072-99095094 CATCTTAGGGAGGCTGAGGCAGG + Intronic
1072973112 10:100034481-100034503 TACCAGAGGGAGGCCGAGGGGGG + Intergenic
1073021479 10:100448344-100448366 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1073157380 10:101358349-101358371 CAACAATGGGAGGCCAAGGCAGG - Intronic
1073462738 10:103676101-103676123 CATCAGACTTAAGCCCAGGCAGG + Intronic
1073759814 10:106617199-106617221 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1074490389 10:113934579-113934601 CATGTGTGGGAGGCCAAGGCGGG + Intergenic
1074536144 10:114329775-114329797 AATGTCAGGGAGGCCCAGGCTGG + Intronic
1075545634 10:123352325-123352347 GGCCAGAGGGAGGCCCAGGCAGG - Intergenic
1075798305 10:125136223-125136245 GCTGGGAGGGAGGCCCAGGCTGG + Intronic
1075878853 10:125832284-125832306 CAACACTGGGAGGCCGAGGCAGG - Intronic
1076684854 10:132193959-132193981 CTTCAGGGGGCGGCCCAAGCCGG + Intronic
1076690982 10:132223779-132223801 AGTCAGAGCCAGGCCCAGGCAGG - Intronic
1076713283 10:132350762-132350784 TTTCAGAGGGAAGACCAGGCAGG + Intronic
1076821754 10:132943152-132943174 CAGCAGGGGGTGGCCGAGGCGGG + Intergenic
1077066365 11:642712-642734 TCTCAGAGGAAGGGCCAGGCGGG + Intergenic
1077066374 11:642740-642762 GGTCAGAGGAAGGGCCAGGCGGG + Intergenic
1077081152 11:725262-725284 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1077103867 11:833524-833546 TATCAGGGGGAGCCCCAGTCAGG - Intronic
1077592804 11:3505677-3505699 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1078116041 11:8451954-8451976 CAACACTGGGAGGCCAAGGCAGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078198054 11:9153073-9153095 CAACACTGGGAGGCCAAGGCGGG + Intronic
1078481614 11:11681174-11681196 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1078534476 11:12162171-12162193 GATGAGAAGCAGGCCCAGGCGGG + Exonic
1078642485 11:13109351-13109373 GATCTGAGTGGGGCCCAGGCAGG + Intergenic
1079213643 11:18486308-18486330 TGGCTGAGGGAGGCCCAGGCAGG + Intronic
1079869189 11:25775073-25775095 CATTAGAGGGAGGCCCACACTGG - Intergenic
1080013331 11:27479740-27479762 CAACCTTGGGAGGCCCAGGCTGG + Intergenic
1080096476 11:28414361-28414383 TAACAGAGGGAGGCACTGGCAGG - Intergenic
1080550433 11:33369731-33369753 CAGCACTGGGAGGCCCAGGTGGG - Intergenic
1080565304 11:33504011-33504033 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1080883123 11:36341154-36341176 CAGCACAGGGAGGCTCAGGAAGG - Intronic
1081620942 11:44618894-44618916 CAGCAGAGGGAGGCCCAGAGCGG - Intronic
1081972405 11:47208706-47208728 AATCCCAGGGAGGCCGAGGCAGG - Intergenic
1082016490 11:47492481-47492503 CAACTGTGGGAGGCCGAGGCAGG + Intronic
1082020231 11:47526771-47526793 CATCAAAAGGAGTTCCAGGCCGG + Intronic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083171955 11:60928507-60928529 CATGAAAGGGAGGCCCAGCATGG - Intronic
1083271132 11:61573166-61573188 CATCAGGGCCAGGCCCAGGAGGG - Intronic
1083364369 11:62132605-62132627 CTGTAGAGGGAGGGCCAGGCAGG + Intronic
1083633718 11:64109066-64109088 CATCTCAGGCAGGGCCAGGCGGG - Intronic
1083693460 11:64426289-64426311 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1083711122 11:64549204-64549226 GATGAAAGGGAGGCCGAGGCGGG - Intergenic
1083916031 11:65744300-65744322 CATGGGAGGGAGGCCAAGGCGGG + Intergenic
1084099652 11:66938020-66938042 AAATAGAGGGAGGCCAAGGCAGG - Intronic
1084284394 11:68121775-68121797 CATCAGAGGCCGGGCCTGGCAGG + Intergenic
1084598218 11:70129867-70129889 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1084824192 11:71717066-71717088 CAACACTGGGAGGCCAAGGCAGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085496827 11:76978041-76978063 CATGGGAGGGAGGCCGAGGCGGG + Intronic
1085511665 11:77091316-77091338 CAGCAGAGGGTGGCAGAGGCAGG - Intronic
1085528237 11:77176318-77176340 CAGCTGTGGGAGGCACAGGCAGG - Intronic
1085584962 11:77693549-77693571 CATCAGAGGAGGGCGAAGGCAGG + Exonic
1085601245 11:77858046-77858068 CCTCACAGGGTGACCCAGGCTGG + Intronic
1085726818 11:78961830-78961852 CATCAGGTGAAGGCCCAGACAGG - Intronic
1086572573 11:88302375-88302397 CAGCATTGGGAGGCCGAGGCGGG + Intronic
1086728775 11:90222748-90222770 CAGCCAAGGGAGGCCCAGGAGGG + Intronic
1087067966 11:94045152-94045174 CAGCAATGGGAGGCCAAGGCAGG - Intronic
1087128657 11:94650669-94650691 CACCAGAGAGTGGCCCTGGCTGG - Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087927962 11:103942071-103942093 CATAAGCAGAAGGCCCAGGCAGG + Intronic
1088113258 11:106286287-106286309 AATCAGAGAGAGGCACAGACTGG + Intergenic
1088652371 11:111969179-111969201 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1088796057 11:113267745-113267767 CATCCAGGGGAGGGCCAGGCAGG - Intronic
1089202609 11:116733506-116733528 GAGAAGAGGGAGCCCCAGGCTGG + Intergenic
1089517126 11:119040236-119040258 CAACACTGGGAGGCACAGGCAGG + Intergenic
1089519723 11:119055887-119055909 GATTAGAGGGAGTCCCAGGAAGG - Intronic
1089855988 11:121545193-121545215 CATTAGAGGCAGGCCCATGTAGG - Intronic
1090081006 11:123612704-123612726 CAGCAGAGGCAGGCCCACCCAGG + Intronic
1090816453 11:130301161-130301183 AAACAGGCGGAGGCCCAGGCTGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090937508 11:131357196-131357218 AGACAGAGGGAGGCCGAGGCAGG - Intergenic
1091014766 11:132040034-132040056 CTCCAGAGGGAGGCTGAGGCAGG - Intronic
1091251351 11:134146809-134146831 CACCTGGGGGAGGCCGAGGCAGG - Intronic
1091702102 12:2670286-2670308 CAACAGAAGGAGCCCCGGGCAGG + Intronic
1091912868 12:4245811-4245833 CAGCAAAGAGAGGCCGAGGCTGG - Intergenic
1091950142 12:4585965-4585987 CAACACTGGGAGGCCAAGGCAGG + Intronic
1092418912 12:8313806-8313828 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092505742 12:9097877-9097899 CAACACTGGGAGGCCAAGGCAGG - Intronic
1092777928 12:11960294-11960316 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095260646 12:40094930-40094952 CATCTGTGCAAGGCCCAGGCAGG + Intronic
1095314254 12:40740570-40740592 CTGAAGAGGGAGGCCAAGGCTGG - Intronic
1096646253 12:53038385-53038407 CATCTGAGGAAGGACCAGGAAGG + Exonic
1096700693 12:53380665-53380687 GACCAGAGGGCGGACCAGGCAGG - Intronic
1097006052 12:55918619-55918641 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1097188469 12:57208366-57208388 CAGCATGGGGAGGGCCAGGCAGG - Intronic
1097188532 12:57208647-57208669 CAGAGGAGGCAGGCCCAGGCAGG - Intronic
1097238723 12:57558425-57558447 CAGCATTGGGAGGCCAAGGCGGG + Intronic
1097320292 12:58218422-58218444 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1098272315 12:68780731-68780753 CAACACTGGGAGGCCGAGGCGGG - Exonic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098822669 12:75252620-75252642 CAGGAGTGGGAGGCCGAGGCAGG + Intergenic
1099049573 12:77766998-77767020 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1099210040 12:79773253-79773275 CATGGTTGGGAGGCCCAGGCGGG - Intergenic
1099216398 12:79859087-79859109 CAACAGTGGGAGGCCAAGGCGGG + Intronic
1099252398 12:80272542-80272564 CAGAAGAGGGAGGGCCAGGGAGG - Intronic
1099460035 12:82910697-82910719 AATCAGAGGAGAGCCCAGGCTGG - Intronic
1101016645 12:100508031-100508053 GAACAGAGGGAGGCCCAGGTAGG + Intronic
1101090872 12:101283794-101283816 CAACAGTGGGAGGCTGAGGCAGG - Intronic
1101146409 12:101844869-101844891 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1101230186 12:102732758-102732780 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1101874849 12:108591413-108591435 CACCACAGGGAGGCCAAGGAGGG + Exonic
1102109716 12:110355829-110355851 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1102275778 12:111580890-111580912 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1102673366 12:114638798-114638820 CAGCATTGGGAGGCCGAGGCGGG - Intergenic
1102787577 12:115617150-115617172 GAACTTAGGGAGGCCCAGGCGGG - Intergenic
1102991464 12:117319297-117319319 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1103359944 12:120347601-120347623 CCTCTGAGGTAGGGCCAGGCTGG - Intronic
1103488802 12:121300469-121300491 CATCAGAGAGAGGAGCGGGCAGG - Intergenic
1103509451 12:121464652-121464674 CGTCGGAGGGAGGCCCTGGTGGG - Intronic
1103547970 12:121715045-121715067 CTTCAGAGTGAGGCCCAGCGCGG + Intronic
1103561535 12:121795510-121795532 CATGAGAGGGGAGGCCAGGCAGG + Intronic
1103635561 12:122302346-122302368 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1103635752 12:122303840-122303862 AATCAGGGGGAGGACAAGGCAGG - Intronic
1104004144 12:124880329-124880351 CAACACTGGGAGGCCGAGGCAGG + Intronic
1104026666 12:125032519-125032541 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1104036194 12:125098697-125098719 CAACACCGGGAGGCCAAGGCGGG - Intronic
1104365343 12:128171555-128171577 CATCTGAGGGAAGGCAAGGCAGG + Intergenic
1104466753 12:128996765-128996787 TATGAGAAGGTGGCCCAGGCTGG + Intergenic
1104862482 12:131930907-131930929 CAACACAGGAAGGCCGAGGCAGG - Intronic
1104890807 12:132139267-132139289 AAGCAGAGGGCGGCCTAGGCTGG - Exonic
1106216500 13:27706585-27706607 CATAAGAGGGAGGCAGAGCCAGG - Intergenic
1106743516 13:32674059-32674081 CAACATTGGGAGGCCGAGGCAGG - Intronic
1107152934 13:37132840-37132862 CATCACTGGGAGGTCCAGGTGGG - Intergenic
1107368386 13:39712104-39712126 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1107650161 13:42536724-42536746 TATCAGATGGAGGCCCTGACAGG + Intergenic
1107809682 13:44188431-44188453 CAAGAGAGGCAGGGCCAGGCAGG - Intergenic
1108623823 13:52208746-52208768 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1108662894 13:52602271-52602293 CAACACTGGGAGGCCGAGGCAGG + Intergenic
1108699734 13:52933546-52933568 CATCTGCAGGAGGCCAAGGCTGG + Intergenic
1109888527 13:68575646-68575668 CATCAGAGAGAGAGACAGGCAGG + Intergenic
1109982256 13:69924116-69924138 CATGGGAGGGAGGCCAAGGAGGG + Intronic
1110342892 13:74413708-74413730 CATGGGAGGGAGGCTGAGGCAGG + Intergenic
1110520666 13:76472380-76472402 CTTCAGGAGGAGGCCGAGGCAGG - Intergenic
1110777953 13:79432320-79432342 CATGGGAGGGAGGCCAAGGAGGG + Intergenic
1110959694 13:81606273-81606295 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1111485658 13:88895707-88895729 CATGGGAGGGAGGCCAAGGCAGG + Intergenic
1112000797 13:95207977-95207999 TATCAGCGGCAGGCACAGGCAGG + Intronic
1112235237 13:97630058-97630080 CATCTGCGGGAGTTCCAGGCAGG + Intergenic
1112308306 13:98295312-98295334 CAGCAGAGGGAGCCCTGGGCAGG + Intronic
1112322267 13:98418519-98418541 CAACACTGGGAGGCCAAGGCGGG - Intronic
1112432539 13:99363494-99363516 CAGCAGTGGGCAGCCCAGGCCGG + Intronic
1112435422 13:99388532-99388554 CAGGAGAGGGCAGCCCAGGCTGG + Intergenic
1112468664 13:99668336-99668358 CAGCACTGGGAGGCCAAGGCAGG + Intronic
1112650664 13:101393568-101393590 CATAAGTGGGAGGCCGAGGCGGG + Intronic
1113529001 13:111006225-111006247 CATTAGACGGCTGCCCAGGCTGG + Intergenic
1113839386 13:113350148-113350170 CACCAGCGACAGGCCCAGGCAGG + Intronic
1114191794 14:20445047-20445069 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114306244 14:21425685-21425707 GACCAGTGGGAGGCCAAGGCAGG + Intronic
1114308163 14:21442218-21442240 CATCACTGGGAGGCGGAGGCAGG + Intronic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114465026 14:22915740-22915762 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1115478880 14:33842410-33842432 CATCATAGCTAGGACCAGGCAGG + Intergenic
1115549991 14:34496242-34496264 CAGCAGTAGGAGGCCAAGGCAGG + Intergenic
1115672843 14:35634923-35634945 GATTACAGGGAGGCCCAGCCAGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116902214 14:50372010-50372032 CATAGGAGGGAGGCCAAGGGAGG + Intronic
1116987758 14:51239408-51239430 CAAAACAGGGAGGCCAAGGCAGG - Intergenic
1117334915 14:54748948-54748970 CCTGAGAGGGTGCCCCAGGCAGG + Intronic
1117392920 14:55279739-55279761 CTCCAGAGGTAGGCCCAGGCTGG - Intronic
1117551647 14:56843108-56843130 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1118072796 14:62264296-62264318 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1118116474 14:62782562-62782584 AACCAAAGGGAGGCCAAGGCAGG + Intronic
1118598352 14:67453405-67453427 CAGGACAGGGAGCCCCAGGCAGG - Intronic
1118619360 14:67600485-67600507 CAGCACTGGGAGGCCAAGGCGGG + Intergenic
1119420629 14:74505908-74505930 CAGCATAGGGAGGTGCAGGCGGG - Intronic
1119513426 14:75229471-75229493 GTTCAGAGGGAGGATCAGGCAGG + Intergenic
1119706585 14:76786695-76786717 CAACAGAGGTAGGCCTAGGAAGG + Intergenic
1121243967 14:92449605-92449627 AACCGCAGGGAGGCCCAGGCTGG - Intronic
1121871065 14:97407950-97407972 AATCAGAGGGAGGCAGAGGTGGG - Intergenic
1122029474 14:98901911-98901933 CACCACAGGGAGGCCCAGGAAGG + Intergenic
1122138854 14:99650269-99650291 CCTCACAGGGAGGACCAGGCTGG - Intronic
1122169950 14:99864563-99864585 CAACACTGGGAGGCCGAGGCAGG + Intronic
1122372176 14:101234809-101234831 CTTCTGAGGAAGGCCCAGCCTGG + Intergenic
1122541471 14:102499952-102499974 CAGCAGAGGCAGCCCCAGGCCGG + Exonic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122599897 14:102915957-102915979 ACTCAGAGGGAAGCCCAGGAGGG - Intergenic
1122708929 14:103641169-103641191 CAACACTGGGAGGCCGAGGCAGG - Intronic
1122773464 14:104107135-104107157 CCCCTGAGGGAGACCCAGGCGGG - Intronic
1122956633 14:105074404-105074426 CAGCAGTGGGAGGCCAAGGTTGG + Intergenic
1122978185 14:105179587-105179609 CAGCAGGTGCAGGCCCAGGCAGG - Intronic
1123002934 14:105306007-105306029 CAGCAGAGCGGGGCCCAGGCTGG + Exonic
1123986584 15:25651700-25651722 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1124126571 15:26942798-26942820 CAGTAGAGGAAGGCGCAGGCTGG + Intronic
1124251683 15:28110318-28110340 CAGCAGAGGCCGGCCCAGCCAGG + Intergenic
1124967731 15:34449547-34449569 AAGCTGAGGGAGGCCGAGGCGGG + Intergenic
1125149950 15:36520136-36520158 CATCAGCAGGAGGCTGAGGCAGG + Intergenic
1125537659 15:40451677-40451699 CAGCAGAGGGAGACCCATGTGGG - Intronic
1125702495 15:41699744-41699766 CATAATTGGGAGGCCGAGGCGGG - Intronic
1125799112 15:42429009-42429031 CATGTAAGGGAGGCCGAGGCGGG - Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1125997600 15:44178744-44178766 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1126022873 15:44419430-44419452 CAACACTGGGAGGCCAAGGCAGG + Intergenic
1126141781 15:45445139-45445161 AATCAGAAGGAAGCCGAGGCGGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126990891 15:54374386-54374408 CATGAGAGGGAGGCCGGGGTGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127666601 15:61153836-61153858 AATGACATGGAGGCCCAGGCCGG + Intronic
1128115820 15:65104627-65104649 CAGCACTGGGAGGCCGAGGCCGG + Intronic
1128238063 15:66080864-66080886 CGGCAGAAGGCGGCCCAGGCGGG + Intronic
1129314376 15:74732317-74732339 AATCCCAGGGAGGCCAAGGCAGG - Intergenic
1129355418 15:74987615-74987637 CACCAGGGCCAGGCCCAGGCTGG + Intronic
1129432611 15:75511490-75511512 CAACACTGGGAGGCCAAGGCAGG - Intronic
1129818132 15:78574132-78574154 CCTCAGGGGGAGGCCAAGGCGGG + Intronic
1130009570 15:80140059-80140081 CATCACTTGGAGGCCGAGGCGGG + Intergenic
1130893138 15:88150227-88150249 TCTCAGAGGGAGGAGCAGGCAGG + Intronic
1131379020 15:91948619-91948641 CACCAGAGAGTGGCCCATGCAGG - Intronic
1132063977 15:98715326-98715348 CTTCTGAAGGAGGCCCAGGATGG - Intronic
1132202741 15:99966036-99966058 CAATTGAGGGAGGCCGAGGCGGG - Intergenic
1132525085 16:410491-410513 CGTCAGGGGGAGGCCCCCGCTGG - Intronic
1132574516 16:658368-658390 CAGCACAGGGAGGGCCAGGTCGG - Intronic
1132682706 16:1149835-1149857 CGTCAGAGAGAAGCCCAGGACGG - Intergenic
1132884639 16:2177252-2177274 CCTCAGAGGGCGGCACAGGCTGG - Exonic
1132980672 16:2737387-2737409 AGTTAGAGGGAGGCCCAGGATGG - Intergenic
1133262229 16:4558365-4558387 CAACACTGGGAGGCCAAGGCGGG + Intronic
1133359999 16:5166662-5166684 CTGCAGAAGGAGGCCCAGGGAGG + Intergenic
1133472128 16:6085515-6085537 CAACACCGGGAGGCCGAGGCGGG - Intronic
1133592940 16:7263647-7263669 CAGCACAGAGAGGCCGAGGCAGG + Intronic
1133678385 16:8097348-8097370 GATCATTGGGAGGCCGAGGCAGG - Intergenic
1133805257 16:9121805-9121827 CAGCACTGGGAGGCCAAGGCGGG + Intergenic
1134375975 16:13673619-13673641 CATCAGAGTGAGACCCTGTCAGG + Intergenic
1134493502 16:14713223-14713245 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134498883 16:14752347-14752369 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134525435 16:14938968-14938990 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134546970 16:15117410-15117432 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134547455 16:15121894-15121916 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134643832 16:15850646-15850668 CAACACTGGGAGGCCAAGGCAGG + Intronic
1134713020 16:16337454-16337476 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1134720889 16:16380814-16380836 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134946538 16:18331071-18331093 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134953799 16:18371218-18371240 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1135188945 16:20338736-20338758 CATAGCAGGGAGGCCGAGGCAGG - Intronic
1135273352 16:21087649-21087671 TATGAGAGGGAGGCTGAGGCAGG + Intronic
1136151776 16:28355898-28355920 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1136194966 16:28645273-28645295 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136211305 16:28759385-28759407 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136238932 16:28932548-28932570 TCTCAGAGGGGGGCCCCGGCTGG - Exonic
1136256026 16:29039335-29039357 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136460413 16:30407253-30407275 CGCCAGGGAGAGGCCCAGGCCGG + Intergenic
1136522321 16:30805216-30805238 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136687520 16:32003914-32003936 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1136788133 16:32947465-32947487 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1136881652 16:33906324-33906346 CACCAGAGGCAGGCTCAGGAGGG - Intergenic
1137590468 16:49690282-49690304 AATCACTGGGAGGCCGAGGCAGG + Intronic
1137693651 16:50447014-50447036 GGGCAGAGGGAGGCCCAGGGAGG - Intergenic
1138091977 16:54182250-54182272 CAACACTGGGAGGCCAAGGCGGG - Intergenic
1138412230 16:56849728-56849750 CAGCAGAGGCAAGCCCAGGTAGG - Intronic
1139212489 16:65093182-65093204 CAACACTGGGAGGCCAAGGCAGG - Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139583718 16:67887826-67887848 CAACACTGGGAGGCCGAGGCGGG - Intronic
1139676127 16:68525022-68525044 CATAAGAGAGTAGCCCAGGCCGG + Intergenic
1139811717 16:69624451-69624473 CAACACTGGGAGGCCGAGGCGGG - Intronic
1139856995 16:69989319-69989341 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139953309 16:70682036-70682058 CCTCAGAGGGAGGCTCTGCCTGG + Intronic
1140167927 16:72573390-72573412 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1140206846 16:72940156-72940178 CAACACAGGGAGGCTGAGGCAGG - Intronic
1140365716 16:74378656-74378678 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1140497193 16:75399623-75399645 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1141569714 16:84927200-84927222 TTTGAGAGGGAGGCCGAGGCAGG + Intergenic
1141765107 16:86052976-86052998 GGGCAGAGGGAGGGCCAGGCTGG + Intergenic
1141957950 16:87384651-87384673 CATCTCTTGGAGGCCCAGGCGGG + Intronic
1142022525 16:87792819-87792841 CAGCATTGGGAGGCCTAGGCAGG - Intergenic
1142301335 16:89260154-89260176 CAACAGTGGCAGGCCGAGGCGGG + Intergenic
1142377700 16:89714977-89714999 AATGGGAGGGAGGCCAAGGCAGG - Intronic
1142384839 16:89757206-89757228 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1142414383 16:89933616-89933638 CATCACAGGCAAGCCCAGGTCGG + Intronic
1203090358 16_KI270728v1_random:1209122-1209144 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1142570815 17:872865-872887 CAACACTGGGAGGCCAAGGCGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143024126 17:3930892-3930914 CATCCCAGGGAGGCGGAGGCGGG + Intronic
1143133501 17:4696079-4696101 CAACACTGGGAGGCCAAGGCAGG + Intronic
1143188691 17:5025567-5025589 CAGCACTGGGAGGCCGAGGCAGG + Exonic
1143547704 17:7608343-7608365 CAACACTGGGAGGCCGAGGCTGG + Intronic
1143969591 17:10785907-10785929 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1144624233 17:16836616-16836638 CAGCAGAGGGAGGCACCAGCAGG + Intergenic
1144691563 17:17269176-17269198 AATCACTGGGAGGCCGAGGCAGG + Intronic
1144702667 17:17349187-17349209 CATCAGAAGGACCCCCAGGATGG - Intergenic
1144770528 17:17757065-17757087 GAGCAGATGGAGGCCCAGGGAGG + Intronic
1144793670 17:17876728-17876750 CATCAGTGGGAGGGCAAGGATGG + Intronic
1144882194 17:18436103-18436125 CAGCAGAGGGAGGCACCAGCAGG - Intergenic
1145150039 17:20508283-20508305 CAGCAGAGGGAGGCACCAGCAGG + Intergenic
1145866297 17:28244026-28244048 TTTGAGATGGAGGCCCAGGCTGG + Intergenic
1145976331 17:28986307-28986329 CCTCCCAGGGAGTCCCAGGCTGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146437266 17:32861767-32861789 CAACACTGGGAGGCCAAGGCAGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146637074 17:34514418-34514440 CAGCAGAGAGAGGGCCAAGCAGG + Intergenic
1146715603 17:35084345-35084367 CAACATTGGGAGGCCAAGGCGGG + Intronic
1146769809 17:35558502-35558524 TTTGGGAGGGAGGCCCAGGCAGG - Intergenic
1147007582 17:37416364-37416386 ATTGAGAGGGAGGCCGAGGCAGG - Intronic
1147148501 17:38499583-38499605 CACCAGAGGCAGGCTCAGGAGGG + Intronic
1147319831 17:39639492-39639514 TATCAGAGGGAGGCAGAGGCTGG + Intronic
1147949510 17:44099194-44099216 CATCAGAGTGAAGTCCTGGCAGG - Intronic
1148040268 17:44701191-44701213 CAACACTGGGAGGCCAAGGCAGG + Intergenic
1148272102 17:46269418-46269440 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1148593843 17:48837005-48837027 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1148596389 17:48859350-48859372 CAACACTGGGAGGCCAAGGCAGG + Intronic
1148880707 17:50724271-50724293 CAACATTGGGAGGCCAAGGCAGG + Intronic
1148919352 17:51016658-51016680 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1150061456 17:62072211-62072233 CAACACTGGGAGGCCAAGGCGGG - Intergenic
1150521000 17:65866346-65866368 CATGGGAGGGAGGCCAAGGCGGG + Intronic
1150710265 17:67525234-67525256 CAGCTGAGGGTGGCCCAGACTGG + Intronic
1151237375 17:72730996-72731018 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1151267219 17:72966145-72966167 CATCCAAGGGAGGCGCAGGCTGG + Intronic
1151278523 17:73054559-73054581 AGACAGTGGGAGGCCCAGGCAGG + Intronic
1151318927 17:73341127-73341149 CAACACTGGGAGGCCGAGGCAGG - Intronic
1151350536 17:73529245-73529267 CAGCTGAGGGAGGACCAGGCTGG + Intronic
1151482842 17:74380300-74380322 CTTCGGAGGGAGGGGCAGGCAGG + Intergenic
1151900822 17:77012833-77012855 CAACACTGGGAGGCCGAGGCTGG - Intergenic
1151955593 17:77378680-77378702 GCTCAGAGGGACCCCCAGGCGGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152629235 17:81402561-81402583 CAGCAGAGGGAGGGGCGGGCTGG - Intronic
1152757933 17:82094855-82094877 AGTCAGAGCGAGGGCCAGGCTGG + Intronic
1152794631 17:82301090-82301112 CCTCAGAGGCAGGCCCAACCCGG + Intergenic
1153374386 18:4358852-4358874 CAGCAGCAGGAAGCCCAGGCTGG + Intronic
1153608132 18:6855021-6855043 CATGGGAGGGAGGCCGAGGTGGG + Intronic
1154008444 18:10555646-10555668 CATCAGATGCAGGGCCTGGCTGG + Intergenic
1154146272 18:11868762-11868784 CAACACTGGGAGGCCGAGGCAGG + Intronic
1154162761 18:11992088-11992110 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1155098209 18:22580573-22580595 GATTACAGGGAGGCCGAGGCGGG + Intergenic
1156994599 18:43450080-43450102 AATTAAAGGGAGGCCGAGGCGGG - Intergenic
1157679092 18:49589698-49589720 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1157830150 18:50850167-50850189 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1158446625 18:57527757-57527779 GATGAAAGGGAGGCCGAGGCCGG - Intergenic
1158865292 18:61632516-61632538 CTACAGAGAGAGGCCCAGGGTGG - Intergenic
1159102260 18:63970287-63970309 AATCAGAGCGAGGCAAAGGCGGG + Intronic
1159569199 18:70092683-70092705 CATGAGATGATGGCCCAGGCTGG - Exonic
1159672523 18:71239346-71239368 CACCAGAGGGAGAGCCAGGCAGG + Intergenic
1160342637 18:78102522-78102544 CATCGGAGGGAGGGCCAGGGAGG + Intergenic
1160742250 19:692071-692093 TATGAAACGGAGGCCCAGGCCGG + Intronic
1160968433 19:1756838-1756860 CGTCAGAGGGAGGCCCGGCGGGG - Intronic
1161033828 19:2072971-2072993 CTTGAGAGACAGGCCCAGGCAGG + Exonic
1161067140 19:2244245-2244267 AGTCAGAGGGAGGCACAGCCAGG - Intronic
1161158079 19:2745000-2745022 CATCCCAGGGAGGCCGAGGGGGG + Intergenic
1161202803 19:3025273-3025295 CAGCTGAGCGAGGCCCAGGGTGG + Intronic
1161272618 19:3398403-3398425 CACCAGAGTGAGATCCAGGCTGG - Intronic
1161312510 19:3602788-3602810 GAAAAGAGGGAGGCCCAGGTGGG + Intronic
1161445220 19:4314731-4314753 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1161595083 19:5147060-5147082 CCTCAGAGTCTGGCCCAGGCAGG + Intronic
1161882112 19:6962929-6962951 CAACATTGGGAGGCCGAGGCAGG + Intergenic
1162307951 19:9886928-9886950 CAACACTGGGAGGCCGAGGCAGG - Intronic
1162515406 19:11144399-11144421 CAACATTGGGAGGCCAAGGCAGG - Intronic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162899683 19:13787230-13787252 CATTACAGGGAGGCTGAGGCAGG + Intergenic
1163450217 19:17372814-17372836 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1163737511 19:18990446-18990468 AGTCAGAGGGTGGCCCAGGCAGG + Intergenic
1163877045 19:19880456-19880478 GAACAGTGGGAGGCCAAGGCAGG + Intronic
1163880458 19:19916309-19916331 GATCAGGGGGAGGCCAAGGCGGG - Intronic
1164130156 19:22354689-22354711 CATCAAAGGGATGCTCAGGATGG - Intergenic
1164169173 19:22709313-22709335 CATCAGAGGGACGCTTAGGATGG + Intergenic
1164206159 19:23060499-23060521 CTTGAGGGGAAGGCCCAGGCAGG + Intergenic
1164480463 19:28607666-28607688 CATCAGAAGGAAGCCTAGACAGG + Intergenic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1164704962 19:30313303-30313325 CACCAGCAGAAGGCCCAGGCAGG - Intronic
1164953119 19:32355753-32355775 CACAGGAGGGAGGCCGAGGCGGG + Intronic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1165748474 19:38245415-38245437 CAACACTGGGAGGCCGAGGCGGG - Intronic
1165985808 19:39767829-39767851 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1166016354 19:39982124-39982146 CAACTTAGGGAGGCCAAGGCAGG - Intergenic
1166060789 19:40324095-40324117 CATCAGGGAGAGGCCCCGGTGGG + Intronic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166852097 19:45765957-45765979 CTTCAGTGGCAGGGCCAGGCCGG + Exonic
1166861606 19:45814861-45814883 CATCAGAGTAAGGCTGAGGCTGG + Exonic
1166942484 19:46375215-46375237 CATGAGAGGAAGGGCCCGGCTGG - Intronic
1167188318 19:47964193-47964215 CAACACTGGGAGGCCAAGGCGGG - Intergenic
1167500111 19:49841481-49841503 AATAAAAAGGAGGCCCAGGCTGG + Intergenic
1167682754 19:50934892-50934914 CAGCACAGGGATGCCAAGGCAGG + Intergenic
1167715688 19:51141747-51141769 CTTCAGTGGGGGGCACAGGCAGG - Intergenic
1167855110 19:52230876-52230898 TATCAGAGTGAGGGCTAGGCTGG - Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168216664 19:54931173-54931195 CAGCAGTGGGAGGCCAAGACGGG + Intronic
1168403577 19:56099462-56099484 CAACACTGGGAGGCCGAGGCGGG + Intronic
925249238 2:2417071-2417093 CATCAGTGGCAGGCTAAGGCTGG + Intergenic
925263083 2:2545083-2545105 TTTCATAGGGAGGCACAGGCAGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925741241 2:7007667-7007689 CATCAGAGGCAGGAACAGGCAGG - Intronic
925994773 2:9283322-9283344 TATTACAGGGAGGCCGAGGCTGG - Intronic
926031867 2:9598078-9598100 CAACATTGGGAGGCCAAGGCAGG - Intronic
926105791 2:10149957-10149979 AGTCAGAGGGTTGCCCAGGCAGG - Intronic
926362332 2:12101674-12101696 CCTCACTGTGAGGCCCAGGCTGG + Intergenic
926596749 2:14797794-14797816 GAGCCGAGCGAGGCCCAGGCAGG + Intergenic
927135275 2:20092361-20092383 CAGCGGAGGGGGGCCCAGACTGG + Intergenic
927572245 2:24169880-24169902 GTTCAGATGGAGGCCGAGGCGGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928139050 2:28711934-28711956 GTTCAAAGGGAGGCCGAGGCGGG + Intergenic
928381249 2:30820876-30820898 CATCTGAGAAAGGCCCTGGCGGG + Intergenic
928510274 2:31996430-31996452 CAGCTGAGGGAGGCTAAGGCAGG + Intronic
928551854 2:32380478-32380500 CAGCTGAGGGAGGCTGAGGCGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929014523 2:37481476-37481498 CATGGGAGGGAGGCCAAGGTGGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929903587 2:46026937-46026959 CAACATTGGGAGGCCAAGGCAGG + Intronic
930517945 2:52431927-52431949 CATCAGAAGGAAGCCTAGACAGG + Intergenic
930804080 2:55472587-55472609 CAGGAGAGGGAGGCCAAGGCAGG + Intergenic
931353459 2:61513245-61513267 CAGCACTGGGAGGCCAAGGCAGG - Intronic
931512783 2:63019460-63019482 CAGCACTGGGAGGCCCAGGCGGG + Intronic
931841879 2:66159980-66160002 AAGCAGAGGGAGGCTGAGGCAGG + Intergenic
932724729 2:74169646-74169668 CAACAGAGTGAGACCCAGTCGGG - Intronic
933866240 2:86520783-86520805 AATAAAAGGGAGGCCCAGGTAGG - Intronic
933936033 2:87204444-87204466 CATCAGAAGGAAGCCTAGACTGG - Intergenic
934724253 2:96605134-96605156 CATCTGAATGAGGACCAGGCAGG - Intronic
935234775 2:101129387-101129409 CAACACTGGGAGGCCGAGGCAGG - Intronic
935268075 2:101411518-101411540 GATCACAGGGAGTCCCAGGAGGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935649111 2:105366990-105367012 CACCTGTGGGAGGCCAAGGCTGG - Intronic
936267663 2:111022754-111022776 CAGCAGAGGGAGGCGAGGGCAGG + Intronic
936357115 2:111761385-111761407 CATCAGAAGGAAGCCTAGACTGG + Intergenic
937001574 2:118472470-118472492 CAGCATTGGGAGGCCGAGGCGGG - Intergenic
937444844 2:121949245-121949267 CAGCACTGGGAGGCCCAGGCGGG - Intergenic
938042455 2:128086829-128086851 CAACACTGGGAGGCCAAGGCGGG - Intergenic
938099063 2:128485913-128485935 CCTCAGAGGGAGGCTCAGAGAGG - Intergenic
938243436 2:129760362-129760384 CAGCAGTGGTAGGCCGAGGCGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938629900 2:133155225-133155247 GATCAGAGGAAGGACCAGGGAGG + Intronic
939491433 2:142881998-142882020 CAGCACTGGGAGGCCGAGGCAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941151369 2:161919188-161919210 CATGAGATGGAGGCCAAGGTGGG + Intronic
941462961 2:165793655-165793677 CCTGAGAGGGAGGGCCCGGCGGG - Intronic
941764862 2:169285619-169285641 GATCAGAGGGTGGCCAAGGGGGG - Intronic
941970296 2:171342924-171342946 CAACATTGGAAGGCCCAGGCAGG + Intronic
942708379 2:178802628-178802650 CATCAGATAGAGCCCTAGGCAGG - Intronic
943495575 2:188616796-188616818 AAAAAGAGGGAGGCCAAGGCAGG - Intergenic
943639515 2:190343555-190343577 ATTCAGAGGGAGGGCCAGGAAGG - Exonic
943666927 2:190618823-190618845 CAGCACTGGGAGGCCAAGGCAGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944586956 2:201181040-201181062 CCACAGGGGGAGCCCCAGGCTGG + Intergenic
944833828 2:203558861-203558883 GATGATAGGGAGGCCAAGGCGGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945981847 2:216318591-216318613 TATCAGAGGGAAGACCAGACAGG + Intronic
946371831 2:219285820-219285842 CCCCAGAGGGAGGCCTAGGAGGG + Exonic
946976340 2:225156460-225156482 CAACACTGGGAGGCCAAGGCAGG - Intergenic
947324707 2:228961637-228961659 CATCATAGGTAGCCCCACGCAGG - Intronic
947722978 2:232380507-232380529 CATCTGAGGGATGCCAGGGCAGG - Intronic
947727328 2:232408588-232408610 CATCTGAGGGATGCCAGGGCAGG - Intronic
947875331 2:233464093-233464115 GATCAGCGCGAGGCCCAGGGGGG - Intronic
947970594 2:234319876-234319898 CAACATTGGGAGGCCGAGGCAGG - Intergenic
948676658 2:239600904-239600926 GAGCAGTGGGAGGCCCAGGGAGG - Intergenic
948736767 2:240013798-240013820 CATCAGAGTGAGGAACAGGCAGG + Intronic
948957696 2:241306659-241306681 CTTCATTGGGAGGCCGAGGCTGG + Intronic
948984967 2:241515721-241515743 CAACACTGGGAGGCCGAGGCGGG + Intergenic
949052813 2:241906144-241906166 CATCCCAGGGTGGGCCAGGCTGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169548532 20:6676518-6676540 AAACAGAGGGAGGCCGAGGCAGG - Intergenic
1170852343 20:20016891-20016913 CAACACTGGGAGGCCAAGGCGGG - Intergenic
1170898952 20:20441481-20441503 CAGCAGAGGCAGGTCAAGGCAGG + Intronic
1171409115 20:24934387-24934409 GATGAGATGGAGGCCAAGGCTGG + Intergenic
1172150924 20:32789838-32789860 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1172157781 20:32841060-32841082 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1172271874 20:33659581-33659603 CACCAGAGCCAGGCCCATGCTGG - Exonic
1172339434 20:34144604-34144626 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1172703098 20:36864258-36864280 CAGGAGAGGGAAGCCGAGGCAGG - Intergenic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1173463324 20:43261417-43261439 CATAAGCAAGAGGCCCAGGCAGG - Intergenic
1173509130 20:43612400-43612422 CACCAGAGGGAGGCCAGGCCCGG + Intronic
1173749942 20:45469214-45469236 CATCAGAAACAGGCCCAGGAAGG - Intergenic
1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG + Intronic
1174047604 20:47744648-47744670 CAACACTGGGAGGCCAAGGCAGG - Intronic
1175814077 20:61874527-61874549 CCCCAGAGGGAGGCCCTGGGCGG + Intronic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1176249734 20:64114832-64114854 CATCAGCAGGAGGTCCAGGGAGG - Intergenic
1176255049 20:64147300-64147322 CATCTGAGGGAGGCTGCGGCTGG - Intergenic
1176524781 21:7857880-7857902 GAGCTGAGTGAGGCCCAGGCAGG - Intergenic
1177344681 21:19854079-19854101 CATGGGAGGGAGGCCGAGGTGGG - Intergenic
1178025803 21:28465089-28465111 CAGCACTGGGAGGCCGAGGCTGG - Intergenic
1178027347 21:28483306-28483328 CATCAGAAGGAGACTCAGGATGG + Intergenic
1178077278 21:29023845-29023867 CAACACTGGGAGGCCGAGGCGGG - Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178658801 21:34487893-34487915 GAGCTGAGTGAGGCCCAGGCAGG - Intergenic
1179681137 21:43022094-43022116 AAGCACAGGGAGGCCAAGGCGGG + Intronic
1179977861 21:44880477-44880499 CAACAGTGGGAGGCCAAGGCAGG + Intergenic
1180025830 21:45161534-45161556 CATGAGAGGGAGGCCAACGCGGG + Intronic
1180051153 21:45331614-45331636 CAGCAGAGGGTGGCCCAGGGAGG + Intergenic
1180259958 21:46662163-46662185 TGTCGGAGGGACGCCCAGGCTGG - Intronic
1180261711 21:46674800-46674822 CAGCAGGTGGAGGCCCTGGCAGG - Intergenic
1181157203 22:20930626-20930648 CAACACTGGGAGGCCGAGGCGGG - Intronic
1181167309 22:20990744-20990766 GTTCAGAGGGAGGCCTAGCCAGG - Intronic
1181265533 22:21628803-21628825 CATCAGAGGTGGGACCAGGCCGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181772795 22:25138956-25138978 CCTCAGAGGGAAGACCAGGAAGG - Intronic
1181928243 22:26377687-26377709 CATCAGAGGCAGGCGGAGGTTGG - Exonic
1182145446 22:27994336-27994358 CACTAGAGAGAGGCCCAGGGAGG - Intronic
1182297772 22:29319602-29319624 CACCTTGGGGAGGCCCAGGCGGG + Intronic
1182352327 22:29705847-29705869 CAGCAGTGGGAGGCCCAGCGGGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182557417 22:31136804-31136826 GAACAGAGGCAGGCTCAGGCCGG + Intronic
1183243013 22:36672402-36672424 CAACACTGGGAGGCCAAGGCAGG - Intronic
1183408711 22:37642702-37642724 CATCAGAAGAATGACCAGGCTGG + Intronic
1183450201 22:37889850-37889872 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1183587017 22:38758711-38758733 CATCACAGGCAGGCCTTGGCGGG + Intronic
1183642882 22:39102751-39102773 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1183950794 22:41351605-41351627 CAGCAGATGGAGGCGCATGCGGG + Exonic
1184129549 22:42509575-42509597 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1184139752 22:42571668-42571690 CAACACTGGGAGGCCGAGGCGGG - Intronic
1184156098 22:42668221-42668243 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184375530 22:44109865-44109887 CATAGGTGGGAGGCCGAGGCGGG + Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
1184617216 22:45646211-45646233 CATTGGAGGGAGGCCTTGGCAGG + Intergenic
1184761358 22:46546621-46546643 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1184781609 22:46652409-46652431 CAGCCCAGGGAGACCCAGGCTGG + Intronic
1185179810 22:49352836-49352858 CCTCAGAGGGCGGCCCCGGCTGG - Intergenic
1185233833 22:49699790-49699812 CATCACTGTGAGGCCCAGCCGGG - Intergenic
949462016 3:4303677-4303699 CAACAGAAAAAGGCCCAGGCCGG - Intronic
950018120 3:9768440-9768462 CAGCAGAGGAAGGGCCAGGCTGG - Intronic
950079555 3:10211386-10211408 CATATGTGGGAGGCCAAGGCAGG - Intronic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
950541516 3:13616040-13616062 CATCAGGGTGAGGCAGAGGCAGG + Intronic
950572294 3:13808951-13808973 TAGCAGAGAGAGGCCCAGGCTGG + Intergenic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
951202923 3:19894738-19894760 CAACACTGGGAGGCCGAGGCAGG + Intronic
951523592 3:23631897-23631919 TGTCAGAGGGAAGCCCAGGCTGG - Intergenic
951789421 3:26463211-26463233 AAAAAAAGGGAGGCCCAGGCTGG - Intergenic
952255054 3:31687823-31687845 CAACAGTGGGAGGCTGAGGCAGG + Intronic
953417811 3:42732940-42732962 CACCAGTGTGTGGCCCAGGCTGG + Exonic
953839515 3:46377949-46377971 CTTCGGTGGGAGGCCGAGGCGGG - Intergenic
953871382 3:46630120-46630142 CGCCGGAGGGAGGCCCAGCCAGG - Intergenic
953958187 3:47247318-47247340 CAGGACTGGGAGGCCCAGGCTGG + Intronic
953991223 3:47484967-47484989 CAACACTGGGAGGCCAAGGCGGG - Intergenic
954112992 3:48446244-48446266 CATTTGAGGTAGGCCCAGGGAGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954574357 3:51667410-51667432 CATCACTGGGAGGCCGAGGAGGG - Exonic
954634224 3:52062850-52062872 CATCACTGGGAGCCCAAGGCGGG - Intergenic
954759249 3:52862020-52862042 CATCACTGGGAGGCCAGGGCTGG - Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
955271297 3:57502151-57502173 CAACCCAGGGAGGCCGAGGCGGG - Intronic
955283276 3:57614728-57614750 TAGCAGAGGGAGGCCGAGGCGGG + Intergenic
955679309 3:61483803-61483825 CAACACTGGGAGGCCAAGGCAGG + Intergenic
955789608 3:62574612-62574634 CATAAGAGGGAGGTTCAGCCAGG + Intronic
955912092 3:63867639-63867661 CATTTGAGGTAGGCCGAGGCGGG + Intronic
958487310 3:94729239-94729261 CAACATAGGGAGACCCAGGCTGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960512971 3:118572323-118572345 CAGCACTGGGAGGCCGAGGCTGG - Intergenic
960601652 3:119464658-119464680 CAACACTGGGAGGCCAAGGCAGG + Intronic
960760446 3:121068252-121068274 CAGCACTGGGAGGCCGAGGCAGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961249820 3:125492252-125492274 CTTCAGAGGGAGGCCCAGACTGG - Intronic
961252865 3:125521407-125521429 CAACACTGGGAGGCCAAGGCCGG + Intergenic
961290513 3:125843069-125843091 CAACACTGGGAGGCCAAGGCGGG + Intergenic
961453776 3:127014458-127014480 CAGCTGAGGGAGGCAGAGGCTGG - Exonic
961468863 3:127098862-127098884 CATCAGGCCTAGGCCCAGGCAGG - Intergenic
961537184 3:127577285-127577307 CCCGAGAGGGAGGGCCAGGCTGG - Intronic
961896595 3:130173026-130173048 CAACACTGGGAGGCCGAGGCAGG - Intergenic
962390873 3:134971567-134971589 GATGAGAGGCAGGCCCTGGCTGG + Intronic
963035128 3:141019399-141019421 GTTCAGAGGGAGGCCCTGGGCGG - Intergenic
963736557 3:149023734-149023756 CAGAATAGGGAGGCCAAGGCAGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964615090 3:158655237-158655259 CAGGAGTGGGAGGCCAAGGCGGG + Intronic
964933296 3:162051546-162051568 CATCAGAAGGAAGCCTGGGCAGG - Intergenic
966005318 3:175004125-175004147 CAGCACTGGGAGGCCAAGGCAGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966794590 3:183701331-183701353 CAGCACTGGGAGGCCAAGGCAGG - Intronic
966851692 3:184168773-184168795 GAGCAGAGGGTGTCCCAGGCAGG + Intronic
968127739 3:196172276-196172298 CAACACTGGGAGGCCAAGGCAGG + Intergenic
968141484 3:196261408-196261430 CAGCACTGGGAGGCCGAGGCAGG + Intronic
968317936 3:197739787-197739809 CAACACTGGGAGGCCCAGGCAGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968896375 4:3406238-3406260 ATTCACAGGGCGGCCCAGGCAGG - Intronic
968919619 4:3515734-3515756 CCTGAGATGGAGGCCCAGGGAGG - Intronic
968949194 4:3681678-3681700 GATCACAGGCAGGCCCAGGCCGG - Intergenic
969006771 4:4026480-4026502 CAACACTGGGAGGCCAAGGCAGG - Intergenic
969312188 4:6360157-6360179 GAGGAGAGGGAGGCCCAGGGTGG + Intronic
969410632 4:7025713-7025735 CAACAAAGGGAGGCCCAGAGAGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971423058 4:26491430-26491452 CAACACTGGGAGGCCAAGGCAGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972991550 4:44827466-44827488 CATCAGAAGGAAGCCTGGGCTGG - Intergenic
973307927 4:48674489-48674511 CAACATAGGGAGGCCAAGGCGGG + Intronic
973318286 4:48783535-48783557 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
973676627 4:53269776-53269798 CAACACTGGGAGGCCAAGGCGGG + Intronic
973727374 4:53789845-53789867 CATCAGAAGGGGGCCCAGGAGGG - Intronic
974082328 4:57225340-57225362 TGTCAAAGGGAGGCCGAGGCGGG + Intergenic
975326306 4:73062580-73062602 CAGAACTGGGAGGCCCAGGCAGG + Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976154251 4:82125626-82125648 CACCACAGGGAGGCCAAGGTAGG - Intergenic
976471151 4:85430529-85430551 GCTCTGTGGGAGGCCCAGGCAGG - Intergenic
976528919 4:86127654-86127676 CCTCAGGGTGAGGGCCAGGCAGG - Intronic
977310069 4:95374709-95374731 CTGGAGAGGGAGGCCCAGGGTGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978443487 4:108758802-108758824 CAGCACTGGGAGGCCGAGGCGGG + Intronic
978906928 4:114016201-114016223 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979790805 4:124779142-124779164 AATTAGAGGGAGGCCGAGTCAGG - Intergenic
979864083 4:125731478-125731500 CACCAGAAGGAGGCCAGGGCTGG - Intergenic
980933081 4:139199874-139199896 CAACACTGGGAGGCCGAGGCGGG + Intergenic
981175828 4:141682708-141682730 CAATAGGGGGAGGCCGAGGCGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982110796 4:152051673-152051695 CAACACAGGGAGGCCGAGGCAGG - Intergenic
983017039 4:162626364-162626386 AATCCCAGGGAGGCCGAGGCTGG - Intergenic
984612552 4:181857314-181857336 CGTCAGAGGGAAGGCCAGGGTGG + Intergenic
984645839 4:182218974-182218996 CAGCACTGGGAGGCCGAGGCAGG + Intronic
984738099 4:183130296-183130318 CAGCACTGGGAGGCCGAGGCAGG - Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985511095 5:314271-314293 CAGCACAGGGAGGCGCAGGTGGG - Intronic
985802035 5:2010812-2010834 CATCAGCGGGAGACCCAGGGAGG - Intergenic
986015390 5:3752970-3752992 CCTCAGAGGGAGGGTCAGGGTGG - Intergenic
986482371 5:8202336-8202358 CATCTCAGGGAGGCCCTGGGAGG - Intergenic
987322682 5:16785106-16785128 AATCAGAGGCAAGCCCAGCCGGG + Intronic
987376507 5:17240236-17240258 CAACAGAGTGAGGCTCTGGCCGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992004344 5:72462795-72462817 CAACTGTGGGAGGCCGAGGCGGG - Intronic
993257099 5:85605396-85605418 CAGAAGAGTGAGTCCCAGGCTGG + Intergenic
993987013 5:94609700-94609722 CAGGAGTGGGAGGCCGAGGCAGG + Intronic
994362997 5:98876920-98876942 CATGACTGGGAGGCCAAGGCAGG + Intronic
996154354 5:120079839-120079861 CATCAGAGGTATGGTCAGGCAGG - Intergenic
996173397 5:120324197-120324219 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
996471621 5:123867655-123867677 CATCGTTGGGAGGCCGAGGCGGG - Intergenic
997264786 5:132489217-132489239 CATGCAAGTGAGGCCCAGGCTGG + Intronic
997295473 5:132765968-132765990 CATCAGTGGGAGGGCCTGGGAGG - Intronic
997436985 5:133882637-133882659 CTCCAGTGGGAGGCCAAGGCAGG + Intergenic
997611808 5:135220810-135220832 CTGCAGAGGTCGGCCCAGGCTGG - Intronic
998072437 5:139208636-139208658 CTTTAGAGGGAGGCCGAGGTGGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000264073 5:159617971-159617993 CATGAAAGTGAGGCCCAAGCAGG - Intergenic
1001294761 5:170491206-170491228 CAACAGGGGCAGGCACAGGCAGG + Intronic
1001713036 5:173793238-173793260 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1001999453 5:176189535-176189557 CTTCAGTGGGTGGCTCAGGCCGG - Intergenic
1002048160 5:176553606-176553628 CCTCAGAGGGATGCCTGGGCTGG + Intronic
1002069231 5:176669206-176669228 CATCAGAGTGAGGCCCTGGCTGG + Intergenic
1002117517 5:176974905-176974927 CAACACTGGGAGGCCCAAGCTGG + Intronic
1002124285 5:177030370-177030392 CAGCACTGGGAGGCCGAGGCGGG + Intronic
1002445283 5:179286713-179286735 CATCACAGGGCAGCACAGGCCGG + Intronic
1003074624 6:2971973-2971995 CAACACTGGGAGGCCGAGGCAGG + Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003602923 6:7534532-7534554 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1003888179 6:10539835-10539857 CAACACTGGGAGGCCAAGGCAGG + Intronic
1003907753 6:10718238-10718260 CACTTGTGGGAGGCCCAGGCAGG + Intergenic
1004063705 6:12222623-12222645 CATCAGACACAGGCCCGGGCAGG - Intergenic
1004517433 6:16332286-16332308 CACCAGAGGGCGCCCCAGGATGG + Intronic
1004647731 6:17579286-17579308 CAGCACTGGGAGGCCCAGGTGGG - Intergenic
1004955079 6:20720616-20720638 AATCATAGGGAGGCTGAGGCAGG - Intronic
1005249231 6:23925813-23925835 TATCAGAGGAAGTCCCAGGCTGG - Intergenic
1005811240 6:29518034-29518056 CATCAGAGTGGGGCCCTGCCTGG - Intergenic
1006114023 6:31765841-31765863 CATCACAGGGTGGGCAAGGCCGG - Intronic
1006359953 6:33581849-33581871 CACAAAAGGGAGGCCAAGGCAGG + Intergenic
1006421212 6:33935363-33935385 AATGAGAGGGAGAGCCAGGCAGG - Intergenic
1006474629 6:34246163-34246185 CCAGAGAGGGAGCCCCAGGCTGG - Exonic
1006570551 6:34999645-34999667 CATCAGAAGGAAGCCTAGACAGG + Intronic
1006617890 6:35342387-35342409 CACCAGAGGGCGCCACAGGCTGG + Intergenic
1006630689 6:35427768-35427790 CTTGGGAGGGAGGACCAGGCAGG - Exonic
1006647327 6:35523605-35523627 CAACAGTGGGAGGCCGAGGCAGG + Intergenic
1006766372 6:36510230-36510252 CATGAGAGGGAGGCCAAGCAGGG - Intronic
1007197844 6:40078100-40078122 AATAAGACAGAGGCCCAGGCTGG + Intergenic
1007216816 6:40246764-40246786 AATAAGAGGGAAGCACAGGCTGG + Intergenic
1007565136 6:42844261-42844283 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008572880 6:52831991-52832013 CCTCAGAGTGAAGCCAAGGCCGG + Intronic
1008578753 6:52886168-52886190 CATGACAGGGAGGACCAGGAAGG + Intronic
1010212602 6:73373942-73373964 CATCACTGGGAGGCTGAGGCGGG + Intronic
1011470570 6:87703498-87703520 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1011564784 6:88663338-88663360 CATCAGAAGGAAGCCTAGACAGG + Intronic
1011682799 6:89799434-89799456 CAACACTGGGAGGCCGAGGCGGG + Intronic
1012215153 6:96573549-96573571 TTTGAGACGGAGGCCCAGGCTGG + Intronic
1012728620 6:102850077-102850099 CACTAGAGGGAGGCCTAGGCGGG + Intergenic
1012889889 6:104885807-104885829 CACAAGAGGGAGGCCAAGGTGGG + Intergenic
1013246709 6:108294191-108294213 CATGCCTGGGAGGCCCAGGCAGG - Intergenic
1015954290 6:138583850-138583872 CATATGAGGGAGGCCAAGGTGGG + Intronic
1015986306 6:138887470-138887492 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1016085813 6:139913054-139913076 TATGATAGGGAGGCCGAGGCGGG + Intergenic
1016271693 6:142297456-142297478 CCTCAGATAGAGGCCCAGGAAGG + Intergenic
1018947291 6:168356685-168356707 CAGCAGGGGCAGCCCCAGGCAGG + Intergenic
1019188475 6:170235851-170235873 CCCCAGATGGAGGCCCAGGTCGG + Intergenic
1019192537 6:170261485-170261507 CAACACTGGGAGGCCAAGGCAGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019491910 7:1318198-1318220 GGTCAGGGGGAGGCCCGGGCAGG - Intergenic
1019524173 7:1473305-1473327 GCTCAGAGGGAGGGCCGGGCGGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019748051 7:2711665-2711687 CAGCACAGGGAGGCAGAGGCAGG - Intronic
1019779539 7:2931204-2931226 CAGCAGAGGGAGGCCAGGGCGGG - Intronic
1020063635 7:5170877-5170899 CAACACTGGGAGGCCAAGGCGGG - Intergenic
1020160602 7:5768319-5768341 CAGTAGTGGGAGGCCGAGGCAGG + Intronic
1020268626 7:6578374-6578396 AATCTTTGGGAGGCCCAGGCAGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022299356 7:29088728-29088750 CACCTGTGGGAGGCCGAGGCGGG + Intronic
1023892489 7:44403222-44403244 CAGCAGAGGTAGGCCCTGGGTGG + Intronic
1024126435 7:46302274-46302296 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1024258627 7:47558060-47558082 CACACGAGGCAGGCCCAGGCTGG + Intronic
1024959137 7:54956924-54956946 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1025769937 7:64495127-64495149 CATTAGAGGGACGCACAGGAAGG - Intergenic
1025825845 7:65009767-65009789 CAGCACTGGGAGGCCAAGGCTGG + Intergenic
1025898841 7:65727552-65727574 CAGCACTGGGAGGCCAAGGCTGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026047677 7:66918689-66918711 CAACAGTGGGAGGCTGAGGCAGG - Intergenic
1026392071 7:69912038-69912060 CACAAGAGGGAGGCCAAGGTAGG - Intronic
1026809186 7:73448006-73448028 CCTTAGAAGGAAGCCCAGGCCGG + Intronic
1026841196 7:73670861-73670883 AATCGGAGGCAGGCCCAGGCTGG + Intronic
1027121080 7:75520869-75520891 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1027133176 7:75605780-75605802 CAACACTGGGAGGCCAAGGCAGG - Intronic
1027231136 7:76273239-76273261 CATGGGAGAGAGGCCCATGCCGG - Intronic
1027487570 7:78781085-78781107 CAGCAGAGGGATGGCCGGGCAGG + Intronic
1027894550 7:84024292-84024314 CACCATGGGGAGGCCAAGGCGGG + Intronic
1028129456 7:87152738-87152760 CCTAAGAGGGAGGCCCTGGCCGG - Exonic
1028527452 7:91801530-91801552 CATGGGAGGGAGGCCAAGGAGGG - Intronic
1029092922 7:98062521-98062543 CATAGGAGGGAGGACCAGCCTGG - Intergenic
1029289376 7:99490401-99490423 CAGCACTGGGAGGCCAAGGCTGG - Intronic
1029449687 7:100633818-100633840 GATACGAGGGAGGCCGAGGCAGG - Intronic
1029958956 7:104669290-104669312 CATCTGAGGAAGGACCAGGAAGG + Intronic
1031599741 7:123692511-123692533 CATCAGAAGGCAGGCCAGGCGGG + Exonic
1031837070 7:126691167-126691189 CATGAGAGGGAGGCCAAGAAGGG - Intronic
1031923840 7:127620109-127620131 CATCAGGGCGAGGGACAGGCTGG - Intergenic
1032064829 7:128759947-128759969 CAACACTGGGAGGCCGAGGCGGG + Intronic
1032172491 7:129597090-129597112 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1032979661 7:137267502-137267524 CATCAGAAGGAAGCCTAGACAGG - Intronic
1033208942 7:139446087-139446109 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033325117 7:140371285-140371307 CAGCTGAGGGAGGCTGAGGCAGG - Intronic
1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG + Intronic
1033911515 7:146269048-146269070 CATAAGAGGGTGGGCCAGGTGGG + Intronic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034995293 7:155573115-155573137 CACTTGAGGGAGGCCGAGGCAGG + Intergenic
1035000452 7:155608554-155608576 TTTGAGACGGAGGCCCAGGCTGG - Intergenic
1035024360 7:155816306-155816328 CTTCACAGAGTGGCCCAGGCCGG - Intergenic
1035165820 7:156989130-156989152 CATCAGTGTGAGCCCCGGGCGGG - Intergenic
1035223672 7:157421882-157421904 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
1035334322 7:158115920-158115942 CATCTGAGGGTGGCACAGGGTGG - Intronic
1035623405 8:1052177-1052199 GGTCAGAGGCAGGCCCAGGAAGG - Intergenic
1036369334 8:8149420-8149442 CAACACTGGGAGGCCGAGGCAGG + Intergenic
1036372437 8:8172956-8172978 CATCAGAAGGAAGCCTGGGCAGG + Intergenic
1036723641 8:11200719-11200741 CATCATGGGGGGGCCCCGGCTGG + Exonic
1036878466 8:12492685-12492707 CATCAGAAGGAAGCCTGGGCAGG - Intergenic
1036881556 8:12516220-12516242 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1037141983 8:15531205-15531227 CACCTGGGAGAGGCCCAGGCAGG - Intronic
1037367371 8:18137126-18137148 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1037768736 8:21787065-21787087 CACCACCGGGAGTCCCAGGCAGG - Intronic
1037951279 8:23019888-23019910 CCCCAGAGGGAGGAGCAGGCAGG + Intronic
1038123146 8:24641196-24641218 CATCTTTGGGAGGCCGAGGCAGG + Intergenic
1038462899 8:27731344-27731366 CAACACTGGGAGGCCGAGGCGGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038745648 8:30252572-30252594 CATGAGAGGGAGGCCCTTGCTGG + Intergenic
1038748918 8:30278341-30278363 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1039277803 8:35952663-35952685 CATCAGAAGGAAGCCTAGACAGG + Intergenic
1039745532 8:40422810-40422832 GACCACAGGGAGCCCCAGGCAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040481602 8:47832132-47832154 CTCCAGAGGGAGGCCCAGGGAGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1042608974 8:70577169-70577191 CACGAGAGGGAGGCCGAGGGGGG + Intronic
1043078613 8:75735509-75735531 CCTAAGAGGGAGGTCTAGGCAGG + Intergenic
1043798695 8:84579125-84579147 CATGGGAGGGAGGCCTAGGGGGG - Intronic
1044547257 8:93473543-93473565 CATCAGAGTGATGACAAGGCAGG + Intergenic
1044895337 8:96885740-96885762 AATCTCAGGGAGGCCGAGGCGGG + Intronic
1044992271 8:97806708-97806730 CATGAGATTGAGGCCGAGGCTGG + Intronic
1045016279 8:98004038-98004060 CAGCACAGGGAGGCCAAGGCGGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045238229 8:100374832-100374854 CAACACTGGGAGGCCGAGGCGGG + Intronic
1045888005 8:107122832-107122854 CATGGAAGGGAGGCCAAGGCAGG + Intergenic
1046395318 8:113632968-113632990 CAGGAGAGGGAGGCCAAGGTGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047206117 8:122803934-122803956 CATTAGATGGAGGGCCAGGGCGG + Intronic
1047761984 8:127961267-127961289 GATCAGAGGGAGGTCCAAGCTGG + Intergenic
1047776995 8:128079968-128079990 CATCCTTGGGAGGCCGAGGCGGG - Intergenic
1048359879 8:133688597-133688619 CCTCAGAGGGGGGCCATGGCAGG + Intergenic
1048455627 8:134575674-134575696 CTCCAGAGGCAGGCCCAGGCTGG - Intronic
1048500668 8:134971891-134971913 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1048890498 8:138942481-138942503 CAGCAAAGGGAGGCTCAGGGAGG - Intergenic
1049010127 8:139881920-139881942 CATCAGAGGGAGGCCCAGGCAGG - Intronic
1049091449 8:140517651-140517673 CATCACTGGGAGGCCGAGGTGGG - Intergenic
1049107066 8:140620741-140620763 CATCTGTGGGAGGCTGAGGCAGG + Intronic
1049388295 8:142355151-142355173 CATGTGAGTCAGGCCCAGGCCGG + Intronic
1049462501 8:142736609-142736631 CATCAGCTGGAGCCTCAGGCTGG - Exonic
1049837607 8:144748318-144748340 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1049918107 9:337905-337927 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1050006006 9:1131147-1131169 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1050330377 9:4539957-4539979 CTTCAGAGTGAGGCCCTTGCTGG - Intronic
1050453425 9:5808069-5808091 CAACATTGGGAGGCCAAGGCAGG - Intronic
1050508876 9:6373737-6373759 CATTTTTGGGAGGCCCAGGCAGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050719008 9:8563679-8563701 TGACAGAGGGAGGCCAAGGCGGG - Intronic
1051029656 9:12658712-12658734 CACGAGAGGGAGGCCAAGGCGGG - Intergenic
1053061855 9:35038017-35038039 CAACACTGGGAGGCCAAGGCAGG + Intergenic
1053129181 9:35605587-35605609 CATGTGAGGCAGGCCCGGGCTGG + Exonic
1053449514 9:38181297-38181319 CAGCAGAGGGAGGGCCATTCAGG - Intergenic
1055019503 9:71654474-71654496 GATCATTGGGAGGCCGAGGCGGG + Intergenic
1055426338 9:76200744-76200766 GATCACTTGGAGGCCCAGGCAGG + Intronic
1055452756 9:76445637-76445659 AAACTGAGGGAGGCCAAGGCGGG - Intronic
1056236936 9:84604043-84604065 CCACAGTGGGAGGCCGAGGCAGG - Intergenic
1056331226 9:85522849-85522871 CAGCAGAGAGAGGCCGATGCGGG - Intergenic
1056644455 9:88398818-88398840 AATCCCAGGGAGGCCAAGGCAGG - Intronic
1057218833 9:93244779-93244801 TCTCACAGGGAGGCCGAGGCAGG - Intronic
1057229170 9:93308534-93308556 CAAGACATGGAGGCCCAGGCAGG + Exonic
1057336776 9:94161767-94161789 ATGGAGAGGGAGGCCCAGGCTGG + Intergenic
1058329129 9:103736994-103737016 AATTAAAGGGAGGCCAAGGCAGG + Intergenic
1058515282 9:105766045-105766067 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1058684437 9:107467864-107467886 GATCCCAGGGAGGCCAAGGCAGG - Intergenic
1059493889 9:114693568-114693590 CCTTAGATGGAGTCCCAGGCAGG + Intergenic
1060297908 9:122355584-122355606 CTTCTGGGGAAGGCCCAGGCTGG + Intergenic
1060588102 9:124799409-124799431 CAGCAGCTGGAGGCCCAGGCGGG - Exonic
1060795596 9:126510683-126510705 CAGCAGAGGGCAGCACAGGCGGG + Intergenic
1061034198 9:128104419-128104441 CAACACAGGGAGGCCCAGCAAGG - Intronic
1061148090 9:128812084-128812106 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1061296062 9:129677459-129677481 CCTCTGGGGGAGGCCCAGGAGGG + Intronic
1061639978 9:131945711-131945733 CAACACTGGGAGGCCAAGGCAGG + Intronic
1061697380 9:132387195-132387217 CAACACTGGGAGGCCAAGGCAGG - Intronic
1061756743 9:132818734-132818756 CTTCAGTGGGAGGCCGAGGCGGG + Intronic
1062025441 9:134338200-134338222 AGCCAGAGGGAGGCCCAGGGAGG - Intronic
1062076392 9:134592297-134592319 CCGCAGAGAGAGGCCGAGGCTGG - Intergenic
1062145983 9:134989912-134989934 CATCAGCAGGATGCCCAGCCAGG - Intergenic
1062329086 9:136028956-136028978 CACAAGAGGGAGGCCGAGGTGGG + Intronic
1062424382 9:136499265-136499287 CAACAGGGAGAGGCTCAGGCGGG + Intronic
1062462941 9:136669422-136669444 CAGCACCGGAAGGCCCAGGCAGG + Intronic
1185579108 X:1196818-1196840 CATCAGAAGGATGGCCAGGCTGG + Exonic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1186471560 X:9826018-9826040 CAGGAGGCGGAGGCCCAGGCAGG - Intronic
1187970775 X:24655869-24655891 CATTAGGGGGAGGCCAAGGCAGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189754634 X:44258604-44258626 GATCACTGGGAGGCCGAGGCAGG + Intronic
1189821096 X:44871272-44871294 CTGCAAAGGGAGGCCGAGGCGGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190315472 X:49147803-49147825 CATCAGAAGGAGGCCTAGACAGG - Intergenic
1190319383 X:49171397-49171419 CAACACTGGGAGGCCGAGGCGGG - Intergenic
1190597252 X:52062154-52062176 TGTCAGAGGGAGGGCCAGGGTGG - Intronic
1190611572 X:52191919-52191941 TGTCAGAGGGAGGGCCAGGGTGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1194752656 X:97702079-97702101 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1195283389 X:103358807-103358829 CAACATTGGGAGGCCAAGGCGGG + Intergenic
1195776427 X:108411138-108411160 GATCAGAGGTAGGCCAAGGCAGG + Intronic
1200093215 X:153645291-153645313 CATAGGAGGGAGGCCTGGGCTGG + Intronic
1200101953 X:153692694-153692716 CAGGTGTGGGAGGCCCAGGCAGG - Intronic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic
1201720336 Y:17089774-17089796 CATGAGAGGGATGCTCAGGAGGG + Intergenic