ID: 1049010441

View in Genome Browser
Species Human (GRCh38)
Location 8:139883817-139883839
Sequence GGCTCCAGAGTGAGCAGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 374}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049010441_1049010451 30 Left 1049010441 8:139883817-139883839 CCGGCTCTGCTCACTCTGGAGCC 0: 1
1: 0
2: 6
3: 55
4: 374
Right 1049010451 8:139883870-139883892 GTCTCCCTGTTTGTAAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049010441 Original CRISPR GGCTCCAGAGTGAGCAGAGC CGG (reversed) Intronic
900215332 1:1478666-1478688 AGCTCAAGAGCGAGCAGATCCGG + Exonic
900222593 1:1517333-1517355 AGCTCAAGAGCGAGCAGATCCGG + Exonic
900228194 1:1542598-1542620 TGCCCCAGAGTGAGCAGGCCCGG + Intronic
900561693 1:3310245-3310267 GGCCCCAGAGTGTGCCGGGCAGG - Intronic
900695370 1:4006294-4006316 GGCCCCAGAGTCAGCACAGATGG - Intergenic
901149366 1:7090356-7090378 GGCTGCAGAGAGAGCTGAGGTGG + Intronic
901291465 1:8127452-8127474 AGCTCCAGAGTGTGCAGGTCTGG + Intergenic
901678817 1:10901661-10901683 GGCTCCAGCGTGGGCAGAAGCGG - Intergenic
902632239 1:17711866-17711888 TGCTCCATACTGAGCAGAGGTGG - Intergenic
902732332 1:18377580-18377602 GGGTCCAAAGTGGGCAGAGGTGG + Intronic
903033766 1:20481379-20481401 GGCTCCAGAGGGCCCAGAGTGGG - Intergenic
903794540 1:25918881-25918903 GGCACCAGAGGGGACAGAGCAGG + Intergenic
903953979 1:27012509-27012531 GGCACCTGAGTGGGCTGAGCTGG - Exonic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905468896 1:38176706-38176728 GTGTCCAGAGTGAGCGGAGCAGG - Intergenic
905629561 1:39511108-39511130 GGCTCTGGAGGGGGCAGAGCTGG - Intronic
905668198 1:39775082-39775104 GGCTCTGGAGGGGGCAGAGCTGG + Intronic
906032819 1:42734439-42734461 GGATTCGGGGTGAGCAGAGCTGG + Exonic
908035021 1:60042521-60042543 CTCTCTAGAGTGAGCAGAGTGGG + Intronic
908421464 1:63962652-63962674 GGGTCAAATGTGAGCAGAGCCGG + Intronic
908517060 1:64903411-64903433 GGGGACAGAGGGAGCAGAGCAGG + Intronic
908922127 1:69208072-69208094 GGCTCCAGAGTGAGAGGACTTGG - Intergenic
911226229 1:95308471-95308493 GGCTCCAGAGGGAGTAGAGTTGG + Intergenic
911905982 1:103569589-103569611 GGCTCCAGCATGTGCAAAGCTGG + Intronic
912233085 1:107818100-107818122 GTTTCCAGAGTGAGGAGAGCAGG + Intronic
914808184 1:151007091-151007113 GGCTCCAGAGGGAAAAGAGCTGG - Intronic
915318371 1:155042567-155042589 GGATCCAAAGAGAGCAGAGAGGG + Intronic
915705948 1:157843918-157843940 TGCACCAGAGAGAGCAGAGGAGG + Intronic
915929393 1:160049915-160049937 GGCCCCAGAGTGAGAAGTGCTGG - Intronic
917067352 1:171111446-171111468 GGCTCTAGAATCAGCAGATCTGG - Intronic
917265254 1:173214296-173214318 GGCTCCAGAGTAAACAAAGCTGG - Intergenic
919630531 1:199956236-199956258 GGCCCCAGTGTGGACAGAGCTGG - Intergenic
920417934 1:205811242-205811264 GCCTCCAGATGGAGCAGTGCAGG - Intronic
920696457 1:208184671-208184693 GGCTCAAGGGTGAGCTGGGCGGG - Intronic
922580412 1:226693169-226693191 TGCTCCTGAGAAAGCAGAGCTGG - Intronic
922763949 1:228148163-228148185 GGCTCCAGAGAGAGCAGGAGTGG + Intronic
922786724 1:228286599-228286621 GGCTGCAGAGGGAACAGGGCAGG - Intronic
922789388 1:228302713-228302735 GGCTCACAAGTTAGCAGAGCAGG - Intronic
923331330 1:232927599-232927621 TGAACCTGAGTGAGCAGAGCAGG + Intergenic
923864622 1:237926867-237926889 GGCTCCAGCATGTGCAAAGCTGG + Intergenic
923916894 1:238516893-238516915 GGCAGCTGAGTGAGCAGACCAGG - Intergenic
1062829082 10:593466-593488 GGGTCCCGCGTGGGCAGAGCAGG - Intronic
1063019952 10:2117541-2117563 GGCTCCAGAGGCAGATGAGCAGG - Intergenic
1063359079 10:5434313-5434335 GACTCCAGACTGAGAAGAACAGG - Intronic
1063440338 10:6067801-6067823 GGACCCAGAGTGGGAAGAGCAGG + Intergenic
1063653099 10:7960028-7960050 GTCCCCAGAGTTAGAAGAGCAGG + Intronic
1066004541 10:31134295-31134317 GGCTCCATTGTGAGCGGGGCCGG - Intergenic
1066300534 10:34091852-34091874 GGCTCCACAGTCAGCTGACCTGG - Intergenic
1066659834 10:37728389-37728411 TGCTCCAGAACGAGCAGAACAGG - Intergenic
1067177433 10:43960000-43960022 GGCTGCTGAGTGAGCCGAGGAGG - Intergenic
1069725554 10:70575590-70575612 GGCTGCTGACTGAGCAGGGCAGG + Intergenic
1069821316 10:71230416-71230438 GACATCAGACTGAGCAGAGCAGG + Intronic
1069868239 10:71517404-71517426 GGGTCCAGAGCGTGCAGAGGTGG + Intronic
1070599104 10:77853501-77853523 GGCTCCTGAGTGACCAGACTCGG - Exonic
1071087576 10:81880543-81880565 AGCTCCAGAGAGAGGAGAGATGG - Intronic
1071603051 10:86968343-86968365 TGCTCCAGAGTCCGCAGGGCAGG - Exonic
1073069753 10:100785839-100785861 GCCTCTGGAGTGAGCACAGCAGG + Intronic
1073100327 10:101003040-101003062 GGCTCCAGATTCACCAGACCTGG + Intronic
1073482840 10:103797859-103797881 GGCTGCAGAGTGTGAAGGGCAGG + Intronic
1074545435 10:114398778-114398800 GGCTCCCGAGGGTGCAGACCTGG - Intronic
1075631408 10:124002854-124002876 GGCACCTGGGAGAGCAGAGCTGG - Intergenic
1075978109 10:126714434-126714456 AACTCCAGAGTGTGCAGAGAAGG + Intergenic
1076260282 10:129059620-129059642 GGCTCCAGGATGGGCAGAGCAGG + Intergenic
1076464127 10:130666722-130666744 GAATCCTGAGTGAGCAGATCGGG + Intergenic
1076569079 10:131420487-131420509 GCCCCCAGAGAGAGCAGCGCTGG - Intergenic
1076999613 11:316055-316077 GGCACCCGCGGGAGCAGAGCTGG + Intergenic
1077309739 11:1883006-1883028 GCCCCCACAGGGAGCAGAGCAGG + Intronic
1077350367 11:2090413-2090435 GGCTCCTGGGTGAGCCGAGAGGG - Intergenic
1077432682 11:2523803-2523825 GGCTGCAGGGTCAGCAGACCTGG + Intronic
1079182906 11:18209330-18209352 AGCTCCGGAGGGAGCAGAGCTGG + Exonic
1080420795 11:32108928-32108950 AGTCCCAAAGTGAGCAGAGCAGG - Intergenic
1081761369 11:45578403-45578425 GGCTCCACCATGAGAAGAGCAGG - Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1083572164 11:63766658-63766680 GGTTCCAGCTGGAGCAGAGCAGG + Intronic
1083574994 11:63784031-63784053 GGCTACAGAGTGAGCCGGGGAGG + Intergenic
1083828738 11:65217724-65217746 GGCTCCTGAAAGAGCAGGGCGGG + Intergenic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1084504431 11:69556361-69556383 GGCTGCTGAGGGAGCAGAGCCGG - Intergenic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1085803807 11:79616103-79616125 GGCTCTGGAGTGAGAAGAGCTGG - Intergenic
1085810058 11:79671816-79671838 GGCTTCAGAGTGATTAGAGTTGG + Intergenic
1088498980 11:110463356-110463378 GGCTGCAGGGTGAGCAGCGTGGG + Exonic
1089124761 11:116169088-116169110 GGCTGCAGCAGGAGCAGAGCTGG - Intergenic
1089177145 11:116557209-116557231 GGCTCAGGAAGGAGCAGAGCAGG + Intergenic
1090781158 11:130007832-130007854 GGCTTCAGAGGGAACAGGGCGGG + Intergenic
1091284074 11:134398390-134398412 GGCTGCAGAGAGAGTAGAACTGG - Intronic
1092168128 12:6355440-6355462 GGGTGCAGAGAGAGCAGAGTTGG + Intronic
1092981102 12:13795060-13795082 TTCTCATGAGTGAGCAGAGCTGG - Intronic
1093233129 12:16573669-16573691 CGCTCCAGCTCGAGCAGAGCAGG - Intronic
1096612103 12:52808909-52808931 GGCTCAAGTAGGAGCAGAGCTGG + Intronic
1096754235 12:53785434-53785456 GGCTCCAGCGTGGGCACAACAGG + Intergenic
1096781410 12:53994390-53994412 GGCCGCAGACAGAGCAGAGCGGG + Intronic
1098214624 12:68202569-68202591 GGCAGGAGAGTGAGCAGAGGGGG + Intronic
1100403819 12:94255420-94255442 GGCTTAAGTTTGAGCAGAGCAGG + Intronic
1100976299 12:100125624-100125646 GGCAACAGAGTGAGGGGAGCAGG + Intronic
1101903644 12:108809735-108809757 GGGTTCAGCGTGAGCACAGCAGG - Exonic
1102001638 12:109561252-109561274 TGCTCCAGAGTGGGCAGGGCTGG + Intronic
1102240712 12:111322847-111322869 GGCTCCATGGTGCTCAGAGCAGG + Intronic
1102302593 12:111781524-111781546 GGCTACAGTGTGAGGACAGCTGG - Intronic
1102968547 12:117147871-117147893 GGCTTCAGAGTGATCGGAACTGG - Intronic
1103102460 12:118190651-118190673 GTCACCAGAGTGAGTAAAGCTGG + Intronic
1103414865 12:120737213-120737235 GTCTCCAGAGAGATCAGGGCTGG - Intronic
1104165098 12:126220038-126220060 GACTCCTGAGTTTGCAGAGCTGG - Intergenic
1104721052 12:131045428-131045450 GGCTCCAGGAGGAGAAGAGCGGG + Intronic
1105611813 13:21975430-21975452 GGTTCAAGAGTGAGGAGAGCAGG - Intergenic
1105642014 13:22275398-22275420 GGATCCCCAGTGGGCAGAGCTGG + Intergenic
1106707221 13:32294037-32294059 GGCTCAAGAGTGAGTAGATCTGG - Intronic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1115521278 14:34235132-34235154 CCCTACAGAATGAGCAGAGCAGG + Intronic
1116105702 14:40501570-40501592 GGAGCAAGAGTGAGCAAAGCTGG + Intergenic
1117769712 14:59120911-59120933 GGCTCCAGACTGAACAGACATGG - Intergenic
1117932742 14:60861467-60861489 AGCTCCACAGTGAGCAAAACAGG - Intronic
1119646055 14:76349280-76349302 GGCTCCAAAGGGTGCAAAGCGGG + Intronic
1119689049 14:76656310-76656332 GGCTCCTGAGGGAAAAGAGCAGG + Intergenic
1119842052 14:77800473-77800495 GGCACCCGAGTGGGCAGAGCTGG + Intronic
1120875525 14:89371718-89371740 GGCACCAGAGCAAGCAGAGAGGG + Intronic
1121609172 14:95264100-95264122 GGCTGCAGTGTGAGCTGAGATGG - Intronic
1122838545 14:104443285-104443307 GGGTCCAGAGTGGGGAGGGCCGG - Intergenic
1122896486 14:104760105-104760127 GACTCCAGAGGGAGCACAGCTGG - Intronic
1124240735 15:28025634-28025656 GGCTGCTGAGTGAGCAGAGAAGG - Intronic
1125754426 15:42053248-42053270 CGCTGGAGAGTGAGCAGAGAGGG + Intergenic
1126053863 15:44711652-44711674 GGCCACAGAGGGTGCAGAGCGGG - Intronic
1126143405 15:45455344-45455366 AGGTCCAGAGTTGGCAGAGCAGG + Intergenic
1127859350 15:62980190-62980212 TTCTCCAGAGTGAGCAATGCAGG + Intergenic
1127888005 15:63221018-63221040 GGGTAGAGAGTGAGCAGAGTTGG + Intronic
1127990495 15:64111848-64111870 GGTACCAGAGTGAACAAAGCTGG - Intronic
1128983675 15:72203697-72203719 GGCAACAGATTGAGCAGCGCTGG + Intronic
1129175410 15:73836403-73836425 TACTTCAGAGTTAGCAGAGCTGG + Intergenic
1129298216 15:74611296-74611318 AGCTCCAGAATGCCCAGAGCTGG - Intronic
1129661357 15:77554733-77554755 GGCTGAAGAGGGAGCAGAGAGGG + Intergenic
1129680981 15:77658165-77658187 GACTCCAGGGTGGGCAGGGCAGG - Intronic
1129714189 15:77837410-77837432 GAGTCCAGTGTGACCAGAGCTGG - Intergenic
1129776060 15:78237213-78237235 GGCCCCAGAGTGCTCAGCGCGGG + Intronic
1130658023 15:85806199-85806221 GGCGACAGAGTGAACAGAGCAGG + Intergenic
1130917073 15:88313549-88313571 GGCTCATAAGTCAGCAGAGCTGG + Intergenic
1132352391 15:101148152-101148174 GGCTCCAAAGCCAGCAGACCTGG - Intergenic
1132622183 16:873021-873043 GGCTCCAGAGAGCACAGATCTGG + Intronic
1132777782 16:1605369-1605391 GGCTGAAGAGTGAGTAGAGGAGG + Intronic
1134156109 16:11844607-11844629 GTCTCCAGGTAGAGCAGAGCAGG - Intronic
1134204226 16:12224006-12224028 GGCTCTGGAGTGAGGAGACCTGG - Intronic
1134915260 16:18063983-18064005 AGCTCCAGAGTGTGCAAAGATGG + Intergenic
1135228128 16:20679313-20679335 GCCTCCAGTGTGGTCAGAGCAGG - Intronic
1135345760 16:21687215-21687237 GGCTCCACAGTGAGTGGAGCAGG + Intronic
1135381194 16:21997493-21997515 GGCTCCGAAGTGAGTAAAGCTGG + Intronic
1136228186 16:28872697-28872719 GACAGCAGGGTGAGCAGAGCAGG + Exonic
1136716910 16:32288819-32288841 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1137628262 16:49923061-49923083 GGCTCTGGGGTGAGCAGATCTGG + Intergenic
1138443064 16:57046689-57046711 GGCGTCAGAGGGGGCAGAGCTGG + Intronic
1140480833 16:75262076-75262098 GGCTCTAGAGTGAACAGTGTTGG - Intronic
1142187469 16:88701354-88701376 GGCGGCAGAGTGGGCACAGCGGG + Exonic
1142325269 16:89410911-89410933 GGCCACAGAATAAGCAGAGCTGG + Intronic
1203145458 16_KI270728v1_random:1795385-1795407 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1143376711 17:6471465-6471487 GGCTGGCAAGTGAGCAGAGCCGG - Intronic
1143421719 17:6798497-6798519 GGCTTCCCAGTGAGCAGAGAGGG + Exonic
1143681891 17:8481921-8481943 GGCTCAAGTGTTTGCAGAGCTGG + Intronic
1144776785 17:17788803-17788825 GGCTCCTGAGGGAGCCCAGCTGG - Intronic
1144954094 17:19010455-19010477 GACTCCAGAGTAAGCAGCCCCGG - Intronic
1145772290 17:27502179-27502201 GGCTCCAGAATCAGCAGACCTGG - Intronic
1147451366 17:40506844-40506866 GGATCAAGAGAGAACAGAGCAGG + Intergenic
1148199211 17:45738100-45738122 GGAGCCAGAGTGTGCAGAGATGG - Intergenic
1149516320 17:57283697-57283719 GGCTCCAGAGTCAGCCAAGTTGG + Intronic
1149571238 17:57673825-57673847 AACTCCAGAGTGAGAACAGCAGG - Intronic
1149665530 17:58362647-58362669 GGCTGGGGAGTGAGCAGAGAGGG + Exonic
1149934218 17:60787826-60787848 GGGTGCAGAGTGAGCAGTGTGGG + Intronic
1150486220 17:65545831-65545853 GGGGCCTGAGTGTGCAGAGCAGG - Intronic
1150677571 17:67258048-67258070 GGGTCCTGAGTCAGCAGAGCAGG + Intergenic
1151882956 17:76905864-76905886 GGCACCAGAGTGACCAGATCGGG - Intronic
1152226440 17:79095012-79095034 AGCTCCTTAGAGAGCAGAGCTGG + Intronic
1153690696 18:7590392-7590414 GTCTCCAGAGTGTGCACACCTGG + Intronic
1155154741 18:23148823-23148845 GGCACAGGTGTGAGCAGAGCTGG + Intronic
1155623983 18:27813399-27813421 GGCCAAGGAGTGAGCAGAGCAGG + Intergenic
1156389621 18:36638384-36638406 GGTTGCACAGTGAGCAGACCAGG + Intronic
1156697800 18:39788458-39788480 GGCTACATAGTAAGCAGAGGGGG + Intergenic
1157808988 18:50679800-50679822 GGCCCCACTGTGAGCAGAGATGG + Intronic
1160941190 19:1621170-1621192 GGCTCCCGAGGGACCACAGCTGG - Exonic
1161078279 19:2297258-2297280 GGGTCCTGGGGGAGCAGAGCAGG - Intronic
1161713595 19:5863549-5863571 GGTTCCAGAGTGGGCAGGCCAGG + Intergenic
1161731690 19:5964704-5964726 GGCAGCAGAGTGAGGAGTGCTGG + Intronic
1163087523 19:14993020-14993042 GGCCCCAGAGGGAGCAGAGGAGG + Intronic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164054456 19:21610008-21610030 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1166423314 19:42654798-42654820 AGCTCTGGAGGGAGCAGAGCAGG + Intronic
1166664351 19:44669835-44669857 TGATCCAGAGTGATCAGGGCTGG - Intronic
1166711404 19:44939925-44939947 GGCCCCAGCGTGAGCACAGTAGG - Intergenic
1167204264 19:48089711-48089733 CTTTCCAGAGTGAGCAGTGCAGG + Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168105414 19:54163104-54163126 GATTCCAGAGAGAGAAGAGCAGG + Exonic
926656350 2:15411166-15411188 GGCTCCAGGGTCAGCTGACCAGG + Intronic
927050626 2:19324765-19324787 GTCTCCAAAGTGAGGAGAGGGGG - Intergenic
927471297 2:23379581-23379603 GGCTACAGGGGGAGCACAGCAGG - Intergenic
927840017 2:26435063-26435085 GTCTCTAGAGTCAGCAGAGAAGG + Intronic
928291177 2:30038601-30038623 AGCAGCCGAGTGAGCAGAGCCGG - Intergenic
928403246 2:30994348-30994370 GGCTCCACAGACAGCAGTGCAGG + Intronic
929867339 2:45729441-45729463 GGCTCCAGGGAGGGCCGAGCTGG - Intronic
929922233 2:46180844-46180866 GGCACCAGAATGAGCTCAGCCGG + Intronic
929960683 2:46494062-46494084 GGGACCCGAGTGAGCAGAGAGGG + Intronic
930023137 2:47013390-47013412 TGAGCCAGAGTGTGCAGAGCAGG + Intronic
931228772 2:60356521-60356543 GGCCCCAGAGTGTGGAGAACAGG + Intergenic
931345479 2:61441437-61441459 GGCTGCAGAGAGACTAGAGCTGG + Intronic
931933697 2:67170906-67170928 GGCTCCAGAGAAAGCAGAGGAGG + Intergenic
932173518 2:69578629-69578651 GGCTTCAGATAGAGGAGAGCAGG - Intronic
932453073 2:71828156-71828178 GGCTGCAGAGGGTGTAGAGCAGG - Intergenic
932636027 2:73388432-73388454 GGCTCCAGAAGGAGGAGAGAAGG - Intronic
933723870 2:85415152-85415174 GTCTGCAGAGTGAGCAGAGTTGG - Intronic
933863853 2:86498349-86498371 GGTTCCAGAGGGAACAAAGCAGG - Intergenic
934614306 2:95761783-95761805 CCCAGCAGAGTGAGCAGAGCTGG + Intergenic
934646595 2:96062704-96062726 CCCAGCAGAGTGAGCAGAGCTGG - Intergenic
934662479 2:96150479-96150501 GGCTCCCCTGTGACCAGAGCTGG + Intergenic
935032717 2:99337713-99337735 GGGCCCAGAGTGTGCGGAGCGGG + Intronic
935098387 2:99968990-99969012 GGCTGCAGAAAGAGCACAGCAGG + Intronic
935366449 2:102296583-102296605 GCCTCAAGTGTAAGCAGAGCTGG + Intergenic
937451958 2:122009546-122009568 GGCTCCCGAGAGGGCAGACCAGG + Intergenic
938539950 2:132277543-132277565 GGGCCCAGAGTGAGAAGACCAGG + Intergenic
942088034 2:172461817-172461839 GGCTCCTGAGCTAGCAGAGTGGG - Intronic
944607365 2:201363959-201363981 GGGGCCAAAATGAGCAGAGCTGG - Intergenic
946200618 2:218068866-218068888 CGCTCCAGAGTGGGGAGGGCAGG - Intronic
947515353 2:230799376-230799398 TGATCCAGTGTGAGCAGAGATGG - Intronic
947597312 2:231421232-231421254 GTCCCCAGAGTGAGAGGAGCGGG - Intergenic
947752263 2:232539342-232539364 GGCTCCAGAGAGGGCTGAGGTGG - Intergenic
948434513 2:237944056-237944078 GGCTCCTGAGTGGGAAGAGGAGG + Intergenic
948594089 2:239068307-239068329 GGCCCCAGAGAGCCCAGAGCAGG - Intronic
1168840552 20:907340-907362 GGCTGCAGAGGGAGGGGAGCAGG + Intronic
1168874346 20:1160620-1160642 GGCTCCAGCATGTGCAAAGCTGG + Intronic
1169310283 20:4532219-4532241 GGATCCTGAGGGAGCACAGCTGG - Intergenic
1170161135 20:13312618-13312640 GGCCCCAGAGGCAGGAGAGCAGG - Intergenic
1170390541 20:15868298-15868320 GGGTACAGAGTGAACAGAGAGGG - Intronic
1170578790 20:17682576-17682598 GGGCCCAGAGTGGGCGGAGCTGG - Intergenic
1170651358 20:18245490-18245512 GGCTCCAGAAAGGACAGAGCTGG - Intergenic
1171003201 20:21435747-21435769 GTCTCCGGAGAGAGCAGAGCAGG + Intergenic
1171167501 20:22984823-22984845 GGCTCCAGGGTGTGCAGTGAAGG - Intergenic
1171218145 20:23367995-23368017 GACTTCAGAATGAGCAGAACTGG - Intronic
1171345394 20:24462026-24462048 GGCTCCTGGGGGAGCAGAGAGGG - Intergenic
1172379056 20:34473428-34473450 GGCTCCAGGGTGAGCAGCGTGGG - Intronic
1172893522 20:38283733-38283755 GGCTCCAGAGAGATCTGAGCTGG + Intronic
1173247065 20:41344295-41344317 TGCTCTAGAGTCAGGAGAGCTGG + Intronic
1174135963 20:48379723-48379745 AGCTAGAGAGTGAGGAGAGCTGG - Intergenic
1174254232 20:49242406-49242428 GGCTCCGGAGTCAGAAAAGCTGG - Intronic
1174419800 20:50391955-50391977 GACTCCAGTGGGAGCAGAGGTGG + Intergenic
1174478045 20:50811134-50811156 GGCTCCAGATGGAGTAGGGCTGG + Intronic
1174527887 20:51188303-51188325 CGCTCCAGAGGCATCAGAGCAGG - Intergenic
1174783907 20:53414831-53414853 GGCTCCTGAGTGGGCAGACCTGG + Intronic
1174858440 20:54068386-54068408 AGCACCAGGGTGAGCATAGCAGG + Intronic
1175355932 20:58368065-58368087 GGAACCAGAGAGAGCAGAGAGGG + Intergenic
1176039712 20:63058939-63058961 GGCTCCAGAGCGCACAGAGGTGG + Intergenic
1176298687 21:5088329-5088351 GGTGCCAGGGTGAGCAGGGCAGG + Intergenic
1176346348 21:5751893-5751915 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176353162 21:5872477-5872499 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176498479 21:7572562-7572584 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1176540669 21:8149963-8149985 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176559620 21:8333008-8333030 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1178083310 21:29088117-29088139 CACTCAAGAGAGAGCAGAGCTGG + Intronic
1178724917 21:35042745-35042767 AGTTCCAGAGTGAGCAGTCCAGG - Intronic
1179623967 21:42637845-42637867 GGCTTGAGAGTCAGCGGAGCTGG - Intergenic
1179825072 21:43959837-43959859 GGCTCCAGAGTGAGTAGGCGAGG - Exonic
1179858339 21:44173620-44173642 GGTGCCAGGGTGAGCAGGGCAGG - Intergenic
1179990288 21:44944716-44944738 GGCTTCACAGTCGGCAGAGCTGG + Intronic
1180613525 22:17112833-17112855 GTCTCCTGAGTGTGCAGAGGTGG + Exonic
1181393912 22:22604542-22604564 GGCTCCCTAGTGAGCAGACAAGG - Intergenic
1181429882 22:22872863-22872885 GGCTCCTTGGTGAGCAGAGAAGG - Intronic
1181535068 22:23537589-23537611 GGCTGCAGAGTGGAGAGAGCAGG + Intergenic
1181845300 22:25702910-25702932 GACTCCAGAGTCAGAAAAGCTGG - Intronic
1182125825 22:27815321-27815343 CGCCCCAGACTGAGCAGGGCTGG - Intergenic
1182296943 22:29315495-29315517 AGCTCGAGAGAGAGCAGAGCCGG + Exonic
1182621066 22:31618871-31618893 GGCACCAGAGTGAACAGGGCAGG - Exonic
1182829769 22:33295574-33295596 GCCTCCAGAGTGAGCAGCACAGG - Intronic
1182898138 22:33875508-33875530 GACTCCAGGCTGAGCAGAGATGG + Intronic
1183627731 22:39014874-39014896 GCCTCCACTGTGAGCAGAGTAGG + Intronic
1183745381 22:39688809-39688831 GGCTCCAGGGTCCACAGAGCAGG + Exonic
1185224965 22:49647122-49647144 GGGCCCAGAGGGAGCAGAGGAGG + Intronic
1203245610 22_KI270733v1_random:66381-66403 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
949231762 3:1757819-1757841 GGCGCCATGATGAGCAGAGCTGG - Intergenic
949352051 3:3133491-3133513 GGCTGCAGAGTGAGCTGTGGTGG + Intronic
950064977 3:10104741-10104763 GGGTCCATGGTGACCAGAGCTGG + Exonic
952698758 3:36303034-36303056 TGCTCCTGAGTGAGGAGAGTAGG - Intergenic
953290241 3:41653205-41653227 GGCTCTGGAGTGATCAGGGCAGG - Intronic
953584163 3:44184882-44184904 GGCTCCAGTATGAGCAGATTTGG - Intergenic
953839175 3:46374945-46374967 GGATGCAGAGTCAGCAGAACTGG + Exonic
953972057 3:47355599-47355621 GGCCCCAGAGTGAGCTGGACAGG + Intergenic
953983892 3:47426888-47426910 GGCTCAAGAGAGACCAGAGGAGG + Intronic
954396816 3:50297417-50297439 GGATCCAGAGTCAGCTCAGCTGG + Exonic
954400609 3:50317645-50317667 AGCTCCAGAGTGGGCAGCTCTGG + Intergenic
954439955 3:50516410-50516432 GGCTACAGGGGCAGCAGAGCAGG - Intergenic
956001952 3:64739129-64739151 GGCTCCAGGGTGAGCAGTGGAGG - Intergenic
956449899 3:69363731-69363753 GGCTCCCCATTGACCAGAGCTGG + Intronic
956964779 3:74446086-74446108 GGCTGCAGAGTCAGAAGAACTGG + Intronic
957858515 3:85912004-85912026 GCTTGCAGAGTGAGCAGAGATGG - Intronic
959338991 3:105103804-105103826 GGCTGCAGAATGTGCAGATCAGG + Intergenic
960476256 3:118132536-118132558 GTCTCTAGAGTTAGCATAGCTGG + Intergenic
960494418 3:118358051-118358073 GGCTCCAGTGAGGGCACAGCAGG + Intergenic
960634890 3:119774945-119774967 GGTTCTGGAGGGAGCAGAGCAGG + Intergenic
960742150 3:120846216-120846238 AGCTCTGGAGTGAGCAGAGCTGG + Intergenic
962648789 3:137467046-137467068 GGCTCCAGAGTGCGTAGAGCAGG - Intergenic
963152222 3:142057126-142057148 GGATCCAGAGGGACCACAGCTGG + Intronic
965923272 3:173945371-173945393 GCCTCTGGAGTGTGCAGAGCTGG + Intronic
966887875 3:184386728-184386750 AGGTGCAGAGTGAGCAGAGCGGG - Exonic
967086005 3:186095920-186095942 GTGTCCACAGTGCGCAGAGCAGG + Intronic
967095375 3:186173438-186173460 GGCCCCACTGTAAGCAGAGCTGG - Intronic
967275831 3:187773725-187773747 GGCTCCTGAGAGAGAACAGCGGG + Intergenic
968664586 4:1814155-1814177 GGCTCCAGAGGCAGCTGGGCTGG - Exonic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
970167638 4:13256558-13256580 GGCCTCAGAGTGAGAAGATCTGG - Intergenic
970347517 4:15167842-15167864 AGCTGCAGAGAGAGAAGAGCTGG - Intergenic
971264931 4:25088865-25088887 GCCTCCTGAGCGAGCAGCGCCGG - Intergenic
971600655 4:28587111-28587133 GGATCCAAAGACAGCAGAGCAGG - Intergenic
973757625 4:54091268-54091290 GGCTCCAGGACCAGCAGAGCGGG + Intronic
974639158 4:64607124-64607146 GGGCCCAGAGTGAGGAGAGTAGG + Intergenic
975363621 4:73502309-73502331 AGCTCCAAATGGAGCAGAGCAGG + Intronic
975418529 4:74135005-74135027 TGTTCAAGAGAGAGCAGAGCAGG + Intronic
975612333 4:76214627-76214649 GACACCACAGTGAGCAAAGCAGG - Intronic
975804999 4:78102969-78102991 TGCTCCAGAATGAGCAGAGGTGG - Intronic
976288321 4:83391444-83391466 GGCACCAGAGTGAGCAAAGTGGG - Intergenic
978761546 4:112359223-112359245 GGGTCCAGAGCGCCCAGAGCAGG + Intronic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
980650280 4:135704644-135704666 GGCTCCAGGGTGATTAGAGTAGG + Intergenic
981012401 4:139938992-139939014 GTCTTCACAGTGCGCAGAGCGGG - Intronic
984877802 4:184384965-184384987 GGGGCCAGAGTTATCAGAGCAGG - Intergenic
985913706 5:2902140-2902162 GGCTTCAGGTTGGGCAGAGCAGG - Intergenic
988124730 5:27014805-27014827 GGGTTCAGAGTGGGCAGATCAGG - Intronic
991006496 5:61832987-61833009 GGCTCCAGCATGTGCAAAGCTGG - Intergenic
994744587 5:103663217-103663239 GGCAGGAGAGAGAGCAGAGCAGG + Intergenic
997519282 5:134512316-134512338 GGCTCCTGAGACAGCAGAGTGGG - Intergenic
998075995 5:139236821-139236843 TGCTCAAGAATGAGCAGAGATGG - Intronic
998380455 5:141721273-141721295 GGCTCCAGAGTGAAGAAAGCAGG - Intergenic
999125573 5:149243595-149243617 GGTTCCAGAGGGGGCTGAGCAGG + Intronic
999257347 5:150216913-150216935 GGCGGCAGGGTGAGCAGAACAGG - Intronic
1000335790 5:160240381-160240403 GGCTGCAAATTGCGCAGAGCTGG - Intergenic
1002259573 5:177984198-177984220 GGTACCAGAGGGAGCCGAGCTGG + Intergenic
1002454611 5:179338987-179339009 GGTTCCAGAGGCAGCCGAGCAGG + Intronic
1002824871 6:763614-763636 GCCTTCAGAGGGAGCACAGCAGG + Intergenic
1003324411 6:5081911-5081933 GGCTGCAGACTGAGCAAGGCTGG + Intergenic
1003512038 6:6789851-6789873 GGCTCCAGAGTGATGAGTGGAGG - Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1005415814 6:25599223-25599245 GGCTCCAGAATGAGGAGACGCGG - Intronic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1007180633 6:39926920-39926942 ACCTCCAGAGTCAGCAGTGCTGG + Intronic
1007257616 6:40539829-40539851 GGCCCCACAGTGAGTAGGGCAGG - Intronic
1007275737 6:40672301-40672323 GGCAGCAGAGAGGGCAGAGCAGG + Intergenic
1007565435 6:42846656-42846678 GGCTCCAGATTGAGCAGCAGAGG - Intronic
1008456156 6:51713429-51713451 GGCTTCATAGTGAGTAGAGGAGG - Intronic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1011443502 6:87412412-87412434 GCCTACAGAGTGAGCAGTGAAGG + Intronic
1012536541 6:100305154-100305176 TGCTCCTAAGAGAGCAGAGCAGG + Intergenic
1013163955 6:107572968-107572990 GGCTCCCGCGTGAGCAGCCCAGG - Intronic
1016442072 6:144094826-144094848 GGCTCCGGAAAGAGCTGAGCGGG - Intergenic
1017971173 6:159314142-159314164 GGCTCAAGGCTCAGCAGAGCTGG - Intergenic
1018740065 6:166721723-166721745 GGCGGCAGAGTTAGCAGAGCTGG + Intronic
1019046725 6:169155430-169155452 GGGTGCAGGGTGAGCAGGGCAGG + Intergenic
1019304098 7:324353-324375 GGCTCAGGAGAGGGCAGAGCTGG - Intergenic
1022673421 7:32476886-32476908 GGGTCCAGAGTGGGATGAGCTGG - Intergenic
1024242248 7:47444644-47444666 AGCTGCAGAGTGAGAAGGGCAGG + Intronic
1024497644 7:50066809-50066831 GCCTCCAGTGTGGTCAGAGCAGG + Intronic
1024526770 7:50355839-50355861 GAGGCCACAGTGAGCAGAGCAGG + Intronic
1025614265 7:63104756-63104778 GGCTCCAGAGTTGGAAGAGGTGG - Intergenic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1028752233 7:94394424-94394446 GGCTCCAGCGGGAGCGGAGGGGG - Intergenic
1029110114 7:98209741-98209763 AGCTCCAGAGGGACCAGGGCAGG - Intergenic
1029637149 7:101792613-101792635 GGCGCCAGTGTGAAAAGAGCCGG - Intergenic
1029946088 7:104534422-104534444 GGCTCCTGCTTCAGCAGAGCTGG + Intronic
1030093520 7:105877395-105877417 TGCTCCAGGGTCAGCAGAGCGGG + Intronic
1030622236 7:111802402-111802424 GGCAGCAGAGAGAGCATAGCTGG - Intronic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033305880 7:140225123-140225145 GGCTACAGAGTTGGCAGTGCCGG + Intergenic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1033597887 7:142869424-142869446 GACTCCAGAGTCAGCACAGCTGG + Intronic
1034217523 7:149420035-149420057 GGCAGCAGAGGGGGCAGAGCAGG + Intergenic
1034264147 7:149773169-149773191 AGCGCCATTGTGAGCAGAGCCGG - Exonic
1034443637 7:151100923-151100945 GGCTGCAGGGAGAGCAGAGTCGG - Intronic
1034919080 7:155064570-155064592 GGCTACGGAGGGAGCAGAGAAGG - Intergenic
1034956314 7:155337575-155337597 GGTTGCTGAGTGAGCAGAACTGG - Intergenic
1035050235 7:155994522-155994544 GGCTCAGGAGGGAGCTGAGCAGG - Intergenic
1035756162 8:2034498-2034520 GGCTCCAGAGCGAGCTGGGAGGG - Intergenic
1036220056 8:6913977-6913999 GGCACCACAGTGAGCAGGGAAGG - Intergenic
1036398393 8:8387020-8387042 GGCGCCGGAGGGAGCAGGGCTGG + Intergenic
1036669548 8:10772406-10772428 GGTTCCATAGAGAGAAGAGCAGG - Intronic
1037665299 8:20963878-20963900 GAAACCAGAGTGAGAAGAGCTGG + Intergenic
1037787005 8:21909213-21909235 GGCTCCAGAAGGGGCAGAGGAGG + Exonic
1038328230 8:26588451-26588473 AGATCCAGAGTGTGCAGATCCGG - Intronic
1039798245 8:40933335-40933357 TGATCCTGAGTGTGCAGAGCGGG - Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1041381565 8:57258662-57258684 GGCTGCAGAGTGCCCAGCGCCGG + Intergenic
1043745485 8:83869229-83869251 GGCTCCAGAGAATGCAGAGTAGG - Intergenic
1044781405 8:95747091-95747113 AGGTCCAGAGTCAGCAGATCAGG + Intergenic
1044793279 8:95870184-95870206 AGGTCCAGAGTCAGCAGATCAGG + Intergenic
1045252095 8:100490791-100490813 GGCTCCAGGGGCAGCAGATCTGG + Intergenic
1047217890 8:122893421-122893443 GGTTCCAGAGGGAGAAGAGATGG - Intronic
1048194950 8:132324808-132324830 GGCTCTGGAGCCAGCAGAGCTGG - Intronic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1049022294 8:139965775-139965797 GGCTCCATGTTGAGCAGAGTTGG + Intronic
1049107728 8:140624206-140624228 GGCTCCAGAGGGGGCAGAGCCGG - Intronic
1049210712 8:141385243-141385265 GTCCCCACAGGGAGCAGAGCAGG - Intergenic
1049593489 8:143472972-143472994 GGCTCCAGCTTCCGCAGAGCAGG + Intronic
1050252383 9:3758582-3758604 GGCTGCAGAGAAAGCAGAGGTGG - Intergenic
1052836545 9:33254451-33254473 GGCACCAGAATGAGTAAAGCAGG - Exonic
1052836655 9:33255153-33255175 CGCTCCAGAGACGGCAGAGCTGG + Exonic
1055269384 9:74540246-74540268 GGGCACAGAGTGAGCAGAGGGGG - Intronic
1055594517 9:77851443-77851465 GGCTCCTGAGAAAGTAGAGCTGG + Intronic
1056449452 9:86701674-86701696 GGCTCTAAAGTCAGCAGGGCAGG - Intergenic
1056635870 9:88330801-88330823 GGCTCTATAGTGAGCATGGCTGG - Intergenic
1056923823 9:90815334-90815356 GGCACCCCAGTGAGCAGAGGTGG + Intronic
1057743176 9:97730234-97730256 GGCTACAGACTGTGCTGAGCTGG + Intergenic
1057800896 9:98191224-98191246 AGGTCCGGAGTGAGGAGAGCCGG - Intronic
1058580624 9:106452568-106452590 GGCTTCAGAGTGACCACATCTGG - Intergenic
1059299016 9:113298004-113298026 GGCGACAGAGTGGGCACAGCAGG + Exonic
1059409834 9:114124893-114124915 GCCTCCAGAGTGGGGAGGGCAGG - Intergenic
1060028243 9:120191390-120191412 GGCTCAAGAGTGACCACAGGTGG + Intergenic
1060552552 9:124492474-124492496 GGCTCCAGAGAGCTCAGAGTCGG - Intronic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061264873 9:129499089-129499111 GGTTCCAGAGTGACCAGGGCTGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1061801227 9:133114386-133114408 GGCTCCAGAGAGAGCTGCCCTGG + Intronic
1062070438 9:134552544-134552566 GACCCCAGTGTCAGCAGAGCTGG - Intergenic
1062237979 9:135521770-135521792 GGGTGCAGAGTGGGCAGGGCTGG + Intronic
1062562194 9:137146576-137146598 GGCTGCAGAGAGATCAGAGCTGG + Intronic
1203461948 Un_GL000220v1:49453-49475 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1185643624 X:1601467-1601489 GGCACCGGAGGGAGCGGAGCCGG + Exonic
1186468735 X:9804765-9804787 GGCTCCAGACTGGGCAGTGCTGG - Intronic
1186509231 X:10117747-10117769 GGGTCCAGAGTGAGGATGGCTGG + Intronic
1189129102 X:38479957-38479979 TGCTCCAGAGAGGGCAGAGCTGG - Intronic
1189611688 X:42743285-42743307 GACTCCAGGGTCTGCAGAGCTGG + Intergenic
1190006554 X:46745229-46745251 GGTTCCAGATGGAGCAGAGCAGG + Intronic
1190862769 X:54359342-54359364 GGCTCTGGAGTGAGCACACCTGG - Intergenic
1193826736 X:86235517-86235539 AGCTCCAAAGTTAGCAGAGAAGG - Intronic
1196100305 X:111840692-111840714 GGCTTCAGAGTCAAAAGAGCTGG - Intronic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1198750806 X:139934379-139934401 GGCTCAACTGTGAGCAGAGAAGG - Intronic
1198786537 X:140294993-140295015 GGGTCCAAAATGAACAGAGCAGG + Intergenic
1199731052 X:150632544-150632566 GGCTGCAGTGTGTGCAGAGTAGG + Intronic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic