ID: 1049012933

View in Genome Browser
Species Human (GRCh38)
Location 8:139899662-139899684
Sequence CAGCTTGCAGAGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 1, 2: 8, 3: 55, 4: 659}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049012933_1049012938 6 Left 1049012933 8:139899662-139899684 CCATCTTCCTTCTCTGCAAGCTG 0: 1
1: 1
2: 8
3: 55
4: 659
Right 1049012938 8:139899691-139899713 TCAGAGCAGGGTCACTGCTCTGG No data
1049012933_1049012937 -6 Left 1049012933 8:139899662-139899684 CCATCTTCCTTCTCTGCAAGCTG 0: 1
1: 1
2: 8
3: 55
4: 659
Right 1049012937 8:139899679-139899701 AAGCTGCATGGTTCAGAGCAGGG No data
1049012933_1049012936 -7 Left 1049012933 8:139899662-139899684 CCATCTTCCTTCTCTGCAAGCTG 0: 1
1: 1
2: 8
3: 55
4: 659
Right 1049012936 8:139899678-139899700 CAAGCTGCATGGTTCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049012933 Original CRISPR CAGCTTGCAGAGAAGGAAGA TGG (reversed) Intronic
901242084 1:7701322-7701344 CCTGTTGCAGAGGAGGAAGAAGG - Intronic
901509578 1:9710085-9710107 CAGCTGGCACAGAAGGGAGATGG - Intronic
901698739 1:11031462-11031484 GAGCTTGCAGAGAGCCAAGATGG + Intronic
902034110 1:13444020-13444042 CAGCTTGGAGAGGGGCAAGAGGG + Intergenic
902058581 1:13622609-13622631 CAGCTTGCAGAGAACCAGGAAGG - Intergenic
902276623 1:15344712-15344734 CACCTTGCAGAGGAGGAAACAGG - Intronic
902470059 1:16643001-16643023 GGGCTGGCAGAGAAGGAAGGAGG - Intergenic
902545437 1:17186696-17186718 CTCCTTGCAGAGAGGGCAGAAGG + Intergenic
903313323 1:22478310-22478332 GAGCTTGCAGTGAACCAAGATGG - Intronic
903451432 1:23456152-23456174 CATCCTGCAGAGAATAAAGAAGG - Exonic
903596807 1:24501890-24501912 TAGCCGGCAGAGAAGGAAGCAGG - Intergenic
904185211 1:28698608-28698630 GAGCTTGCAGTGAGGCAAGATGG + Intronic
904752917 1:32752279-32752301 CATTTTGCAGGGAGGGAAGAGGG + Intronic
905022380 1:34826719-34826741 CAGCTTGCCGTGCAGGAAGCTGG + Intronic
905273593 1:36802721-36802743 CAGCTTGCATGGAAGGCAGTGGG + Intronic
905298076 1:36967240-36967262 CAGCTTGCAGTGAAGAAGGGAGG - Intronic
905789470 1:40782718-40782740 CAGCTTTCCGTGGAGGAAGAGGG + Intergenic
906149098 1:43577454-43577476 CAGCTGGAGGTGAAGGAAGAGGG - Intronic
906652921 1:47525874-47525896 GTGGTTCCAGAGAAGGAAGAGGG + Intergenic
906661480 1:47585921-47585943 CAGCCAGAAGAGGAGGAAGAGGG + Intergenic
907056432 1:51373099-51373121 CAGGATGTAGAGAAGAAAGAAGG + Intronic
907334413 1:53690973-53690995 CAGCTAGCAGTGAAGGAGCAGGG + Intronic
907987329 1:59544951-59544973 CAGCCATCAGGGAAGGAAGATGG - Intronic
908335761 1:63121125-63121147 CAGCTTGCAGGGGAAGATGATGG + Intergenic
908756653 1:67474739-67474761 GAGGTTGCAGAGAGGCAAGATGG + Intergenic
909049661 1:70752904-70752926 CAGCTTGCAGAGCACAGAGAAGG - Intergenic
909542152 1:76803223-76803245 CAGCCTCCAGGGAGGGAAGAGGG - Intergenic
909694434 1:78450161-78450183 CATTTGACAGAGAAGGAAGATGG - Intronic
910189722 1:84583297-84583319 TGGCTGGCAGAGAAGGGAGAAGG - Intergenic
911978494 1:104534616-104534638 CATCTGGCATGGAAGGAAGATGG - Intergenic
912080292 1:105927868-105927890 CATGTTACAAAGAAGGAAGAAGG - Intergenic
912254988 1:108049156-108049178 CAGCCTGCAAAGAAGGACAAGGG + Intergenic
912514082 1:110207262-110207284 CAGGTTTCAAAGAAGGAAGATGG + Intergenic
912822197 1:112877002-112877024 CAGCTAGAAGAGAAGGAGGGTGG + Intergenic
912836366 1:112999990-113000012 CAGCTTCCAGGGAGGGAAGAGGG - Intergenic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
913349623 1:117842924-117842946 CTGCTTGCAGAGCACAAAGAAGG + Intergenic
914227459 1:145732845-145732867 AAGAATGCAGAGAAGGAAAATGG + Intronic
915119432 1:153619462-153619484 CAGCTTTCTGAGAAAGAGGAGGG - Intronic
916023546 1:160814789-160814811 AAGCTTTCAGAGAAGGAATCTGG - Intronic
917512578 1:175680586-175680608 CAGCTTGAAGTGAAGCACGAAGG + Intronic
917765028 1:178206473-178206495 CATCTTCCAGATGAGGAAGAAGG + Intronic
917786089 1:178458768-178458790 CTGCTTGAAGAGAAGGAAGGGGG - Intronic
918292547 1:183122739-183122761 GAGCTCACAGAGAAGGAGGAGGG + Intronic
918508280 1:185281698-185281720 CAGGGTGCAGAGAAGAAAGACGG + Intronic
918526422 1:185469582-185469604 GAGCATGAAGATAAGGAAGAAGG + Intergenic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
919931102 1:202222135-202222157 GAGCGTGCAGAGCTGGAAGAGGG - Intronic
920128038 1:203709298-203709320 CAGCCTCCAGAGAAGGAGGGAGG + Exonic
920335870 1:205244779-205244801 CGGCTAGCAGAGAAGGAGGTGGG + Intronic
920634279 1:207684032-207684054 CAGATTGCACAGAAGGAATTCGG - Intronic
921264739 1:213412759-213412781 CAACTTGCAGAGCAGGAGGCAGG - Intergenic
921294365 1:213688235-213688257 GAGCTTGGGGAGAAGGAAGTGGG - Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
922150054 1:222993267-222993289 CAGCTGCCAGAGAAGAAGGAAGG + Intronic
922187072 1:223285233-223285255 CAACATGCAGACCAGGAAGAGGG + Intronic
923593087 1:235337966-235337988 AAGCTGGCAGTGGAGGAAGAAGG + Intronic
923752982 1:236763913-236763935 CAGCTTGTAGAGAATAAAGCAGG + Exonic
923797330 1:237170450-237170472 CACCTGGCAGAGACGGAGGAGGG - Intronic
924802889 1:247340469-247340491 CAGCTAATAGAGGAGGAAGAAGG - Intergenic
1062999858 10:1906231-1906253 CATGTGGCATAGAAGGAAGATGG + Intergenic
1062999871 10:1906324-1906346 CATGTGGCACAGAAGGAAGATGG + Intergenic
1062999885 10:1906425-1906447 CATGTGGCACAGAAGGAAGATGG + Intergenic
1063039051 10:2318067-2318089 TCGCTTGGAGAGAAGGAACAGGG + Intergenic
1064202531 10:13296887-13296909 GAGCTTGCAGTGAAGCAAGATGG + Intronic
1064366457 10:14712956-14712978 AAGCTTGCAGTGTAGGAAGAGGG - Intronic
1064565517 10:16635382-16635404 CAGCTAGCTGAGAGGGAGGATGG - Intronic
1065211371 10:23406653-23406675 CAGCTTGAGAAGGAGGAAGAGGG + Intergenic
1065338262 10:24677240-24677262 GAGCTTGCAGAGAAAGAATGAGG - Intronic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065838463 10:29680359-29680381 CAGCCAGTTGAGAAGGAAGAGGG + Intronic
1066448496 10:35506562-35506584 CAGCATGAAGAAAGGGAAGAAGG - Intronic
1067061725 10:43081194-43081216 CAGCCTCCAAAGAAGGAAGGGGG - Intronic
1067290220 10:44934683-44934705 CCGCTTGCTCAGAAGGAAGTAGG - Exonic
1067844605 10:49709847-49709869 CTGCTGGGAGAGAAGGGAGAAGG - Exonic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1069232877 10:66033859-66033881 CATATTGCAGGGAAGGAAGTAGG - Intronic
1070044553 10:72819288-72819310 CAGGTAGAAGAGAAAGAAGAGGG + Intronic
1070454514 10:76598991-76599013 CAGCTAGCACATAAGGAAGAGGG - Intergenic
1070772188 10:79088926-79088948 CATTTTGCAGAGGAGGAAGCTGG + Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1072688956 10:97557666-97557688 CAGCTAGAACAGAAGAAAGAGGG - Intronic
1072951386 10:99849445-99849467 CAGCTTGGACAGGAGAAAGATGG - Intronic
1073004873 10:100315548-100315570 TAGTTTGCTGAGAATGAAGAGGG + Intronic
1073511896 10:104047719-104047741 CAGGTAACAGAGCAGGAAGAGGG - Exonic
1074094715 10:110301229-110301251 CAGAAGGCAGAGAAGGAAAAAGG + Intronic
1074233805 10:111564421-111564443 CTGCTAGCAGAGAAGGGAAATGG - Intergenic
1074336850 10:112585576-112585598 AAGTTTGCAGAGAAGGCACAGGG + Intronic
1074338157 10:112599197-112599219 CAGCTTGCAGAGTAGGATTGGGG + Intronic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1074997710 10:118772154-118772176 AAGTTGGCAGAGCAGGAAGATGG + Intergenic
1075595373 10:123725363-123725385 CAGCTTGAAGAAAAGCAAGATGG + Intronic
1076273169 10:129174495-129174517 GAGCTGGCAGAGCAGAAAGAAGG - Intergenic
1076623397 10:131807354-131807376 CAGCTTCCAGACATGGATGAGGG + Intergenic
1076729400 10:132430977-132430999 CAGGGTCCCGAGAAGGAAGATGG + Intergenic
1077117608 11:892299-892321 CAGCTGGCACATAAGGGAGAGGG + Intronic
1077415564 11:2422840-2422862 CAGCTTCCAGGGAAGGAAATGGG + Intronic
1078050586 11:7962060-7962082 CAGCTTTCAGTTATGGAAGAAGG - Intronic
1078624306 11:12939979-12940001 CACCTGGAAGAGAAGCAAGACGG - Intronic
1078854973 11:15199795-15199817 CAGCTTTCAGGGAAGGAAAGAGG + Intronic
1078928830 11:15897807-15897829 CAGCAAGCCGAGAAGGAAGAGGG - Intergenic
1079375828 11:19890977-19890999 GAGCTGGGAGAGAAGGAAGGGGG - Intronic
1080186592 11:29494432-29494454 GAGCTTGCAGTGAACGGAGATGG + Intergenic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1081198891 11:40193240-40193262 AAGCTTCCAGAGGAGGAAGCAGG + Intronic
1081267580 11:41045334-41045356 CAGCTTGAAGAGATGTAAAAAGG - Intronic
1081800845 11:45858340-45858362 AAGCTTGCTGAGCAGGCAGAAGG + Intronic
1082026694 11:47578005-47578027 CAGCTGGCAGAGAGAGAAGTTGG - Exonic
1082645560 11:55720266-55720288 CAGCTAGCAGAGAAGAAAAGTGG - Intergenic
1082793293 11:57362273-57362295 GAGCTTGCAGATAAGGCAGGTGG + Intronic
1083834373 11:65255726-65255748 GAGCTTGCAGTGAGGCAAGATGG - Intergenic
1084036484 11:66514486-66514508 CAGCTGGCAGAGCAGGTAGCGGG - Exonic
1084109802 11:67006810-67006832 TGGCTGGCAGAGAAGGAAAAAGG + Exonic
1084364028 11:68686021-68686043 GAGCTTGGAGAAAGGGAAGAGGG - Intronic
1084396272 11:68912741-68912763 CAGTTTGTAGACAAGGAAGCCGG + Intronic
1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG + Intergenic
1084534149 11:69746926-69746948 CAGCAAGCAGAGAGGGAAGGTGG - Intergenic
1084574000 11:69977080-69977102 CATCTTGCAGAGCAGGGAGGCGG + Intergenic
1085026464 11:73239415-73239437 CAGCATGGAGAGGAGGAAGAGGG + Intergenic
1085273035 11:75281547-75281569 CATCTTGCAGATGAGGAAGCTGG + Intronic
1085389242 11:76174060-76174082 TAGCTGGTAGAGAGGGAAGAGGG + Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1086756732 11:90573220-90573242 GAGCTTGCAGTCAAGGCAGATGG + Intergenic
1087139159 11:94748854-94748876 CAGCTTGATGGGAAGGAAGTAGG - Intronic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1088034538 11:105296088-105296110 AAGCTTCCAGAGGAAGAAGAAGG - Intergenic
1088347849 11:108849282-108849304 CAGCTATCACATAAGGAAGAAGG - Intronic
1088993216 11:114972653-114972675 CAGCTTGCTGAGAAGGGAATGGG - Intergenic
1089188633 11:116637947-116637969 CTGCTTGCAAAGAAGAAATAAGG + Intergenic
1089345099 11:117786002-117786024 CAGCTTGGAGAGAAGGCATGAGG - Intronic
1089412948 11:118262535-118262557 CAGTTTCCAGAGAAGGATGGAGG + Exonic
1089769072 11:120789708-120789730 CACCTGGCAGGGAAGGCAGATGG - Intronic
1089819564 11:121212573-121212595 AAGCTTGGAGAGAGGCAAGATGG + Intergenic
1090068765 11:123525943-123525965 CAGCTGGGAGAGGGGGAAGAAGG + Exonic
1090462546 11:126905144-126905166 CAGCTTGCAGAGGAGGAACGGGG + Intronic
1090673332 11:128966770-128966792 CAGCATGGAGATTAGGAAGAGGG - Exonic
1090945077 11:131422276-131422298 AATCTGGCAGAGGAGGAAGAAGG - Intronic
1091388896 12:113098-113120 CAGCATGGAGGGAAGGAAGTGGG - Intronic
1091461312 12:645530-645552 CATTTTGCAGATAAGGAAAAGGG + Intronic
1091858831 12:3760495-3760517 AAGCAAGAAGAGAAGGAAGAAGG + Intronic
1092896050 12:13011351-13011373 GAGTTTACTGAGAAGGAAGAAGG + Intergenic
1093144797 12:15552862-15552884 GAGCTTGCAGTGAACCAAGATGG - Intronic
1093390800 12:18618162-18618184 CTAGTTGCAGAGAAGCAAGATGG + Intronic
1094003343 12:25720015-25720037 CATCTTCCAGCTAAGGAAGAGGG + Intergenic
1094096085 12:26706484-26706506 CAGCTTGTACACAAGGAAGGAGG - Intronic
1095825421 12:46525557-46525579 CCCCTTACAGAGAAGGGAGAGGG + Intergenic
1095924217 12:47562486-47562508 CAGCTTCCAAAGAAACAAGATGG + Intergenic
1096016480 12:48280747-48280769 CAGATACCAGAGAAGGAGGAAGG - Intergenic
1096246039 12:49987230-49987252 TTGCTTGCAGAGATAGAAGAAGG - Intronic
1096584727 12:52612499-52612521 CAGAAAGCAGAGAAGGCAGAAGG + Intronic
1096975119 12:55695405-55695427 GAGCCTGCAGAAAAGGCAGAAGG - Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097347056 12:58505262-58505284 AAGGTAGCAGAGAAGGAATAAGG + Intergenic
1099006184 12:77237149-77237171 CATTTTGTAGAGAAGGCAGAAGG - Intergenic
1099668351 12:85659543-85659565 GAGCTTGCAGTGAACGGAGATGG - Intergenic
1099744886 12:86689667-86689689 AAGCTTTCAGAGGAAGAAGAAGG - Intronic
1100602620 12:96124947-96124969 CAGCCTGCAGAAAGGGGAGAAGG + Intergenic
1101090252 12:101278045-101278067 TAAATTGCAGAGAAGGAAAATGG + Intergenic
1101415980 12:104508357-104508379 ACCCTGGCAGAGAAGGAAGAAGG - Intronic
1101510473 12:105388391-105388413 GAGGTTGCAGTGAACGAAGATGG - Intronic
1101657546 12:106736488-106736510 CAGCTGGCAGAAATGGAAAAAGG + Intronic
1101900257 12:108786749-108786771 CAGCTTGCAGAAAAGCAGAAAGG - Exonic
1102214063 12:111147715-111147737 CACCTGGCAGAGGAGGGAGAGGG + Intronic
1102219507 12:111184997-111185019 GAGCTTGCAGTGAACCAAGATGG + Intronic
1103081191 12:118025227-118025249 CAGCTTCCAGGGGAGGAGGATGG - Intronic
1103136013 12:118508536-118508558 CAACTTGGAGAGAAGGGAGTGGG - Intergenic
1103845783 12:123901214-123901236 GAGCTGGCTGGGAAGGAAGAGGG - Intronic
1104239601 12:126975078-126975100 CAGGGTGCAGAGCAGGAAGTAGG + Intergenic
1104628359 12:130378148-130378170 CTGCTTGCAAAGAGGCAAGATGG - Intergenic
1104839631 12:131816632-131816654 CAACTGGCAGAGAACAAAGAGGG + Intergenic
1106482478 13:30147351-30147373 GAGTTTGAAGAGAAGAAAGAGGG - Intergenic
1106572047 13:30935475-30935497 CAGCAGCCAGAGAATGAAGAGGG + Intronic
1107509051 13:41062880-41062902 CAGGTTGATGAAAAGGAAGAAGG - Intronic
1107825287 13:44323961-44323983 CAGCTTGCAAAGAGGGAAGAGGG - Intergenic
1107859501 13:44647508-44647530 CAGCAAACTGAGAAGGAAGAGGG + Intergenic
1108349591 13:49579557-49579579 CAGCTTGCAGTGAACCGAGATGG + Intronic
1108940341 13:55945138-55945160 CAACTTTCAGTGAAAGAAGAGGG - Intergenic
1108943301 13:55986945-55986967 GAGCTTGCAGTGAACCAAGATGG - Intergenic
1109173986 13:59132621-59132643 CAGATTGCAAAGCAGGAAGGTGG - Intergenic
1109897232 13:68709052-68709074 CAGCTTTCAGATAAGAAAGAAGG - Intergenic
1110279304 13:73674161-73674183 CCGCTTACAGATAAGGAAGCCGG - Intergenic
1110667701 13:78137423-78137445 CAGCTTTCAGAGAAAGGAGGGGG + Intergenic
1111102452 13:83605939-83605961 CTTCTGGCAGAGAAGGAAAAAGG + Intergenic
1111412635 13:87896264-87896286 CAGCTTCCAGGAAAGGCAGAGGG - Intergenic
1112187472 13:97141668-97141690 AAGCTTGCAGGGAAGGGAGGAGG + Intergenic
1112745184 13:102519829-102519851 CTGCTTGCAGAGAAGAGGGAGGG - Intergenic
1112836832 13:103525538-103525560 CAAGTTGCAGAGAAAGAACAAGG + Intergenic
1113072694 13:106436834-106436856 CAGAATGCATGGAAGGAAGATGG + Intergenic
1113223811 13:108136670-108136692 CAACTTGCAGAGAAAGAGCAAGG + Intergenic
1113762023 13:112855145-112855167 CAGATTGCAGATCAGGTAGAGGG - Intronic
1114049925 14:18914170-18914192 CAGCTTGCAGACCAGGTGGACGG + Intergenic
1114050879 14:18919207-18919229 CAGCAGGCAGAAAAGAAAGACGG - Intergenic
1114111680 14:19482715-19482737 CAGCAGGCAGAAAAGAAAGACGG + Intergenic
1114112632 14:19487760-19487782 CAGCTTGCAGACCAGGTGGACGG - Intergenic
1115255947 14:31401883-31401905 CAGATAGCAGACAAGGAAAATGG - Intronic
1115491770 14:33964995-33965017 CAGCTTCCAGGAAAGGGAGAGGG - Intronic
1115554325 14:34532392-34532414 CAGGTTGCAGTGAACCAAGATGG + Intronic
1115735337 14:36321570-36321592 CAGCTTAGAGATAAGGAAGGTGG + Intergenic
1116742312 14:48772284-48772306 CAGCATGAAGAGAAGAAACAAGG + Intergenic
1116856251 14:49954979-49955001 AAGGTTGCAGAGAGGAAAGATGG - Intergenic
1116869520 14:50058002-50058024 CACCTTGCTGAGAGAGAAGATGG + Intergenic
1116984735 14:51206517-51206539 CATCCTTCAGAGAGGGAAGAGGG - Intergenic
1117667319 14:58070200-58070222 CAGCTCAAAGAGGAGGAAGAAGG + Intronic
1118725113 14:68623484-68623506 CAACATGCATAGAAGGCAGATGG + Intronic
1118877615 14:69798045-69798067 AAACTTGCTGAGAAGGAAGCAGG + Intergenic
1119110781 14:71971945-71971967 CAACAGGCAGAGAAGGAAGATGG + Intronic
1119535332 14:75398405-75398427 CAGCCTGCAGAAAAGGAAAAGGG + Intergenic
1119603437 14:75993714-75993736 CAGATAGCAGAGCAGGAAGCTGG - Intronic
1119726130 14:76922791-76922813 CAGCTTCAAGGGAAGGACGAAGG - Intergenic
1120053944 14:79900050-79900072 CAGATTGCAGAGAAAAGAGAGGG - Intergenic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120261626 14:82192254-82192276 CTGGTTTCAAAGAAGGAAGATGG + Intergenic
1120341848 14:83230695-83230717 CCTCTTGAAGAGAAGGAACATGG + Intergenic
1120436981 14:84494665-84494687 CATGTGGCAGAGAAGGAAAAAGG + Intergenic
1121005302 14:90486907-90486929 CTGCTAGCAGAGAAGGGAGCTGG + Intergenic
1121185580 14:91964875-91964897 CAGATTGCAGAGGGGGAAGAGGG - Intergenic
1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG + Intergenic
1121769658 14:96522184-96522206 CAGGTTGCAGCGAACCAAGATGG - Intronic
1121832681 14:97065744-97065766 CAGTAGGCAGAGAAGGAAAAGGG + Intergenic
1122138752 14:99649835-99649857 TACCTTGCAGAGATGAAAGAAGG + Intronic
1122355489 14:101120762-101120784 CAGCTGGCAAAGAAGGAAAGTGG + Intergenic
1122729622 14:103786421-103786443 CAGTTCACAGAGAAGGAAAATGG - Intronic
1123156730 14:106234456-106234478 AAGTATGCAGAGAAGGAAAATGG + Intergenic
1123207503 14:106727557-106727579 AAGTATGCAGAGAAGGAAAATGG + Intergenic
1123724354 15:23087309-23087331 CAGTTTGCAGAAAAGGAGGCAGG + Intergenic
1123781981 15:23637682-23637704 GAGCTTGCAGTGAACCAAGATGG + Intergenic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1123920639 15:25067432-25067454 CCGCTTGCTGGCAAGGAAGATGG + Intergenic
1124026010 15:25966516-25966538 CAGCGTGCTCAAAAGGAAGAGGG + Intergenic
1124435607 15:29646533-29646555 CAGGTAGAAGAGAAGGCAGAAGG - Intergenic
1124828646 15:33126230-33126252 TAGACTTCAGAGAAGGAAGATGG + Intronic
1124829267 15:33132179-33132201 CAGCCAGGAAAGAAGGAAGAGGG - Intronic
1124989687 15:34659347-34659369 CAGCTTGCTGGGAAGGAAGGAGG + Intergenic
1125047683 15:35261369-35261391 GATCTTCAAGAGAAGGAAGAAGG - Intronic
1125929709 15:43591635-43591657 AATATTGCAGAGAAGGAAAAGGG - Intergenic
1125942876 15:43691467-43691489 AATATTGCAGAGAAGGAAAAGGG - Intergenic
1126064614 15:44816458-44816480 GAGCTTGCAGTGAAGCGAGATGG + Intergenic
1126980559 15:54238021-54238043 CAGCTGGAAGGGGAGGAAGATGG - Intronic
1127396904 15:58550368-58550390 AAGCATCAAGAGAAGGAAGAAGG + Intronic
1127903409 15:63358231-63358253 CAGCTGGAAGGAAAGGAAGATGG + Intronic
1129161081 15:73748297-73748319 CAGCAGGCAGAGGAGGAAGATGG + Intronic
1129185929 15:73906469-73906491 CAGTTTGGAAAGAAGGATGAGGG + Intergenic
1130414490 15:83679726-83679748 CAACTTGGAGAGAAGGGAGCTGG - Intronic
1130717676 15:86351788-86351810 CAGCTTGTAGAGAAGGCAGAAGG - Intronic
1130923090 15:88365454-88365476 CAGCTCGTAAAGGAGGAAGACGG + Intergenic
1131890812 15:96969714-96969736 GAGCCTGCAGAGGCGGAAGAAGG - Intergenic
1132048363 15:98585413-98585435 GAGCTTGCAGAGAGCCAAGATGG - Intergenic
1133460127 16:5980296-5980318 CAGCTTGCAGAGAGAGCAGGGGG + Intergenic
1134093687 16:11404934-11404956 AAGCTTGCAGAGGAGGAAAAAGG + Intronic
1134366699 16:13585563-13585585 CACCTTGCAGAGGAGGAAGCAGG + Intergenic
1134511952 16:14855654-14855676 TAGCTTGCAGAGAAGGATGGGGG + Intronic
1134564595 16:15240324-15240346 CAGCTGGGAGAGAAGAAAGCAGG - Intergenic
1134699593 16:16254154-16254176 TAGCTTGCAGAGAAGGATGGGGG + Intronic
1134737900 16:16516375-16516397 CAGCTGGGAGAGAAGAAAGCAGG + Intergenic
1134837717 16:17376039-17376061 CACTTTACAGAGAAGGAAGTGGG + Intronic
1134972236 16:18540517-18540539 TAGCTTGCAGAGAAGGATGGGGG - Intronic
1136501060 16:30669851-30669873 CAGCCTCTAGAGAAGGGAGAGGG + Exonic
1138187395 16:54987085-54987107 GGGCTTGCAGAGAGGGAAGGGGG + Intergenic
1138214974 16:55196307-55196329 GAGCTTGGAGGGAAGGAAGTGGG + Intergenic
1138353523 16:56359904-56359926 AAGATGGCAGAGAAGAAAGAGGG - Intergenic
1139335862 16:66230760-66230782 CTGCTTTGAGATAAGGAAGAGGG + Intergenic
1139485306 16:67252885-67252907 GAGCTTGAGGAGAAGGGAGAGGG - Intronic
1139850449 16:69949014-69949036 GAGGTTGCAGTGAAGCAAGATGG - Intergenic
1139879433 16:70171926-70171948 GAGGTTGCAGTGAAGCAAGATGG - Intergenic
1140214852 16:72999212-72999234 GAGGTTGCAGTGAGGGAAGATGG - Intronic
1140355857 16:74305605-74305627 CGGGATGCAGAGAAGAAAGAAGG + Exonic
1140373091 16:74423622-74423644 GAGGTTGCAGTGAAGCAAGATGG + Intergenic
1141207307 16:81942787-81942809 CAGCCTGCAGAGGAGGAACACGG - Intronic
1141382888 16:83591612-83591634 GAGAATTCAGAGAAGGAAGAAGG - Intronic
1141597801 16:85107944-85107966 CAGCCTGCAGAAAAGGAGGAGGG + Exonic
1141657647 16:85424575-85424597 GGGCTGGGAGAGAAGGAAGAGGG - Intergenic
1141762486 16:86038042-86038064 ACATTTGCAGAGAAGGAAGAGGG + Intergenic
1142017819 16:87760540-87760562 GAGCTTGCAGTGAACCAAGATGG + Intronic
1142391134 16:89800966-89800988 GAGCTTGCAGTGAACCAAGATGG + Intronic
1142668785 17:1477812-1477834 CAGCCTGGAGAGAACGGAGAAGG + Intronic
1143568886 17:7741983-7742005 CAGGCTGCAGAGGAGGAATAGGG + Intronic
1144130669 17:12243571-12243593 CTGCTTGCATGGAAGGAGGAAGG - Intergenic
1144159060 17:12539203-12539225 CAGCTGGGTGAGAAGGAAGTAGG + Intergenic
1144947111 17:18975233-18975255 AAGCTGGCAGAGAAGCAGGAAGG + Intronic
1145115210 17:20203908-20203930 CAGATGGCAGAGAAGGAAGAAGG - Intronic
1145776929 17:27535689-27535711 AAGATTGCAGCGAAGGAAGATGG + Intronic
1145838382 17:27972247-27972269 TAATTTACAGAGAAGGAAGAAGG + Intergenic
1145925864 17:28646070-28646092 CATTTTACAGAGAAGGAAGCAGG - Intergenic
1146542369 17:33708525-33708547 GAGCTGGAAGAGAAGAAAGAAGG - Intronic
1147225454 17:38973338-38973360 TAAATTGCAGAGTAGGAAGAGGG + Intergenic
1147469982 17:40649574-40649596 GAGCTTGCAGTGAACGGAGATGG + Intergenic
1147571945 17:41576815-41576837 CTGCTTGCAGGCAAGCAAGAGGG - Intergenic
1148519490 17:48257562-48257584 AAACTTACAAAGAAGGAAGATGG + Intronic
1148851492 17:50557723-50557745 CACCTTTCAGATAAGGAAGGGGG - Intergenic
1149064960 17:52468220-52468242 AAGCCTGTAGTGAAGGAAGAAGG - Intergenic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150633597 17:66897610-66897632 CATCTTGCAGAGAAGGAAGGAGG - Intergenic
1151054186 17:71012784-71012806 CCACTTGAAGAAAAGGAAGAAGG + Intergenic
1151207487 17:72518784-72518806 CGGCAAGCAGGGAAGGAAGAAGG + Intergenic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1153467629 18:5406713-5406735 CACCCTGTAGAGAAGGAAGGCGG + Intronic
1155047356 18:22114500-22114522 CAGCTTGCAGATAAGGGAGGTGG - Intergenic
1155538126 18:26839183-26839205 AAGCTTGCAGAGCAGAAAGAAGG + Intergenic
1155916674 18:31564470-31564492 CGGTTTGCAGAGAAAGCAGAAGG - Intergenic
1155943921 18:31826578-31826600 GAGATTTCAGAGAGGGAAGAGGG - Intergenic
1156052022 18:32948597-32948619 CAGATTGCAAAGAAGTAAAATGG - Intronic
1156389946 18:36640996-36641018 CATGTTGCAGAGAAGAAGGATGG - Intronic
1156759001 18:40564163-40564185 CAGACAGCAGAGAAGGAAGCTGG - Intergenic
1156922029 18:42533616-42533638 AAACTTTCTGAGAAGGAAGAAGG - Intergenic
1157108157 18:44794096-44794118 CAGCCTGCAGAGTATGAACAGGG + Intronic
1157466093 18:47946860-47946882 GAGCTTGCAGTGAACCAAGATGG + Intergenic
1157857119 18:51113443-51113465 CAGCTGGCAGACCAGCAAGAAGG - Intergenic
1158282499 18:55842802-55842824 CACTAAGCAGAGAAGGAAGAAGG - Intergenic
1158390343 18:57039822-57039844 GAGGTTGCAGTGAACGAAGATGG + Intergenic
1159010823 18:63057594-63057616 CTGCTTGGAAAGAAGGAAGGTGG - Intergenic
1160216318 18:76935633-76935655 GAGCTTGCACAGAGGGAAGACGG - Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161615768 19:5269417-5269439 CAGATGGCAGAGGAGGAGGAAGG + Intronic
1162437993 19:10674423-10674445 GAGCTTGCAGTGAACCAAGATGG - Intronic
1162603829 19:11691934-11691956 CAGCTTGCAGTGAGCCAAGATGG + Intergenic
1163326371 19:16605994-16606016 CAGTTTTGAGTGAAGGAAGAAGG - Intronic
1164919955 19:32082056-32082078 CAGCATGAAGAGAAGGGAGTGGG + Intergenic
1165268859 19:34687401-34687423 CAGGTCTCTGAGAAGGAAGAAGG + Intergenic
1165283769 19:34820148-34820170 CACTTTGCAGAGTGGGAAGAAGG + Intergenic
1166293350 19:41877345-41877367 CAGCAGGAAGAGGAGGAAGATGG - Exonic
1167615567 19:50531054-50531076 CACTTTTCAGAGAAAGAAGATGG + Intronic
1168013075 19:53549356-53549378 CAGGTTGCAGCAAAGAAAGACGG + Intronic
1168288125 19:55344545-55344567 CGGTTTTCAGAGAAGAAAGATGG - Intronic
925109261 2:1319639-1319661 CAGCTTACACAGGAAGAAGAGGG + Intronic
925537522 2:4933460-4933482 TAGCTTCCAGAGAGGGTAGATGG - Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926359594 2:12073620-12073642 CATTTTACAGAGAAGGAAGCAGG + Intergenic
926448886 2:12978229-12978251 CAGCTTGCTTAGAAGCAGGAAGG - Intergenic
926610235 2:14939525-14939547 CAGAATGCAGAGAAGTCAGAAGG - Intergenic
926610244 2:14939596-14939618 CAGAATGCAGAGAAGTCAGAAGG - Intergenic
927488217 2:23503744-23503766 CAGCTGCCAGCGAAGGAGGAAGG + Intronic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
927521978 2:23704344-23704366 CTGCAGGCAGAGAAGGTAGAGGG + Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927736039 2:25523265-25523287 CACCTTGCAGAGTAGCTAGAAGG + Intronic
928027321 2:27750939-27750961 GAGGTTGCAGTGAACGAAGATGG + Intergenic
929411109 2:41698121-41698143 CAGCATGGAGATAAGGAATAAGG + Intergenic
929900781 2:46001525-46001547 CAGCGGCCAGAGAAGGAAAAAGG + Exonic
929934918 2:46287437-46287459 CATCTTGCAGATGAGGAAGTGGG + Intergenic
931025333 2:58107798-58107820 GAGCTGGCAGAGAAAGAAGCAGG - Intronic
931701696 2:64914272-64914294 CAGGTGGGAGAGAAGGAAGAAGG - Intergenic
931721892 2:65072675-65072697 GAGCTTGAAGGGAAGGAAGCTGG - Exonic
931791577 2:65668245-65668267 GATGTTGCAGAGTAGGAAGAGGG + Intergenic
932103958 2:68926198-68926220 CAGCTTGCAGAAGAGGAAAATGG - Intergenic
932374603 2:71224680-71224702 CAGGGTGCAGAGAAGCACGATGG - Intronic
932502330 2:72194289-72194311 CATCTAGTAGAGAAGGTAGAAGG + Intronic
932740330 2:74286140-74286162 CAGCTGGCAGTGAAGAATGATGG + Intronic
932887690 2:75561706-75561728 AAGCTTGGACAGAGGGAAGACGG + Intronic
934725542 2:96615579-96615601 CAGTTTTCAGAGAAAGAAAAAGG + Intronic
935161315 2:100531844-100531866 CTGCGTGCTGAGAAGGATGAAGG + Intergenic
935402138 2:102671146-102671168 GAGTTTACAGAGAAGGAAGCGGG + Intronic
935491196 2:103722476-103722498 CATCTAGCACAGGAGGAAGATGG - Intergenic
935623667 2:105150502-105150524 CACTTTACAGATAAGGAAGAAGG + Intergenic
937428109 2:121816580-121816602 GAGCTTCCAGAGAAGAAAAAGGG - Intergenic
937579498 2:123467106-123467128 CAGATGGCAAAGAAGGAAGGAGG - Intergenic
938288284 2:130136370-130136392 CAGCTTGCAGATCAGGCGGACGG - Intergenic
938394370 2:130931487-130931509 CATACTACAGAGAAGGAAGAGGG - Intronic
938468244 2:131536574-131536596 CAGCTTGCAGATCAGGCGGACGG + Intergenic
938960531 2:136336439-136336461 CAGCTTGCAAAGAAGGTATGGGG + Intergenic
939055091 2:137355787-137355809 CACTTTACAGAGAAGGAAAAAGG - Intronic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
940004680 2:148999672-148999694 GAGGTTGGAGGGAAGGAAGAGGG + Intronic
940328535 2:152451211-152451233 CAGGTTGCAGTGAACCAAGATGG - Intronic
941301911 2:163813020-163813042 CAGTTTCCAGAGAAGTTAGAAGG - Intergenic
941660621 2:168192225-168192247 CAGCAGGCAAAGAAGGAACATGG + Intronic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
943392414 2:187285843-187285865 CAGTTTGCAGATAAGGAAATGGG - Intergenic
943435480 2:187860594-187860616 CAGCTTGCAGTGAGCGGAGATGG - Intergenic
944527575 2:200635684-200635706 CAGCATGCATGGAAGGAAGGAGG + Intronic
944978989 2:205092276-205092298 CAGCTTCCAGAGGAGGAAACAGG + Intronic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
945250984 2:207766844-207766866 CGACTTGGAGAGAGGGAAGAGGG - Exonic
946181312 2:217950783-217950805 AAGAGTGCAGAGGAGGAAGAGGG - Intronic
946366540 2:219252605-219252627 CAGCTTACAGGAAAGAAAGAGGG - Intronic
946490865 2:220147658-220147680 CAGCCTGCTGAGAAGGAATCGGG - Intergenic
947150699 2:227112331-227112353 GAGGTTGCAGTGAAGGGAGATGG - Intronic
947205484 2:227657296-227657318 CAGCGTTTGGAGAAGGAAGAAGG + Intergenic
947866968 2:233404945-233404967 CAGCTTGGAAAGAAGACAGAAGG + Intronic
948516631 2:238508090-238508112 CAGCCAGCAGAGAGGGAAGCTGG - Intergenic
948723017 2:239913158-239913180 CAGCTGGCAGAGGAGGAAGAAGG - Intronic
948857908 2:240738835-240738857 CAGACAGGAGAGAAGGAAGAGGG - Intronic
948979809 2:241487810-241487832 GAGCTTGCAGAGAGCCAAGATGG - Intronic
949079273 2:242083947-242083969 GAGCTTGCAGGGATGGCAGAGGG + Intergenic
1169055235 20:2615372-2615394 CAGCATGCATGGATGGAAGAAGG - Intronic
1169867236 20:10215266-10215288 CAGTATGGTGAGAAGGAAGAAGG - Intergenic
1170144916 20:13162901-13162923 TAGCTTGCTGAGATGGGAGAGGG - Intronic
1170232561 20:14066874-14066896 GAGCTTGCAGAGAGCCAAGACGG - Intronic
1170412631 20:16107573-16107595 CAGCATGTGGAAAAGGAAGAAGG + Intergenic
1170758394 20:19225604-19225626 CAGGGTTCAGAGATGGAAGAAGG - Intronic
1171328009 20:24312783-24312805 CACCTTGCAGAGGAGGAAAGCGG - Intergenic
1172184973 20:33025876-33025898 CTCCTTGCCCAGAAGGAAGATGG + Intergenic
1172753065 20:37264492-37264514 GAGCTTGCAGTGAACCAAGATGG + Intergenic
1172934716 20:38611640-38611662 GAGCTTGCAGAGAGCCAAGATGG - Intronic
1173001823 20:39110449-39110471 GAGGTGGGAGAGAAGGAAGAGGG - Intergenic
1173187966 20:40855754-40855776 GAGCTTTCAGAGATGGTAGATGG - Intergenic
1173239517 20:41281897-41281919 CAGCTGAGAGAGAAGGCAGAAGG + Intronic
1173847592 20:46197883-46197905 CAGCTAGGGGAGGAGGAAGAGGG + Intronic
1173878263 20:46390544-46390566 CAGCTTGCAGAAAAGGAGGCAGG - Intronic
1173881870 20:46420723-46420745 CATCTTTCAGAAATGGAAGATGG + Intronic
1174686673 20:52462869-52462891 GAGTTTGCAGAGAAAGACGATGG - Intergenic
1175391230 20:58628647-58628669 CAGCTTGCCTAGAAGTCAGAGGG - Intergenic
1175443326 20:59005405-59005427 CAGTTTGCAGATGAGGAAGCAGG - Intronic
1175443978 20:59007738-59007760 CCTTTTGCAGAGAAGGAAGGAGG + Intergenic
1175914584 20:62419727-62419749 CATCCTGAAGAGGAGGAAGAGGG + Exonic
1175977545 20:62718652-62718674 GAGGATGCAGTGAAGGAAGAAGG - Intronic
1176426764 21:6553086-6553108 CAGCTTCCAGAGAAGGCTGAGGG - Intergenic
1177543086 21:22520787-22520809 CAGCTTGCACAGAGAGAAGGAGG - Intergenic
1178499341 21:33112802-33112824 CAGCTTCCAGAGAAGGATTTAGG + Intergenic
1179371503 21:40810102-40810124 GAACTTGCAGACAAAGAAGAGGG + Intronic
1179446133 21:41432052-41432074 TACTTTGCAAAGAAGGAAGATGG + Exonic
1179702255 21:43161408-43161430 CAGCTTCCAGAGAAGGCTGAGGG - Intronic
1179905205 21:44419011-44419033 CACCTTGGAAAGAAGCAAGATGG - Intronic
1180098527 21:45573323-45573345 CATCTTGCAGAGGAGGAAACAGG + Intergenic
1180163073 21:46006710-46006732 CAGCTTACAGGGGAGGAAGCCGG - Intergenic
1180468407 22:15636546-15636568 CAGCTTGCAGACCAGGTGGACGG + Intergenic
1180469356 22:15641582-15641604 CAGCAGGCAGAAAAGAAAGACGG - Intergenic
1180713472 22:17855890-17855912 CAGGCTGCAGAGAATGATGAAGG + Intronic
1181042573 22:20199186-20199208 CATCTTGCAGACAAGGAAACAGG - Intergenic
1181466793 22:23114739-23114761 CAGCTGGCAGAGCAGGAGGTTGG + Intronic
1181582849 22:23837516-23837538 CAGCTGGGAGGGCAGGAAGATGG + Intronic
1181722540 22:24786767-24786789 CAGGTTGCAGGGAAGGTAGTGGG - Intergenic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1182047275 22:27285080-27285102 CAGCTTGCACAGAAGTCTGAAGG - Intergenic
1182114790 22:27749907-27749929 CAGCTTTCAGAAAAGGGAAAGGG + Exonic
1182354198 22:29714945-29714967 CTGCTGGGAGAGAAGGAGGAGGG + Intergenic
1182447700 22:30399125-30399147 CAGGTTGCAGGGCAGGAAGTGGG - Intronic
1182456928 22:30457767-30457789 GAGCTGGCAGGGAAGGAGGAGGG - Intronic
1182769141 22:32781096-32781118 AGGGATGCAGAGAAGGAAGAAGG - Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183109230 22:35636825-35636847 CAGCTGGGAGGGAGGGAAGAGGG - Intronic
1183218674 22:36497755-36497777 CATTTTGCAGATGAGGAAGAAGG + Intronic
1183267729 22:36839613-36839635 CAACTAGCAGTGAAGGAGGAAGG - Intergenic
1183413414 22:37668730-37668752 CAGGTAGCAGAGCAGAAAGACGG + Intergenic
1183539667 22:38422857-38422879 CAGGATGGAGAGAATGAAGAGGG - Intergenic
1183818637 22:40325551-40325573 CAAATTGCAGAGCAGGAAGAGGG - Exonic
1183864629 22:40694451-40694473 CAGCTTCCAGAGAAGGAAGATGG - Intergenic
1184701678 22:46178464-46178486 CAGGTTGCAGTGCAGGGAGAGGG + Intronic
1184860854 22:47172717-47172739 CATTTTGCAGAGGAGGAAGCTGG + Intronic
1184994805 22:48197611-48197633 GAGCTTGCACAGTAGGAAGTGGG - Intergenic
1185125694 22:49009538-49009560 CAATTTCCAGAGAAGGAAGCAGG - Intergenic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
949140365 3:626040-626062 TAGGTGGCAGAGAAGCAAGAAGG - Intergenic
950111461 3:10421354-10421376 CAGCTTTCAGGGAAGGAGAAGGG - Intronic
950865215 3:16183280-16183302 AAGCTTGCAGACAAGAGAGATGG - Intronic
952058136 3:29473884-29473906 CAGCTTGCAGAGAGGTATGGAGG - Intronic
952947323 3:38487062-38487084 CACCTGGCAGTGAGGGAAGATGG + Exonic
952970345 3:38646832-38646854 CACTTGACAGAGAAGGAAGATGG + Intronic
953222286 3:40983459-40983481 TAGCAACCAGAGAAGGAAGATGG + Intergenic
953252886 3:41262396-41262418 CAGCGTGCAAAGGAGGATGATGG + Intronic
953505754 3:43484320-43484342 CAGCTTTCAGAGAACATAGATGG + Intronic
954299374 3:49691252-49691274 GAGCTGGCAGGGAAGGAAGGAGG + Intronic
955182070 3:56682399-56682421 CAGCTCCCAGAGAGGAAAGATGG - Intronic
955301940 3:57788591-57788613 CAGCTGGCAGGGAAAAAAGAAGG + Intronic
955974766 3:64469254-64469276 AAGATGGCAGGGAAGGAAGAAGG + Intergenic
956289661 3:67648182-67648204 CAGGTTGCAGAGAAAGAACATGG + Intronic
956647350 3:71469289-71469311 CAGATTTCAAAGAAGGAAAAAGG + Intronic
956677669 3:71751322-71751344 CATTTTGCAGAGGAGGCAGAAGG - Intronic
957025350 3:75175181-75175203 CAGCCTGGAGAAAAGGAAAATGG - Intergenic
957107727 3:75911860-75911882 CAGCTTGTAGATAAGAAACAAGG - Intronic
958464691 3:94443123-94443145 CAGCTTGCAGAGCACAGAGAAGG + Intergenic
958542511 3:95497295-95497317 CAGCATGCAGAGCAGGAATATGG + Intergenic
959422008 3:106140357-106140379 CAGCTAAAAGAAAAGGAAGAAGG + Intergenic
960084084 3:113572011-113572033 CAGGATGCAGAGAAGTTAGAAGG + Intronic
960374066 3:116877187-116877209 CAGTTTGCAACCAAGGAAGAGGG - Intronic
960803970 3:121564943-121564965 CAGCTGGCAGAGCAGCAGGAAGG + Intergenic
960865002 3:122190516-122190538 CAGTTTACAGATAAGGAAAATGG - Intronic
961328017 3:126121816-126121838 CAGCTCCCAGCGAAGGAAGCTGG + Intronic
961430081 3:126875205-126875227 CAGAATCCAGAGCAGGAAGAGGG + Intronic
961867705 3:129965831-129965853 TAGCTAGCAGAAAATGAAGAAGG + Intergenic
962169672 3:133087748-133087770 CAGGTTCCAGGGAAGAAAGATGG - Intronic
962501592 3:135999709-135999731 CATCTTGCTGAGAAAGAAAAAGG - Intronic
962712564 3:138100163-138100185 CAGCCTCCAGGGAGGGAAGAGGG + Intronic
962733864 3:138306755-138306777 CAGGTGGCAGAGGAGGAACATGG + Intronic
963633837 3:147768274-147768296 AAGCTTGCAGTGATGGCAGAAGG - Intergenic
963704983 3:148675808-148675830 CAGCTTGCATACCAGGAATATGG + Intergenic
963921434 3:150909662-150909684 CAGCCTGCGGGGAAGAAAGAAGG + Intronic
964041185 3:152263856-152263878 GAGCTTACAGTCAAGGAAGAGGG - Intronic
964137003 3:153355276-153355298 CAGCTTGTGGAGAAGAAAAAAGG + Intergenic
964405511 3:156344365-156344387 CAGCTTTCAGAACAGGAAAATGG - Intronic
966440156 3:179935927-179935949 CAGCTGGCAGAGAAGCAGAAGGG - Intronic
967471291 3:189864940-189864962 AAGCTTGCAGTGAACCAAGATGG + Intronic
967857380 3:194128673-194128695 AAGCTGGAAGAGAAGGGAGAAGG - Intergenic
967889953 3:194357946-194357968 CAGCTTGCTGGCAGGGAAGAGGG + Exonic
968446666 4:655568-655590 CAGCCTGGGGAGGAGGAAGAAGG + Intronic
968806601 4:2777147-2777169 GAGCTTGCAGAGAGCGGAGATGG - Intergenic
969131783 4:4995534-4995556 AAGCAGGCAGAGAAGGAGGAAGG + Intergenic
969143263 4:5098708-5098730 CAGCTGGGAGACCAGGAAGAGGG - Intronic
969707164 4:8818352-8818374 CTGCATGCAGAGAAGGGAGGCGG - Intergenic
970139787 4:12969394-12969416 GAGCTTGCAGTGAACGGAGATGG - Intergenic
970435711 4:16032939-16032961 CAGCATGCAGAAAAGAGAGATGG - Intronic
971231757 4:24805870-24805892 CAGCAGGAAGAGCAGGAAGATGG + Intergenic
972225009 4:37002249-37002271 GAGCTTGCAGTGAGGGGAGATGG + Intergenic
972229274 4:37052193-37052215 CAGCTAGCAGAAAGGAAAGAAGG - Intergenic
972304502 4:37819231-37819253 GAGCTTACAGAAAAGGCAGAAGG + Intergenic
972361636 4:38331036-38331058 CAGCTAGCAAAGCAGAAAGATGG + Intergenic
972372362 4:38437552-38437574 AAGCTTCCAGAGGAAGAAGAAGG - Intergenic
973083255 4:46022172-46022194 CATTTTCCAGAGATGGAAGAAGG - Intergenic
973798483 4:54451978-54452000 CAGCTTCCAGAGGAAGGAGAAGG + Intergenic
975999826 4:80360389-80360411 CTGCTTGCAGAGCAGAGAGAAGG - Intronic
976826116 4:89262338-89262360 TTGCTATCAGAGAAGGAAGATGG + Intronic
978185972 4:105857762-105857784 AAGCTTCCAGAGAAGGAGCAGGG - Intronic
978589182 4:110305480-110305502 CAGCTTACACTGAAGGAATACGG + Intergenic
978655759 4:111063766-111063788 CAGCTTGCCTGGAATGAAGAAGG + Intergenic
979007069 4:115312811-115312833 AAGGTTGCAGAGAAAGAGGAAGG + Intergenic
979152217 4:117333961-117333983 GAGCTTGCAGTGAGGCAAGATGG - Intergenic
979444636 4:120797136-120797158 TAACTTGAAGAGAAAGAAGAAGG + Intronic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
980026230 4:127770558-127770580 GAGCTTGCAGTGAACCAAGATGG + Intronic
980979670 4:139643473-139643495 CAGGGTGCTGAGGAGGAAGAAGG - Intergenic
982194783 4:152900032-152900054 CAGATAGCAGAGAGAGAAGATGG + Intronic
982430802 4:155319877-155319899 ATGCTTGAAGAAAAGGAAGATGG + Intergenic
983008812 4:162519749-162519771 GAGCTTGCAGTGAGCGAAGATGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
983737383 4:171078874-171078896 AAGCTGGCAGAAAAGGGAGAAGG + Intergenic
984307370 4:178011330-178011352 CAGCTTTAAGAGAATGAAAAAGG - Intergenic
985749292 5:1665226-1665248 CAGCTTCCAGTGAAGGGAGCTGG + Intergenic
985931385 5:3060170-3060192 GAGCTTGCAGTGAACCAAGATGG + Intergenic
985939135 5:3120560-3120582 CAGCTAGCAAATCAGGAAGATGG - Intergenic
986109028 5:4692838-4692860 GAGCTTGCAGTGAACCAAGATGG - Intergenic
986472979 5:8094238-8094260 GAGCTCCCTGAGAAGGAAGATGG - Intergenic
986853672 5:11842652-11842674 GAGCTTGCAGTGAACGGAGATGG + Intronic
987234784 5:15931798-15931820 CAGCAGGCAGAGGAGGGAGAGGG - Intronic
987562145 5:19538352-19538374 TAGATTGCACAGAGGGAAGATGG + Intronic
987690931 5:21265878-21265900 CAGCCTTATGAGAAGGAAGAAGG + Intergenic
987776252 5:22371453-22371475 CTACTTACAGAGAAGTAAGATGG - Intronic
988022205 5:25635321-25635343 CAGATTGCAGAGAAAAGAGAAGG - Intergenic
988410829 5:30883863-30883885 CAGCATGAAGTGAAGAAAGAGGG + Intergenic
988434581 5:31159069-31159091 GAGATTGCAGTGGAGGAAGAGGG - Intergenic
989249215 5:39289320-39289342 CTTCTGGAAGAGAAGGAAGAAGG - Intronic
989739485 5:44753462-44753484 CAACTTTCAGAGAGGGGAGAGGG + Intergenic
989758479 5:44984763-44984785 CAGTTTGCACTGAAGGAAGCAGG - Intergenic
990104694 5:52244512-52244534 GAGCTTGCAGTGAAATAAGATGG - Intergenic
990773939 5:59284163-59284185 CAGATTGCAGAGCAGCAGGATGG - Intronic
990826870 5:59909979-59910001 CACGTTGCAGAGAAGTACGATGG - Intronic
990919029 5:60942612-60942634 TAGTTTCTAGAGAAGGAAGAGGG + Intronic
991527421 5:67576637-67576659 CAGCCTGCAGAACAGGAAGAAGG - Intergenic
991662448 5:68963749-68963771 GAGCTTGCAGAGAGCCAAGATGG - Intergenic
992423444 5:76630186-76630208 CAGCTGACAGTGAAGGAAGAAGG + Intronic
992638021 5:78743990-78744012 GAGCTTGCAGTGAATGGAGATGG + Intronic
992852093 5:80821008-80821030 CATCTTGCAGAGAGAGAAGCAGG - Intronic
993363122 5:87002491-87002513 CCGCTTACAGAGAAGGGAAAAGG - Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994115950 5:96061485-96061507 CAGCTAACAGAGAAGAAAAAAGG + Intergenic
994135129 5:96277946-96277968 CAGCCTTCAGAGAAGGGGGATGG - Intergenic
994247424 5:97495568-97495590 CTGATTCCAAAGAAGGAAGAAGG + Intergenic
994260811 5:97656390-97656412 AAACATGCACAGAAGGAAGAGGG + Intergenic
994278233 5:97865522-97865544 GAGCTTGCAGTGAACCAAGATGG + Intergenic
995170174 5:109100409-109100431 CACCTTTCTGAGAAGGAAGAAGG + Exonic
995183469 5:109249688-109249710 CAGCTTGAAGAGAGGGACGGGGG + Intergenic
995348667 5:111149989-111150011 CAGCTGTCAGAGGAGGAAGTTGG - Intergenic
995461840 5:112411596-112411618 CAGCTTACAGATAAGGAAACTGG + Intronic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996588648 5:125120373-125120395 AAGATTGCTGAGATGGAAGATGG + Intergenic
996601799 5:125273020-125273042 AAGCTTTCAGAGATGGAAGTTGG + Intergenic
996648149 5:125841478-125841500 AAGCTTCCAGAGAAAGAAGCCGG + Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997368723 5:133342321-133342343 CAGGTTGCAGAGAAGGGGCAGGG + Intronic
997443665 5:133926168-133926190 CAGCCTGCAAACCAGGAAGAGGG - Intergenic
997718956 5:136062857-136062879 CATCTTACAGAGAAGGAAATGGG - Intronic
997771921 5:136563027-136563049 CTGCTTGAAGATAGGGAAGATGG + Intergenic
998633760 5:143929795-143929817 TATTTTGCAGAGAAGGAAAAAGG - Intergenic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
999587064 5:153101334-153101356 CCTCTTACAGAGAAGGAAGCTGG + Intergenic
999865403 5:155695375-155695397 CAGCTAGCAGAGGAGAAAAAAGG - Intergenic
999942363 5:156557755-156557777 CAGCTTGATGAGGAGGCAGAGGG - Intronic
1000021519 5:157322911-157322933 TAGATAGGAGAGAAGGAAGAGGG - Intronic
1000747740 5:165056129-165056151 CATATTGCAGATAAGGCAGAAGG + Intergenic
1001087801 5:168714086-168714108 CAGCTAGGACAGCAGGAAGATGG + Intronic
1001098719 5:168796488-168796510 CACCTCGGAGAGAAGGGAGATGG - Intronic
1001448495 5:171806233-171806255 CAACTTCCAGAGAAAGGAGAAGG + Intergenic
1001664941 5:173424759-173424781 CAGGCTGGTGAGAAGGAAGATGG - Intergenic
1001859734 5:175043480-175043502 CAACTTGCAGAAAAGGTGGATGG - Intergenic
1002169304 5:177366475-177366497 CAGCTGGGAGAAGAGGAAGAGGG - Intronic
1002322106 5:178382422-178382444 CAGCCTCCAGAGGAGGAGGAGGG - Intronic
1002477779 5:179478506-179478528 CAGCTGTAAGAAAAGGAAGAAGG + Intergenic
1002480829 5:179499641-179499663 GAGCTTGCAGAGAGCCAAGATGG + Intergenic
1003891268 6:10565793-10565815 CAACTTTAAGAGAAAGAAGAAGG - Intronic
1004451711 6:15753827-15753849 CACCTGGCACTGAAGGAAGATGG - Intergenic
1005030240 6:21501481-21501503 CTGTATGCAAAGAAGGAAGATGG - Intergenic
1005083452 6:21980577-21980599 CAGGCTGCAGAACAGGAAGAAGG - Intergenic
1005083457 6:21980603-21980625 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005083515 6:21980909-21980931 CAGTTTCCAGAGCAGGAAGGAGG - Intergenic
1005083529 6:21980967-21980989 CAGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005083549 6:21981076-21981098 CAGTTTCCAGAGCAGGAAGGAGG - Intergenic
1005083557 6:21981131-21981153 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005083575 6:21981271-21981293 CAGTTTTCAGAGCAGGAAGGAGG - Intergenic
1005083581 6:21981300-21981322 CAGGTTCCAGGGCAGGAAGAAGG - Intergenic
1005083601 6:21981412-21981434 CAGGTTCCAGAGCAAGAAGAGGG - Intergenic
1005083622 6:21981545-21981567 CAGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005272941 6:24185760-24185782 CAGTCTGCAAAGAAGGAAAAGGG + Intronic
1006143318 6:31943919-31943941 CATCGTGCAGGGAAGGCAGATGG - Exonic
1006561537 6:34917177-34917199 GAGCCAGGAGAGAAGGAAGAAGG + Intronic
1006697478 6:35943474-35943496 CAGAATACAGAGAAGGGAGAAGG + Intergenic
1006817517 6:36862555-36862577 CTACTTTCAAAGAAGGAAGATGG - Intronic
1006888143 6:37399535-37399557 CAGCTTGCAGAAACTGAAAAAGG + Intergenic
1007477375 6:42127987-42128009 GAGCTTGCAGTGAACCAAGATGG - Intronic
1007576031 6:42925649-42925671 CAGCCTGCAGAGGAGGAGGCAGG - Exonic
1007663191 6:43498959-43498981 CCGCCTGCTGAGAAGCAAGAAGG - Exonic
1007835522 6:44671177-44671199 GAGGCTGCAGAGAAGGAAGGTGG - Intergenic
1009808456 6:68632813-68632835 CAGCTTGCAGACATGAAACAAGG + Intergenic
1010387887 6:75303339-75303361 CAGCTTGTAGAGCAGGAACATGG + Intronic
1011062379 6:83285512-83285534 CATGCTGTAGAGAAGGAAGAAGG + Intronic
1011131893 6:84060253-84060275 CAGCCTTCAGAGAAGGCAGGTGG - Intronic
1011604965 6:89094285-89094307 CAGGTTGCAGTGAACCAAGATGG - Intergenic
1011955468 6:93019608-93019630 GAGCTTGCAGAGAGCCAAGATGG + Intergenic
1012076089 6:94688104-94688126 GAGCTTGCAGTGAAACAAGATGG + Intergenic
1012625023 6:101393936-101393958 CCACCTGGAGAGAAGGAAGAAGG + Intergenic
1013293642 6:108739788-108739810 CACCTTGCTGAGAAGGATGCTGG + Intergenic
1013395442 6:109733128-109733150 CAGTTTCCTGAGAAGGAATATGG + Intronic
1013677993 6:112488495-112488517 CAGCTTCCAGCGAAAGAAAAAGG - Intergenic
1015697221 6:135993983-135994005 CAGCTTGCAGAAATCTAAGAGGG + Intronic
1016272861 6:142309525-142309547 CATCCTGCAAAGAAAGAAGATGG - Exonic
1017137515 6:151161374-151161396 CACTTTGGAGAGAAGGAACAGGG - Intergenic
1018565729 6:165150161-165150183 GAGCTTGCAGTGAATGGAGATGG - Intergenic
1018915904 6:168132201-168132223 CAGCTGGCTGAGAAGGAGGCAGG - Intergenic
1019034423 6:169042489-169042511 CTGCTGGCAGTGAAGGGAGAAGG + Intergenic
1020465705 7:8476283-8476305 CAGCTGACAGAGAAAGAACAGGG - Intronic
1020811840 7:12857709-12857731 CAGTTTTCAGAGAAGGGAGATGG + Intergenic
1022233607 7:28439551-28439573 CAGTTTGCAGAGGAGGAACCTGG + Intronic
1023002462 7:35824401-35824423 CAGCATACAGAGTAGGAAGCAGG - Intronic
1023111665 7:36818918-36818940 CAGGTGGGAGAGAAGGCAGACGG - Intergenic
1023619502 7:42055467-42055489 CAGCTAGCAGAGAGGGAGGAGGG - Intronic
1023749938 7:43362744-43362766 CAACAGGCAGAGAAGGAAGGAGG + Intronic
1024517786 7:50274517-50274539 CAGCTTGCTCAGGAGGAAGTGGG + Intergenic
1024688945 7:51778873-51778895 CAGTTTACAGAGCAGTAAGAAGG + Intergenic
1026451407 7:70532687-70532709 CATGTTGGAGAGAAGGAAGAAGG - Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1027874386 7:83749993-83750015 GAGCTTGCAGTGAACCAAGATGG - Intergenic
1028252045 7:88548030-88548052 TGGCTGGCAGAGAGGGAAGATGG + Intergenic
1028359563 7:89951565-89951587 TTGCTTGGTGAGAAGGAAGAAGG - Intergenic
1029453341 7:100655135-100655157 CAGCGTGCAGAGACGCAAGAAGG + Intronic
1029578739 7:101420903-101420925 CGGCCTGGAGAGGAGGAAGAAGG - Intronic
1029692364 7:102190818-102190840 CAGCCTGCAGAGATGGGAGGTGG - Intronic
1029694518 7:102204128-102204150 CAGCTCCCAGGGAGGGAAGAGGG - Intronic
1031252556 7:119406123-119406145 CAACGGGCAGAGAAGGAAAAAGG + Intergenic
1031490406 7:122380907-122380929 TAGCTTGAAGAGAAGGAAAACGG + Intronic
1032602312 7:133310831-133310853 CAGCTTCCATAGTAGGAAGTGGG + Intronic
1033008136 7:137589789-137589811 CCCCTTCCAAAGAAGGAAGAAGG + Intronic
1033159580 7:138983556-138983578 GAGTTTGCAGAGAATGGAGAAGG - Intergenic
1033345940 7:140525859-140525881 CTGCATGCCAAGAAGGAAGAAGG - Intronic
1034143635 7:148848585-148848607 CAGATGACAGAGAAGGCAGATGG + Intronic
1035537427 8:403035-403057 GAGCTTGCAGGGATGGCAGAGGG + Intergenic
1037718249 8:21418320-21418342 CAGGTTGCAGAGCAGAAAGTTGG - Intergenic
1037734396 8:21555108-21555130 CAGCTTACAGAGGAGAAGGAGGG + Intergenic
1038239824 8:25798216-25798238 CAGCCTGTAGGCAAGGAAGATGG + Intergenic
1038575995 8:28703401-28703423 CAGTTTGGAGAGAAGTAAGTCGG + Intronic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1039097788 8:33905100-33905122 AAGATAACAGAGAAGGAAGAAGG - Intergenic
1039324835 8:36473763-36473785 CAGCATGCAGAGAAGAGAGTGGG + Intergenic
1039339701 8:36634138-36634160 CAGAATGCAGAGGAGGAAGCTGG - Intergenic
1042548990 8:69976208-69976230 CAGCATATAGAGAAGGAAAAGGG + Intergenic
1042736585 8:71996228-71996250 CAGCTTGACTAGAAGGAAGATGG - Intronic
1043358471 8:79441465-79441487 CAGATCGGAGAGAAAGAAGAGGG + Intergenic
1043784298 8:84378182-84378204 TAGTTTGCAGAGAATTAAGAAGG - Intronic
1043798480 8:84577418-84577440 TTGCTGGCAGAGAAGGAAGTTGG + Intronic
1044221938 8:89679137-89679159 GAGCTTGCAGAGGAAGAAGCTGG + Intergenic
1044286506 8:90416635-90416657 CATCTAGCACAGAAGAAAGATGG + Intergenic
1044626989 8:94243533-94243555 CAGCTTGCAGTGAGCCAAGATGG + Intergenic
1045948842 8:107829074-107829096 GAGCTTGCAGTGAGGGAGGAAGG + Intergenic
1046547193 8:115667865-115667887 CAGCATGCAGAGTAGTAAGTTGG - Intronic
1047437568 8:124847588-124847610 CAGCTTCCACAGCAGGAAAAGGG + Intergenic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1048874012 8:138822555-138822577 AACCTTGCAGAGATGGAACAAGG - Intronic
1049001017 8:139825734-139825756 CAGCTTGCCCGGAAGGAAAAAGG + Intronic
1049012933 8:139899662-139899684 CAGCTTGCAGAGAAGGAAGATGG - Intronic
1049343528 8:142126587-142126609 CAGCTCGCAGGAGAGGAAGAGGG + Intergenic
1049529502 8:143147331-143147353 GAGTTTGGAGAGAAGGAGGATGG + Intergenic
1051622966 9:19070886-19070908 CAGACTGCAGAGTGGGAAGAAGG + Intronic
1052275997 9:26677414-26677436 AATCCTGCAGAGAAGGAAGTAGG - Intergenic
1052502848 9:29314876-29314898 CAGTTTGTAGAGGTGGAAGAAGG - Intergenic
1053360403 9:37482572-37482594 CATTTTTCAGAGAAGGAAAATGG - Intergenic
1053436257 9:38076517-38076539 AAGCTTCCACAGAAGGAAAAGGG - Intergenic
1054794608 9:69288695-69288717 CATCTTCCAGAAAGGGAAGAGGG - Intergenic
1054805978 9:69396081-69396103 TAGAATGCAGAGCAGGAAGAGGG + Intergenic
1055122299 9:72675582-72675604 CATCATGCAGAGAAGGACAATGG - Intronic
1055978444 9:81976835-81976857 CAGCTTGCAGCGAGCCAAGATGG - Intergenic
1056625568 9:88250217-88250239 CAGCTTGCAGAGGAGCAAGAGGG + Intergenic
1056848857 9:90063885-90063907 CAGCCTGCAGAGAAAGAAGAGGG + Intergenic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057524062 9:95784075-95784097 GAGCTGGCTGGGAAGGAAGAGGG - Intergenic
1057796818 9:98163665-98163687 CATATTGCATAGCAGGAAGAGGG - Intronic
1057828268 9:98387849-98387871 CTGCTTGCAAAGAAGGAATTTGG - Intronic
1058459654 9:105171117-105171139 CAGCATAGAGAGAAAGAAGATGG + Intergenic
1059094284 9:111395836-111395858 CAGTTTGTATAGAAGGAAGGAGG - Intronic
1059380135 9:113916986-113917008 CATCTTGTTCAGAAGGAAGAGGG + Intronic
1059492663 9:114682038-114682060 CAGCTGGCAGAGTAGACAGAAGG + Intergenic
1059511871 9:114855672-114855694 CATTTTGCAGAGAAGGAAGAAGG + Intergenic
1059746264 9:117204585-117204607 CAGCTTTAAGAGCTGGAAGAGGG + Intronic
1059819599 9:117957295-117957317 CACCTTGCTGTGAAGGGAGAAGG + Intergenic
1059998071 9:119933224-119933246 CTGCCTGCAGAAAAGCAAGAAGG - Intergenic
1060059543 9:120446771-120446793 CATCTTGGGAAGAAGGAAGAAGG - Intronic
1060300188 9:122370591-122370613 CAGTCTGCAGAGAAGAAAGGGGG - Intronic
1060374336 9:123105229-123105251 CACCAGGCAGAGATGGAAGAGGG + Intergenic
1061037402 9:128121326-128121348 CAGCTGGCAGGGAACGAAGGAGG - Intronic
1061231263 9:129317180-129317202 AAGTGTGCAGAGAAGGAACAAGG - Intergenic
1061605622 9:131708474-131708496 CAGCTTGAGGAGGAGGAAGTTGG - Intronic
1061888498 9:133605491-133605513 CAGGTGGCAGAGGTGGAAGAAGG - Intergenic
1062154205 9:135037339-135037361 CAGCAGGCACAGAAGGCAGAGGG + Intergenic
1062666815 9:137678002-137678024 GAGCTTGCAGTGAACCAAGATGG + Intronic
1185840313 X:3383445-3383467 CTATTTGCAGAGAAGGAAGGTGG - Intergenic
1186398554 X:9235122-9235144 CAGCCTTCATGGAAGGAAGAAGG - Intergenic
1186653887 X:11592143-11592165 CATCCTGCAGAGGAGGAAGATGG + Intronic
1187715387 X:22097448-22097470 CTGCTGTCAGAGCAGGAAGAAGG + Intronic
1190067218 X:47249610-47249632 CATTTTGCAGATAAGGAAGCAGG + Intergenic
1191604071 X:63042616-63042638 CAGCCTGCAGAAAAGGAATAGGG + Intergenic
1191701671 X:64048465-64048487 GAGCTTCCAGAGGAGGAAGAAGG + Intergenic
1191880068 X:65836996-65837018 CATCTTACAGAAGAGGAAGAAGG - Intergenic
1192259210 X:69494128-69494150 CAGACTTCAGAGAAGAAAGAGGG + Intergenic
1192491538 X:71580009-71580031 GAGGTTGGACAGAAGGAAGAAGG + Intronic
1192785803 X:74334409-74334431 GAGCTTGCAGTGAGGCAAGATGG - Intergenic
1192926581 X:75760233-75760255 CTGCTTGCAGGGAACAAAGAAGG + Intergenic
1193270879 X:79529787-79529809 CAGCTTCCAGAGAGGGAAACTGG - Intergenic
1193758710 X:85440149-85440171 CAGCTTCCAGAGGAAGAAGAAGG - Intergenic
1194124358 X:89995707-89995729 CAGCTTGCAGTGAGCCAAGATGG - Intergenic
1194393391 X:93348430-93348452 CAGCTTGCAGACAGCGAACATGG - Intergenic
1194421019 X:93673067-93673089 CCGCTTGTATAGAAAGAAGAGGG - Exonic
1195859265 X:109363798-109363820 CGGCATGCAGAGAGGGAACAAGG - Intergenic
1195903027 X:109818260-109818282 GAGCTTGCAGTGAGGGGAGATGG - Intergenic
1197206704 X:123797225-123797247 GAGCTTGCAGTGAACCAAGATGG + Intergenic
1200078437 X:153563691-153563713 GAGCTTGAAGAGCAAGAAGAGGG - Intronic
1201543274 Y:15132298-15132320 AAGCTTGCAGAGGAAGAAAAAGG + Intergenic