ID: 1049015010

View in Genome Browser
Species Human (GRCh38)
Location 8:139914028-139914050
Sequence CATTGTGTGCAGCAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049015000_1049015010 28 Left 1049015000 8:139913977-139913999 CCATGGAGGGGTCCTCACACCTG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1049015010 8:139914028-139914050 CATTGTGTGCAGCAGCTGCAAGG No data
1049015006_1049015010 -1 Left 1049015006 8:139914006-139914028 CCCCTGCCGGAAGACACTGCTGC 0: 1
1: 0
2: 1
3: 16
4: 117
Right 1049015010 8:139914028-139914050 CATTGTGTGCAGCAGCTGCAAGG No data
1049015007_1049015010 -2 Left 1049015007 8:139914007-139914029 CCCTGCCGGAAGACACTGCTGCA 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1049015010 8:139914028-139914050 CATTGTGTGCAGCAGCTGCAAGG No data
1049015003_1049015010 16 Left 1049015003 8:139913989-139914011 CCTCACACCTGGGTTCACCCCTG 0: 1
1: 0
2: 2
3: 24
4: 288
Right 1049015010 8:139914028-139914050 CATTGTGTGCAGCAGCTGCAAGG No data
1049015009_1049015010 -7 Left 1049015009 8:139914012-139914034 CCGGAAGACACTGCTGCATTGTG 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1049015010 8:139914028-139914050 CATTGTGTGCAGCAGCTGCAAGG No data
1049015005_1049015010 9 Left 1049015005 8:139913996-139914018 CCTGGGTTCACCCCTGCCGGAAG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1049015010 8:139914028-139914050 CATTGTGTGCAGCAGCTGCAAGG No data
1049015008_1049015010 -3 Left 1049015008 8:139914008-139914030 CCTGCCGGAAGACACTGCTGCAT 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1049015010 8:139914028-139914050 CATTGTGTGCAGCAGCTGCAAGG No data
1049014999_1049015010 29 Left 1049014999 8:139913976-139913998 CCCATGGAGGGGTCCTCACACCT 0: 1
1: 0
2: 1
3: 7
4: 108
Right 1049015010 8:139914028-139914050 CATTGTGTGCAGCAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049015010 Original CRISPR CATTGTGTGCAGCAGCTGCA AGG Intronic
No off target data available for this crispr